MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-030I07
Chromosome	1 (Build37)
Map Location	58,975,190 - 58,976,278
singlet/doublet	singlet
Overlap gene	Trak2
Upstream gene	2810022L02Rik, Kctd18, Sgol2, Aox1, Aox3, Aox4, Aox3l1, EG628262, Bzw1, Clk1, Ppil3, Nif3l1, Orc2l, BC049806, Ndufb3, EG667397, Als2cr12, Cflar, LOC100042431, Casp8, EG667419
Downstream gene	Als2cr2, 4930408G06Rik, EG667447, Als2cr11, Als2cr4, Mpp4, Als2, Als2cr7, Fzd7, Gm973, Sumo1, LOC100042476, Nol5, B430105G09Rik, LOC100043007, Bmpr2, Als2cr13
Link	Open Mouse BAC browser

Click to get alignment info.

name	2810022L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67198 MGI:1914448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51960 MGI:3603813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgol2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68549 MGI:1098767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11761 MGI:88035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71724 MGI:1918974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aox4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71872 MGI:1919122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aox3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213043 MGI:3529596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628262 MGI:3643892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Bzw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66882 MGI:1914132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12747 MGI:107403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppil3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70225 MGI:1917475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nif3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65102 MGI:1929485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Orc2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18393 MGI:1328306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC049806 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213056 MGI:2674086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66495 MGI:1913745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667397 MGI:3646346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Als2cr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108812 MGI:1918359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cflar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12633 MGI:1336166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Casp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12370 MGI:1261423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG667419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667419 MGI:3647857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Trak2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70827 MGI:1918077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227154 MGI:2144047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930408G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68179 MGI:1915429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein

name	EG667447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667447 MGI:3644495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Als2cr11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73463 MGI:1920713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381259 MGI:2138365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mpp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227157 MGI:2386681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74018 MGI:1921268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271697 MGI:3583944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 10 Proteins

name	Fzd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14369 MGI:108570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm973 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381260 MGI:2685819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22218 MGI:1197010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Nol5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55989 MGI:1933184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B430105G09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320907 MGI:2445016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs

name	LOC100043007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Bmpr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12168 MGI:1095407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72750 MGI:1920000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2810022L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801973 GeneID:67198 MGI:1914448
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810022L02 gene transcript_id : NM_144882.3

name	Kctd18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345025 GeneID:51960 MGI:3603813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 18 transcript_id : NM_030211.2

name	Sgol2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092284 GeneID:68549 MGI:1098767
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shugoshin-like 2 (S. pombe) transcript_id : NM_199007.1

name	Aox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347466 GeneID:11761 MGI:88035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde oxidase 1 transcript_id : NM_009676.2

name	Aox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205419 GeneID:71724 MGI:1918974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde oxidase 3 transcript_id : NM_023617.2

name	Aox4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205421 GeneID:71872 MGI:1919122
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde oxidase 4 transcript_id : NM_023631.2

name	Aox3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606022 GeneID:213043 MGI:3529596
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde oxidase 3-like 1 transcript_id : NM_001008419.1

name	EG628262 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363430 GeneID:628262 MGI:3643892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG628262 transcript_id : XM_900516.2

name	Bzw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892965 GeneID:66882 MGI:1914132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic leucine zipper and W2 domains 1 transcript_id : NM_025824.3

name	Clk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038131 GeneID:12747 MGI:107403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC-like kinase 1 transcript_id : NM_009905.2

name	Clk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038134 GeneID:12747 MGI:107403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC-like kinase 1 transcript_id : NM_001042634.1

name	Ppil3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374499 GeneID:70225 MGI:1917475
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase (cyclophilin)-like 3 transcript_id : NM_027351.2

name	Ppil3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802141 GeneID:70225 MGI:1917475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase (cyclophilin)-like 3 transcript_id : NM_027374.2

name	Nif3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41056092 GeneID:65102 MGI:1929485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ngg1 interacting factor 3-like 1 (S. pombe) transcript_id : NM_022988.2

name	Orc2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982141 GeneID:18393 MGI:1328306
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : origin recognition complex, subunit 2-like (S. cerevisiae) transcript_id : NM_008765.2

name	Orc2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909305 GeneID:18393 MGI:1328306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : origin recognition complex, subunit 2-like (S. cerevisiae) transcript_id : NM_001025378.1

name	BC049806 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358375 GeneID:213056 MGI:2674086
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049806 transcript_id : NM_172513.2

name	Ndufb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366150 GeneID:66495 MGI:1913745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex 3 transcript_id : NM_025597.2

name	Als2cr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129876 GeneID:108812 MGI:1918359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 (human) transcript_id : NM_175370.3

name	Cflar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131887384 GeneID:12633 MGI:1336166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CASP8 and FADD-like apoptosis regulator transcript_id : NM_207653.3

name	Cflar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131889125 GeneID:12633 MGI:1336166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CASP8 and FADD-like apoptosis regulator transcript_id : NM_009805.4

