MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-085N10
Chromosome	1 (Build37)
Map Location	174,859,906 - 174,861,032
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Slamf6, Vangl2, LOC100040199, Nhlh1, Ncstn, Copa, Pex19, LOC100041219, Wdr42a, Pea15a, Casq1, Timm23p, Atp1a2, Igsf8, Kcnj9, Kcnj10, Pigm, LOC665819, Slamf9, LOC100040274, Igsf9, Tagln2, Ccdc19, EG240916, Slamf8, Fcrl6, Dusp23, LOC100040320, Crp, LOC665875, Apcs
Downstream gene	Olfr16, GA_x5J8B7W5Q1F-395172-396104, Olfr1408, GA_x5J8B7W5Q1F-344462-343889, Olfr1406, Olfr218, Olfr1405-ps1, Olfr1404, Fcer1a, Olfr1403, Darc, Cadm3, Aim2, EG240921, BC094916, LOC623121, AI447904, E430029J22Rik, LOC665972, AI607873, Ifi204, EG666028, LOC100040462, Mnda, Ifi203
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slamf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30925 MGI:1353620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vangl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93840 MGI:2135272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Nhlh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18071 MGI:98481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncstn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59287 MGI:1891700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12847 MGI:1334462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19298 MGI:1334458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 179 ESTs, 6 Proteins

name	Wdr42a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98193 MGI:91860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pea15a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18611 MGI:104799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12372 MGI:1309468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm23p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:218888
definition	note : translocase of inner mitochondrial membrane 23 homolog pseudogene pseudo : _no_value

name	Atp1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98660 MGI:88106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140559 MGI:2154090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16524 MGI:108007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16513 MGI:1194504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67556 MGI:1914806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Slamf9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98365 MGI:1923692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040274 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Igsf9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93842 MGI:2135283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tagln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21346 MGI:1312985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71870 MGI:1919120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins

name	EG240916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240916 MGI:3642995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slamf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74748 MGI:1921998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:677296 MGI:3618339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	Dusp23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68440 MGI:1915690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040320 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 168 ESTs, 2 Proteins pseudo : _no_value

name	Crp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12944 MGI:88512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Apcs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20219 MGI:98229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18313 MGI:106648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5Q1F-395172-396104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257799
definition	note : olfactory receptor GA_x5J8B7W5Q1F-395172-396104 pseudo : _no_value

name	Olfr1408 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258759 MGI:3031242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5Q1F-344462-343889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257800
definition	note : olfactory receptor GA_x5J8B7W5Q1F-344462-343889 pseudo : _no_value

name	Olfr1406 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258758 MGI:3031240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258880 MGI:3030052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1405-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404511 MGI:3031239
definition	gene_synonym : MOR267-3 note : olfactory receptor 1405, pseudogene 1 pseudo : _no_value

name	Olfr1404 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258881 MGI:3031238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcer1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14125 MGI:95494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258645 MGI:3031237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Darc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13349 MGI:1097689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cadm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94332 MGI:2137858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383619 MGI:2686159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG240921 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240921 MGI:3646410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 10 Proteins

name	BC094916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545384 MGI:3584522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	AI447904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236312 MGI:2138243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E430029J22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100033459 MGI:2442822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein

name	LOC665972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	AI607873 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226691 MGI:2138302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 10 Proteins

name	Ifi204 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15951 MGI:96429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666028 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666028 MGI:3648011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 3 Proteins

name	Mnda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381308 MGI:3041120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifi203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15950 MGI:96428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slamf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892889 GeneID:30925 MGI:1353620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 6 transcript_id : NM_030710.2

name	Vangl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131201 GeneID:93840 MGI:2135272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vang-like 2 (van gogh, Drosophila) transcript_id : NM_033509.3

name	LOC100040199 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245324 GeneID:100040199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001474255.1

name	Nhlh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754851 GeneID:18071 MGI:98481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nescient helix loop helix 1 transcript_id : NM_010916.1

name	Ncstn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981204 GeneID:59287 MGI:1891700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicastrin transcript_id : NM_021607.2

name	Copa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356847 GeneID:12847 MGI:1334462
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex subunit alpha transcript_id : NM_009938.3

name	Pex19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543532 GeneID:19298 MGI:1334458
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 19 transcript_id : NM_023041.2

name	LOC100041219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245415 GeneID:100041219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 179 ESTs, 6 Proteins product : similar to Translocase of inner mitochondrial membrane 23 homolog (yeast) transcript_id : XM_001476967.1

name	Wdr42a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956325 GeneID:98193 MGI:91860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 42A transcript_id : NM_153555.1

name	Pea15a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439980 GeneID:18611 MGI:104799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoprotein enriched in astrocytes 15A transcript_id : NM_011063.2

name	Casq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753289 GeneID:12372 MGI:1309468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calsequestrin 1 transcript_id : NM_009813.1

name	Atp1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861248 GeneID:98660 MGI:88106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, alpha 2 polypeptide transcript_id : NM_178405.3

name	Igsf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189433 GeneID:140559 MGI:2154090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 8 transcript_id : NM_080419.1

name	Kcnj9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607442 GeneID:16524 MGI:108007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 9 transcript_id : NM_008429.2

name	Kcnj10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87116685 GeneID:16513 MGI:1194504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 10 transcript_id : NM_001039484.1