name	Casp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626095 GeneID:12370 MGI:1261423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 8 transcript_id : NM_009812.2

name	Casp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056577 GeneID:12370 MGI:1261423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 8 transcript_id : NM_001080126.1

name	Trak2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254202 GeneID:70827 MGI:1918077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein, kinesin binding 2 transcript_id : NM_172406.2

name	Als2cr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239985 GeneID:227154 MGI:2144047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 (human) transcript_id : NM_172656.5

name	4930408G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233852 GeneID:68179 MGI:1915429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein product : RIKEN cDNA 4930408G06 gene transcript_id : XM_619629.4

name	EG667447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233856 GeneID:667447 MGI:3644495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG667447 transcript_id : XM_990603.2

name	Als2cr11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382477 GeneID:73463 MGI:1920713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (human) transcript_id : NM_175200.3

name	Als2cr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716016 GeneID:381259 MGI:2138365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 transcript_id : NM_001033449.1

name	Als2cr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801956 GeneID:381259 MGI:2138365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 transcript_id : NM_001037812.2

name	Mpp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802601 GeneID:227157 MGI:2386681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) transcript_id : NM_145143.2

name	Als2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366376 GeneID:74018 MGI:1921268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) homolog (human) transcript_id : NM_028717.3

name	Als2cr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363445 GeneID:271697 MGI:3583944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 10 Proteins product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7 transcript_id : XM_990659.1

name	Fzd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254636 GeneID:14369 MGI:108570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frizzled homolog 7 (Drosophila) transcript_id : NM_008057.2

name	Gm973 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244084 GeneID:381260 MGI:2685819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 973, (NCBI) transcript_id : NM_001013771.2

name	Sumo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244086 GeneID:22218 MGI:1197010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMT3 suppressor of mif two 3 homolog 1 (yeast) transcript_id : NM_009460.2

name	Nol5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407049 GeneID:55989 MGI:1933184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 5 transcript_id : NM_018868.2

name	B430105G09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233858 GeneID:320907 MGI:2445016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs product : RIKEN cDNA B430105G09 gene transcript_id : XM_900601.3

name	LOC100043007 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233899 GeneID:100043007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical protein LOC100043007 transcript_id : XM_001479403.1

name	Bmpr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801679 GeneID:12168 MGI:1095407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenic protein receptor, type II (serine/threonine kinase) transcript_id : NM_007561.2

name	Als2cr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368733 GeneID:72750 MGI:1920000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 (human) transcript_id : NM_001037725.2

name	Als2cr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556210 GeneID:72750 MGI:1920000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 (human) transcript_id : NM_001003946.1

name	2810022L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536268 GeneID:67198 MGI:1914448
definition	codon_start : 1 product : hypothetical protein LOC67198 protein_id : NP_659131.1

name	Kctd18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336039 CCDS:CCDS14968.1 GeneID:51960 MGI:3603813
definition	codon_start : 1 exception : mismatches in translation product : potassium channel tetramerisation domain containing 18 protein_id : NP_084487.1

name	Sgol2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092285 GeneID:68549 MGI:1098767
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence IEA]; GO:0045132 - meiotic chromosome segregation [Evidence IEA] codon_start : 1 product : tripin protein_id : NP_950172.1

name	Aox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347467 GeneID:11761 MGI:88035
definition	GO_function : GO:0051537 - 2 iron, 2 sulfur cluster binding [Evidence IEA]; GO:0004031 - aldehyde oxidase activity [Evidence IDA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030151 - molybdenum ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : retinal oxidase; aldehyde oxidase 2 product : aldehyde oxidase 1 protein_id : NP_033806.2

name	Aox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205420 CCDS:CCDS14969.1 GeneID:71724 MGI:1918974
definition	GO_function : GO:0051537 - 2 iron, 2 sulfur cluster binding [Evidence IEA]; GO:0004031 - aldehyde oxidase activity [Evidence IDA]; GO:0009055 - electron carrier activity [Evidence ISS] [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030151 - molybdenum ion binding [Evidence IDA] codon_start : 1 note : aldehyde oxidase structural homolog 2; aldehyde oxidase 1 product : aldehyde oxidase 3 protein_id : NP_076106.2

name	Aox4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205422 CCDS:CCDS14970.1 GeneID:71872 MGI:1919122
definition	GO_function : GO:0004031 - aldehyde oxidase activity [Evidence ISS]; GO:0009055 - electron carrier activity [Evidence IEA] [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030151 - molybdenum ion binding [Evidence ISS] codon_start : 1 note : aldehyde oxidase structural homolog 2 product : aldehyde oxidase 4 protein_id : NP_076120.2

name	Aox3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606023 GeneID:213043 MGI:3529596
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : aldehyde oxidase-like protein 3 product : aldehyde oxidase 3-like 1 protein_id : NP_001008419.1

name	EG628262 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363431 GeneID:628262 MGI:3643892
definition	codon_start : 1 product : hypothetical protein protein_id : XP_905609.2

name	Bzw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385296 CCDS:CCDS14971.1 GeneID:66882 MGI:1914132
definition	codon_start : 1 product : basic leucine zipper and W2 domains 1 protein_id : NP_080100.1

name	Clk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111038135 GeneID:12747 MGI:107403
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0018107 - peptidyl-threonine phosphorylation [Evidence IDA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; CDC-like kinase product : CDC-like kinase 1 isoform 1 protein_id : NP_001036099.1

name	Clk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753446 GeneID:12747 MGI:107403
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0018107 - peptidyl-threonine phosphorylation [Evidence IDA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; CDC-like kinase product : CDC-like kinase 1 isoform 2 protein_id : NP_034035.1

name	Ppil3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746159 GeneID:70225 MGI:1917475
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cyclophilin-like 3 product : peptidylprolyl isomerase-like 3 isoform 1 protein_id : NP_081627.1

name	Ppil3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28269677 GeneID:70225 MGI:1917475
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; cyclophilin-like 3 product : peptidylprolyl isomerase-like 3 isoform 2 protein_id : NP_081650.1

name	Nif3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41056093 CCDS:CCDS14973.1 GeneID:65102 MGI:1929485
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] codon_start : 1 note : Ngg1 interacting factor 3 homolog (S. pombe)-like 1 product : Ngg1 interacting factor 3-like 1 protein_id : NP_075364.2

name	Orc2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909306 CCDS:CCDS14974.1 GeneID:18393 MGI:1328306
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0000939 - inner kinetochore of condensed chromosome [Evidence IDA]; GO:0005664 - nuclear origin of replication recognition complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000808 - origin recognition complex [Evidence IEA] GO_function : GO:0003688 - DNA replication origin binding [Evidence IDA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant b product : origin recognition complex, subunit 2-like isoform B protein_id : NP_001020549.1

name	Orc2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679176 CCDS:CCDS14975.1 GeneID:18393 MGI:1328306
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0000939 - inner kinetochore of condensed chromosome [Evidence IDA]; GO:0005664 - nuclear origin of replication recognition complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000808 - origin recognition complex [Evidence IEA] GO_function : GO:0003688 - DNA replication origin binding [Evidence IDA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant a product : origin recognition complex, subunit 2-like isoform A protein_id : NP_032791.1

name	BC049806 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358376 CCDS:CCDS14976.1 GeneID:213056 MGI:2674086
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC213056 protein_id : NP_766101.2

name	Ndufb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385054 CCDS:CCDS14977.1 GeneID:66495 MGI:1913745
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex 3 protein_id : NP_079873.1

name	Als2cr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425074 GeneID:108812 MGI:1918359
definition	codon_start : 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 protein_id : NP_780579.1

name	Cflar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559393 CCDS:CCDS14978.1 GeneID:12633 MGI:1336166
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0043154 - negative regulation of caspase activity [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : CASP8 and FADD-like apoptosis regulator isoform 1 protein_id : NP_997536.1

name	Cflar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198303 GeneID:12633 MGI:1336166
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0043154 - negative regulation of caspase activity [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : CASP8 and FADD-like apoptosis regulator isoform 2 protein_id : NP_033935.2

name	Casp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056578 GeneID:12370 MGI:1261423
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030690 - Noc1p-Noc2p complex [Evidence IMP]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IDA] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence IMP]; GO:0001841 - neural tube formation [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : Fas-linked ICE-like protease product : caspase 8 protein_id : NP_001073595.1

name	Casp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859520 CCDS:CCDS14979.1 GeneID:12370 MGI:1261423
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030690 - Noc1p-Noc2p complex [Evidence IMP]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IDA] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence IMP]; GO:0001841 - neural tube formation [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : Fas-linked ICE-like protease product : caspase 8 protein_id : NP_033942.1

name	Trak2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254203 CCDS:CCDS14980.1 GeneID:70827 MGI:1918077
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 product : trafficking protein, kinesin binding 2 protein_id : NP_765994.2

name	Als2cr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239986 CCDS:CCDS14981.1 GeneID:227154 MGI:2144047
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0000902 - cell morphogenesis [Evidence IDA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence TAS]; GO:0007254 - JNK cascade [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : polyploidy associated protein kinase product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 protein_id : NP_766244.4

name	4930408G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233853 GeneID:68179 MGI:1915429
definition	codon_start : 1 product : hypothetical protein LOC68179 protein_id : XP_619629.4

name	EG667447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233857 GeneID:667447 MGI:3644495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995697.2

name	Als2cr11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424816 CCDS:CCDS14982.1 GeneID:73463 MGI:1920713
definition	codon_start : 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 protein_id : NP_780409.1

name	Als2cr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716017 CCDS:CCDS14983.1 GeneID:381259 MGI:2138365
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 isoform 1 protein_id : NP_001028621.1

name	Als2cr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715982 CCDS:CCDS14984.1 GeneID:381259 MGI:2138365
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 isoform 2 protein_id : NP_001032901.1

name	Mpp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553099 GeneID:227157 MGI:2386681
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : discs large homolog 6; membrane palmitoylated protein 4 product : membrane protein, palmitoylated 4 protein_id : NP_660125.1

name	Als2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505210 GeneID:74018 MGI:1921268
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005769 - early endosome [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS]; GO:0042598 - vesicular fraction [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence ISS]; GO:0005097 - Rab GTPase activator activity [Evidence ISS]; GO:0017137 - Rab GTPase binding [Evidence ISS]; GO:0030675 - Rac GTPase activator activity [Evidence ISS]; GO:0048365 - Rac GTPase binding [Evidence ISS]; GO:0005087 - Ran guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007032 - endosome organization and biogenesis [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP] codon_start : 1 exception : mismatches in translation product : alsin protein_id : NP_082993.1

name	Als2cr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363446 GeneID:271697 MGI:3583944
definition	codon_start : 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7 protein_id : XP_995753.1

name	Fzd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254637 CCDS:CCDS14985.1 GeneID:14369 MGI:108570
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004926 - non-G-protein coupled 7TM receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : frizzled 7 protein_id : NP_032083.2

name	Gm973 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244085 GeneID:381260 MGI:2685819
definition	codon_start : 1 product : hypothetical protein LOC381260 protein_id : NP_001013793.2

name	Sumo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678489 GeneID:22218 MGI:1197010
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0016605 - PML body [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019949 - SUMO conjugating enzyme activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin-like 1; SUMO-1 related peptidase product : SMT3 suppressor of mif two 3 homolog 1 protein_id : NP_033486.1

name	Nol5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407050 GeneID:55989 MGI:1933184
definition	GO_component : GO:0005730 - nucleolus [Evidence IC] GO_function : GO:0030519 - snoRNP binding [Evidence ISS] codon_start : 1 note : SIK similar protein product : nucleolar protein 5 protein_id : NP_061356.2

name	LOC100043007 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233900 GeneID:100043007
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479453.1

name	B430105G09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363449 GeneID:320907 MGI:2445016
definition	codon_start : 1 product : hypothetical protein LOC320907 protein_id : XP_905694.2

name	Bmpr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680804 GeneID:12168 MGI:1095407
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IEA] codon_start : 1 product : bone morphogenic protein receptor, type II (serine/threonine kinase) protein_id : NP_031587.1

name	Als2cr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582792 CCDS:CCDS14986.1 GeneID:72750 MGI:1920000
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 isoform a protein_id : NP_001032814.1

name	EG667397 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667397
definition	number : 2 pseudo : _no_value

name	EG667397 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667397
definition	number : 1 pseudo : _no_value

name	LOC100042431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042431
definition	number : 1 pseudo : _no_value

name	LOC100042431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042431
definition	number : 2 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 14 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 13 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 12 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 11 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 10 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 9 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 8 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 7 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 6 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 5 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 4 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 3 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 2 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 1 pseudo : _no_value

name	LOC100042476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042476
definition	number : 1 pseudo : _no_value

name	LOC100042476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042476
definition	number : 2 pseudo : _no_value

name	LOC100042476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042476
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:28562
definition	standard_name : RH18299

name	(CDS detail)
type	STS
link
xref	UniSTS:164116
definition	standard_name : AI842453

name	(CDS detail)
type	STS
link
xref	UniSTS:158796
definition	standard_name : AI480531

name	(CDS detail)
type	STS
link
xref	UniSTS:178399
definition	standard_name : AA987173

name	(CDS detail)
type	STS
link
xref	UniSTS:123256
definition	standard_name : 15.MMHAP26FLE3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:167300
definition	standard_name : D1Ertd8e

name	(CDS detail)
type	STS
link
xref	UniSTS:234132
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165079
definition	standard_name : AV008062

name	(CDS detail)
type	STS
link
xref	UniSTS:158797
definition	standard_name : AI196512

name	(CDS detail)
type	STS
link
xref	UniSTS:128736
definition	standard_name : MT4983

name	(CDS detail)
type	STS
link
xref	UniSTS:128737
definition	standard_name : D1Mit376.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128899
definition	standard_name : D1Mit531

name	(CDS detail)
type	STS
link
xref	UniSTS:165080
definition	standard_name : AI326299

name	(CDS detail)
type	STS
link
xref	UniSTS:128556
definition	standard_name : D1Mit214

name	(CDS detail)
type	STS
link
xref	UniSTS:142250
definition	standard_name : D1Mit5.2

name	(CDS detail)
type	STS
link
xref	UniSTS:162173
definition	standard_name : RH125351

name	(CDS detail)
type	STS
link
xref	UniSTS:125665
definition	standard_name : U11054

name	(CDS detail)
type	STS
link
xref	UniSTS:207167
definition	standard_name : AW047618

name	(CDS detail)
type	STS
link
xref	UniSTS:158795
definition	standard_name : AU041563

name	(CDS detail)
type	STS
link
xref	UniSTS:125707
definition	standard_name : U27457

name	(CDS detail)
type	STS
link
xref	UniSTS:162905
definition	standard_name : RH126197

name	(CDS detail)
type	STS
link
xref	UniSTS:128682
definition	standard_name : D1Mit324

name	(CDS detail)
type	STS
link
xref	UniSTS:158798
definition	standard_name : AF067834

name	(CDS detail)
type	STS
link
xref	UniSTS:128933
definition	standard_name : D1Mit75

name	(CDS detail)
type	STS
link
xref	UniSTS:178400
definition	standard_name : AI646576

name	(CDS detail)
type	STS
link
xref	UniSTS:207162
definition	standard_name : AU021929

name	(CDS detail)
type	STS
link
xref	UniSTS:128778
definition	standard_name : D1Mit414

name	(CDS detail)
type	STS
link
xref	UniSTS:141238
definition	standard_name : Casp8

name	(CDS detail)
type	STS
link
xref	UniSTS:498225
definition	standard_name : Casp8

name	(CDS detail)
type	STS
link
xref	UniSTS:158798
definition	standard_name : AF067834

name	(CDS detail)
type	STS
link
xref	UniSTS:128933
definition	standard_name : D1Mit75

name	(CDS detail)
type	STS
link
xref	UniSTS:158794
definition	standard_name : AI480836

name	(CDS detail)
type	STS
link
xref	UniSTS:178398
definition	standard_name : AW046271

name	(CDS detail)
type	STS
link
xref	UniSTS:234134
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:222101
definition	standard_name : RH140019

name	(CDS detail)
type	STS
link
xref	UniSTS:234136
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:160067
definition	standard_name : AA792893

name	(CDS detail)
type	STS
link
xref	UniSTS:164114
definition	standard_name : AI853305

name	(CDS detail)
type	STS
link
xref	UniSTS:128500
definition	standard_name : D1Mit161

name	(CDS detail)
type	STS
link
xref	UniSTS:234135
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128629
definition	standard_name : D1Mit279

name	(CDS detail)
type	STS
link
xref	UniSTS:124685
definition	standard_name : 48.MMHAP34FRH12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123060
definition	standard_name : 10.MMHAP9FRD7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128657
definition	standard_name : D1Mit302

name	(CDS detail)
type	STS
link
xref	UniSTS:273019
definition	standard_name : PMC316619P2

name	(CDS detail)
type	STS
link
xref	UniSTS:498742
definition	standard_name : Fzd7

name	(CDS detail)
type	STS
link
xref	UniSTS:178397
definition	standard_name : AW554518

name	(CDS detail)
type	STS
link
xref	UniSTS:234137
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122762
definition	standard_name : 04.MHAa63a4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:43024
definition	standard_name : D17S756

name	(CDS detail)
type	STS
link
xref	UniSTS:123545
definition	standard_name : 21.MMHAP94FLG3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178396
definition	standard_name : AW546137

name	(CDS detail)
type	STS
link
xref	UniSTS:185437
definition	standard_name : BB189135

name	(CDS detail)
type	STS
link
xref	UniSTS:128562
definition	standard_name : D1Mit22

clone name	MSMg01-056D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111G18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-409G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-030I07.b	B6Ng01-030I07.g
ACC	DH860399	DH860400
length	1,077	945
definition	DH860399\|Mus musculus domesticus DNA, BAC clone: B6Ng01-030I07, 5' end.	DH860400\|Mus musculus domesticus DNA, BAC clone: B6Ng01-030I07, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaaacagtctcaaagacaaatctgttttctctcatttgtgcttgt tgttcttacatatagctacgtaagatgcctgtgtatgtgacaaaaaagca ggggtgaacctatgtagagggcaaaggggatggcaaaggtgggggaacag gaggtaatatgcttaacatatggtatattcttactttaaaatctttaaag tcctatatttttaaagaaagtcaaggctttctgttactcaggaggaagga tatcatgattagctttggaaacaaaccttttcaaatgttttcttagatct taatacatcccaactgtttgttgttgctgctgtattccaaatctggcagt ccttttactttttacataggtggacgaactccttattcccctcctgcact accaagaaaaaggaagtgtctgttacctccattgtcagctgtcgctgggc atctttggaagcctgcaggtgaagtcttagttcttccttctcgatcacat gctgacaacatacaagagggacatgtgaggcactccttcccaaagggagc ataagtacttcttcccttcaaagacacaccaagagtgtctatgtggggta cagtcttagcctacagcaggggacacatcacaagtaagagtgataattaa aagtacatgtgttccgagggtatggaccataaattcagcaatgacatcat atccttctcgggaaaatctaatatatttgcacaaataaatacagccttgt taggtgtttatgatatcccagcagaggagcagcactgagaacgaactctg cccagtgagtagcacttagaatgcagtgtcccaggacgtgcttagtgagc ctgggctgacagtgaatgacccacctctttcagtttgtgctgaaagtcta cgatctgagaaacagggaggagatctcttcttgttaccggagctctcgtc gctctttcccgacagctcttcatcatctggacatctgtgcattggtctcc ctggggacagagtgactttagaccaaattaagtagaattagagcagatgc tgtttacaacaactccggggggggggg	gaattcagtagcttaaggtattggctctggctttagagacaacaatagaa gggactactggaacaattggtgctggttagatggagctaagaaattagtg gtgattaagaagagaccagtatcactgaggtgaaatcttctgggaactat tttctgagagcacaaagcagctgtgttccagagatagccaaggttgtacc ttgtgctgcacctgaacttggaaatgtgtaagagtcacccaggtggtact ggtttcgaaggcatgaaggggtcaaggagagcagctgagaattggcactg tgagaggccagggaaggccattggtgaaggtgcagcttcatttacagtca tggcccaggaatgaaggggtcatgcaaaggaattgaggtttggcaccatg aagaaagactatgagagactattggtgacacctagttgcagcagaagact ctcagataattggagattccaataccttgggatgatcaccaagaacagta gcagcattggagttgagtcaaccagatcctagagtactacagagggcaga gctggagaaatgacccaaaccgtttggaggagcccaaaagatcatatgtg gatccccagacattggaacaagaagctgtaacattgaagttgctttggat acgccaagatgtcagagccatgcgatgcctgcagaggaaagctactaaca gggagtagaaccagcccaagagaacgaagtttgttgctgctgaatgctag atctgccacaacagttaaccagtatgaaaagaattggagatctgaagagc actttgaaactggacatggagacacagtttggagtttgacctgctagttt taggttttgatttggttcattattccttactatgatgttttggaactgta atatgtatcttgtgccatgtatgttggaggatgtgatttgcattt
quality values	Open. Hide. 50 47 35 36 50 25 24 43 50 40 33 43 47 47 61 49 36 55 55 52 61 52 52 61 55 61 61 10 11 10 12 13 22 12 12 12 12 28 26 59 59 59 61 61 59 59 59 59 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 59 55 61 61 59 59 52 31 23 27 18 25 25 26 29 27 43 61 61 61 59 59 59 59 59 59 59 59 59 59 61 59 61 61 59 61 61 59 61 61 61 61 61 55 61 61 61 61 59 61 59 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 59 61 61 59 59 59 59 59 59 59 59 59 59 55 55 49 59 49 49 59 52 59 49 59 59 61 61 61 59 59 59 59 59 61 59 55 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 59 59 59 59 61 59 59 59 61 61 61 61 59 49 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 59 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 59 59 49 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 59 52 61 59 59 59 59 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 50 61 55 61 61 61 61 61 61 61 61 61 61 50 61 53 61 61 61 61 61 61 61 61 61 47 43 61 61 53 61 61 61 53 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 47 61 50 61 61 52 61 50 61 52 52 61 61 61 53 53 61 61 61 61 53 61 61 53 50 61 61 61 39 61 61 43 53 52 61 61 61 50 50 61 61 53 53 61 43 61 61 53 50 57 47 47 47 27 43 50 38 53 53 36 53 50 53 42 45 53 47 24 57 50 53 53 43 35 27 40 43 53 38 53 53 53 34 50 40 52 50 53 57 42 53 53 43 57 57 42 53 32 57 53 36 45 40 53 47 42 30 57 30 53 45 57 47 47 57 52 33 50 45 45 45 39 53 45 40 29 41 52 38 50 31 34 52 37 36 40 53 45 50 53 57 50 53 57 57 15 16 52 30 38 37 42 39 30 38 30 57 43 50 45 21 31 42 53 17 34 31 57 41 32 27 41 23 38 45 46 36 32 36 38 53 39 30 53 29 39 22 57 50 35 28 32 42 23 23 42 52 57 53 42 42 50 33 18 35 7 33 43 14 39 38 24 52 30 30 50 37 38 14 52 12 17 13 53 20 22 40 36 31 42 31 47 39 20 31 32 37 41 29 37 32 10 31 29 29 52 19 19 21 34 40 27 37 24 35 29 29 47 25 40 35 29 21 13 10 24 21 9 17 29 34 29 37 41 18 23 33 35 12 23 36 29 32 53 35 24 30 25 32 19 24 29 27 30 17 31 24 29 29 26 48 44 18 11 32 18 29 27 51 32 33 24 15 29 51 23 34 27 30 32 35 20 19 21 10 11 7 12 20 18 27 7 19 20 37 34 18 11 5 12 5 5 7 10 18 33 13 20 12 16 38 14 28 15 28 29 39 16 11 28 30 7 29 5 11 13 29 15 9 5 25 8 18 7 7 15 20 15 23 29 11 21 41 28 19 51 31 23 36 23 7 17 12 18 21 21 27 19 7 33 23 19 16 26 23 33 8 14 19 27 17 14 22 29 12 5 15 24 26 26 13 34 34 27 29 19 15 5 9 14 23 13 28 51 51 39 22 14 6 5 6 5 17 24 16 9 10 29 31 19 6 26 12 17 5 12 18 11 9 38 20 21 6 11 12 30 38 19 28 23 6 38 19 24 7 5 27 15 5 7 7 8 10 51 33 21 15 14 5 6 11 8 7 5 10 9 21 27 25 35 31 33 15 14 14 4 4	Open. Hide. 55 61 39 47 61 49 12 14 13 10 7 11 25 26 19 41 52 59 43 59 59 59 59 59 59 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 59 59 61 59 59 61 61 59 59 59 39 59 28 30 37 44 35 52 49 61 59 59 61 61 59 59 61 61 61 61 59 59 61 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 59 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 59 61 59 61 59 59 59 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 59 61 61 59 61 61 61 59 61 59 59 59 61 61 59 59 59 59 61 61 59 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 59 59 59 59 59 61 59 59 59 59 59 52 61 59 61 61 61 61 61 61 59 59 61 59 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 61 52 61 61 61 61 61 61 61 61 59 59 59 43 59 61 59 61 61 61 61 61 59 59 59 61 61 61 61 61 59 61 59 59 61 61 61 59 61 61 55 59 61 59 61 61 59 59 61 59 59 59 43 59 59 61 59 61 59 61 59 61 59 61 61 61 59 61 61 59 43 52 59 59 59 59 59 59 43 55 61 61 55 61 55 55 61 61 55 55 61 55 61 61 61 61 55 52 52 52 55 52 52 55 61 55 55 52 55 61 55 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 55 43 47 47 55 61 61 61 61 61 61 61 61 61 61 61 61 38 61 61 61 61 61 61 61 61 61 61 38 37 61 61 61 61 61 61 61 52 50 50 61 61 61 50 50 52 61 43 61 45 43 50 43 50 53 61 50 61 50 53 53 61 61 52 53 53 53 53 61 37 36 31 50 50 45 61 61 53 17 33 20 14 21 24 61 53 61 47 39 43 27 42 47 45 61 53 61 32 61 53 61 61 61 50 61 61 43 53 61 52 45 53 47 16 24 32 53 61 53 50 61 53 53 61 53 39 57 53 26 53 53 53 45 52 47 53 30 45 30 45 39 53 45 53 53 40 53 53 28 47 53 47 47 53 34 28 47 34 28 57 45 47 32 53 43 50 42 25 32 53 53 45 47 52 36 34 34 43 45 42 38 53 53 45 53 38 45 50 50 43 40 57 45 53 52 38 33 38 40 23 52 35 8 17 34 50 42 53 45 41 33 12 53 22 18 37 17 53 50 45 30 45 38 45 45 50 32 40 39 23 33 38 19 38 24 15 27 17 31 41 28 39 40 29 43 50 22 16 57 29 30 39 42 39 27 47 28 34 37 24 30 42 53 42 31 12 11 46 14 37 38 34 17 25 30 17 52 53 42 26 15 39 26 30 50 32 29 43 36 42 21 9 34 27 36 42 22 25 25 32 32 42 53 25 41 23 17 27 42 14 26 19 52 28 32 32 40 19 24 29 31 37 42 29 44 42 35 35 36 40 33 40 30 33 31 24 31 29 40 40 37 24 43 30 28 18 27 22 41 34 57 40 29 40 57 29 27 19 35 19 29 34 27 24 40 24 21 20 21 10 5 10 18 28 32 33 14 48 20 30 17 14 47 30 28 32 39 30 5 22 29 14 17 16 23 44 48 32 24 10 39 18 47 47 32 32 16 15 44 30 17 13 5 25 7 10 14 9 9 38 34 32 18 7 12 24 28 13 29 20 25 18 9 43 14 46 46 23 14 23 26 24 15 28 33 7 7 17 8 10 17 29 16 11 10 18 30 31 46 16 29 18 14 14 10 10 4 7 5 25 25 25 27 26 33 5 7 6 7 6 7 13 19 18 28 27 21 7 7 19 19 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_58975190_58976278
seq2: B6Ng01-030I07.b_47_1123

seq1  GAATTCAAACAGTCTCAAAGACAAATCTGTTTTCTCTCATTTGTGCTTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAACAGTCTCAAAGACAAATCTGTTTTCTCTCATTTGTGCTTGT  50

seq1  TGTTCTTACATATAGCTACGTAAGATGCCTGTGTATGTGACAAAAAAGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCTTACATATAGCTACGTAAGATGCCTGTGTATGTGACAAAAAAGCA  100

seq1  GGGGTGAACCTATGTAGAGGGCAAAGGGGATGGCAAAGGTGGGGGAACAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTGAACCTATGTAGAGGGCAAAGGGGATGGCAAAGGTGGGGGAACAG  150

seq1  GAGGTAATATGCTTAACATATGGTATATTCTTACTTTAAAATCTTTAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTAATATGCTTAACATATGGTATATTCTTACTTTAAAATCTTTAAAG  200

seq1  TCCTATATTTTTAAAGAAAGTCAAGGCTTTCTGTTACTCAGGAGGAAGGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTATATTTTTAAAGAAAGTCAAGGCTTTCTGTTACTCAGGAGGAAGGA  250

seq1  TATCATGATTAGCTTTGGAAACAAACCTTTTCAAATGTTTTCTTAGATCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCATGATTAGCTTTGGAAACAAACCTTTTCAAATGTTTTCTTAGATCT  300

seq1  TAATACATCCCAACTGTTTGTTGTTGCTGCTGTATTCCAAATCTGGCAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATACATCCCAACTGTTTGTTGTTGCTGCTGTATTCCAAATCTGGCAGT  350

seq1  CCTTTTACTTTTTACATAGGTGGACGAACTCCTTATTCCCCTCCTGCACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTTACTTTTTACATAGGTGGACGAACTCCTTATTCCCCTCCTGCACT  400

seq1  ACCAAGAAAAAGGAAGTGTCTGTTACCTCCATTGTCAGCTGTCGCTGGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAGAAAAAGGAAGTGTCTGTTACCTCCATTGTCAGCTGTCGCTGGGC  450

seq1  ATCTTTGGAAGCCTGCAGGTGAAGTCTTAGTTCTTCCTTCTCGATCACAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTGGAAGCCTGCAGGTGAAGTCTTAGTTCTTCCTTCTCGATCACAT  500

seq1  GCTGACAACATACAAGAGGGACATGTGAGGCACTCCTTCCCAAAGGGAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGACAACATACAAGAGGGACATGTGAGGCACTCCTTCCCAAAGGGAGC  550

seq1  ATAAGTACTTCTTCCCTTCAAAGACACACCAAGAGTGTCTATGTGGGGTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGTACTTCTTCCCTTCAAAGACACACCAAGAGTGTCTATGTGGGGTA  600

seq1  CAGTCTTAGCCTACAGCAGGGGACACATCACAAGTAAGAGTGATAATTAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTTAGCCTACAGCAGGGGACACATCACAAGTAAGAGTGATAATTAA  650

seq1  AAGTACATGTGTTCCGAGGGTATGGACCATAAATTCAGCAATGACATCAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTACATGTGTTCCGAGGGTATGGACCATAAATTCAGCAATGACATCAT  700

seq1  ATCCTTCTCGGGAAAATCTAATATATTTGCACAAATAAATACAGCCTTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTCTCGGGAAAATCTAATATATTTGCACAAATAAATACAGCCTTGT  750

seq1  TAGGTGTTTATGATATCCCAGCAGAGGAGCAGCACTGAGAACGAACTCTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTGTTTATGATATCCCAGCAGAGGAGCAGCACTGAGAACGAACTCTG  800

seq1  CCCAGTGAGTAGCACTTAGAATGCAGTGTCCCAGGACCGTGCTTAGTGAG  850
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  CCCAGTGAGTAGCACTTAGAATGCAGTGTCCCAGGA-CGTGCTTAGTGAG  849

seq1  CCTGGGCTGACAGTGAATGACCCACCTCTTTCAGTTTGTGCTGAAGGTCT  900
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CCTGGGCTGACAGTGAATGACCCACCTCTTTCAGTTTGTGCTGAAAGTCT  899

seq1  ACGATCTGAGACAGCAGGGAGGAGATCTCCTCTTGGTACCGGAGCAGCTC  950
      ||||||||||| | ||||||||||||||| ||||| |||||||||  |||
seq2  ACGATCTGAGA-AACAGGGAGGAGATCTCTTCTTGTTACCGGAGC-TCTC  947

seq1  GTCGCTCTTTCCCGACAGCTCTTCAGTCATTCTGGACATCTGTGCATTGG  1000
      ||||||||||||||||||||||||| ||| ||||||||||||||||||||
seq2  GTCGCTCTTTCCCGACAGCTCTTCA-TCA-TCTGGACATCTGTGCATTGG  995

seq1  TCTCACCTGGGGACAGAGTGACATTTAGAACCAGAATAAAGGTAGAATTA  1050
      |||| ||||||||||||||||| ||||| |||| | |||  |||||||||
seq2  TCTC-CCTGGGGACAGAGTGAC-TTTAG-ACCAAATTAA--GTAGAATTA  1040

seq1  GAAGCAGATGCTGTTTTACAACAAGCACGGGGGGGGGGG  1089
      | ||||||||||| ||||||||||   ||||||||||||
seq2  G-AGCAGATGCTG-TTTACAACAACTCCGGGGGGGGGGG  1077

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information