name	Pigm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373575 GeneID:67556 MGI:1914806
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class M transcript_id : NM_026234.3

name	Slamf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361393 GeneID:98365 MGI:1923692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 9 transcript_id : NM_029612.3

name	LOC100040274 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245328 GeneID:100040274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040274 transcript_id : XM_001474401.1

name	Igsf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475735 GeneID:93842 MGI:2135283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 9 transcript_id : NM_033608.2

name	Tagln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110349995 GeneID:21346 MGI:1312985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transgelin 2 transcript_id : NM_178598.2

name	Ccdc19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364522 GeneID:71870 MGI:1919120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins product : coiled-coil domain containing 19, transcript variant 1 transcript_id : XM_355284.5

name	EG240916 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360594 GeneID:240916 MGI:3642995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240916 transcript_id : NM_177723.3

name	Slamf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367889 GeneID:74748 MGI:1921998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 8 transcript_id : NM_029084.3

name	Fcrl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245417 GeneID:677296 MGI:3618339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : Fc receptor-like 6 transcript_id : XM_001477207.1

name	Dusp23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485684 GeneID:68440 MGI:1915690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 23 transcript_id : NM_026725.2

name	Crp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87162477 GeneID:12944 MGI:88512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-reactive protein, pentraxin-related transcript_id : NM_007768.3

name	Apcs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7363448 GeneID:20219 MGI:98229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid P-component transcript_id : NM_011318.1

name	Olfr16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679171 GeneID:18313 MGI:106648
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 16 transcript_id : NM_008763.1

name	Olfr1408 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129318 GeneID:258759 MGI:3031242
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1408 transcript_id : NM_146764.1

name	Olfr1406 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129324 GeneID:258758 MGI:3031240
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1406 transcript_id : NM_146763.1

name	Olfr218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227319 GeneID:258880 MGI:3030052
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 218 transcript_id : NM_001001809.1

name	Olfr1404 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203800 GeneID:258881 MGI:3031238
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1404 transcript_id : NM_146881.1

name	Fcer1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753827 GeneID:14125 MGI:95494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgE, high affinity I, alpha polypeptide transcript_id : NM_010184.1

name	Olfr1403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203782 GeneID:258645 MGI:3031237
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1403 transcript_id : NM_146651.1

name	Darc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502089 GeneID:13349 MGI:1097689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Duffy blood group, chemokine receptor transcript_id : NM_010045.2

name	Cadm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699416 GeneID:94332 MGI:2137858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell adhesion molecule 3 transcript_id : NM_053199.3

name	Aim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000647 GeneID:383619 MGI:2686159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : absent in melanoma 2 transcript_id : NM_001013779.1

name	EG240921 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245344 GeneID:240921 MGI:3646410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 10 Proteins product : predicted gene, EG240921 transcript_id : XM_136331.7

name	BC094916 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701547 GeneID:545384 MGI:3584522
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC094916 transcript_id : NM_001024721.1

name	LOC623121 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245419 GeneID:623121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : similar to Interferon-activatable protein 203 (Ifi-203) (Interferon-inducible protein p203) transcript_id : XM_001477431.1

name	AI447904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366683 GeneID:236312 MGI:2138243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI447904 transcript_id : NM_175026.2

name	AI607873 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245348 GeneID:226691 MGI:2138302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 10 Proteins product : expressed sequence AI607873 transcript_id : XM_980696.2

name	Ifi204 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130978 GeneID:15951 MGI:96429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon activated gene 204 transcript_id : NM_008329.2

name	EG666028 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364530 GeneID:666028 MGI:3648011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666028 transcript_id : XM_988496.1

name	LOC100040462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245352 GeneID:100040462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 3 Proteins product : similar to interferon-activatable protein transcript_id : XM_001474715.1

name	Mnda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352357 GeneID:381308 MGI:3041120
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid cell nuclear differentiation antigen transcript_id : NM_001033450.2

name	Ifi203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325980 GeneID:15950 MGI:96428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon activated gene 203 transcript_id : NM_001045481.1

name	Ifi203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865994 GeneID:15950 MGI:96428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon activated gene 203 transcript_id : NM_008328.2

name	Slamf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507654 CCDS:CCDS15504.1 GeneID:30925 MGI:1353620
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : lymphocyte antigen 108 product : SLAM family member 6 protein_id : NP_109635.1

name	Vangl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15723382 CCDS:CCDS15505.1 GeneID:93840 MGI:2135272
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045176 - apical protein localization [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001736 - establishment of planar polarity [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0001843 - neural tube closure [Evidence IGI] [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IGI] codon_start : 1 note : vang (van gogh)-like 2 product : loop tail associated protein protein_id : NP_277044.1

name	LOC100040199 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245325 GeneID:100040199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474305.1

name	Nhlh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754852 CCDS:CCDS15506.1 GeneID:18071 MGI:98481
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nescient helix loop helix 1 protein_id : NP_035046.1

name	Ncstn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981205 CCDS:CCDS15507.1 GeneID:59287 MGI:1891700
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence ISS]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0007220 - Notch receptor processing [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS]; GO:0016485 - protein processing [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nicastrin protein_id : NP_067620.2

name	Copa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981828 GeneID:12847 MGI:1334462
definition	GO_component : GO:0030126 - COPI vesicle coat [Evidence IEA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005792 - microsome [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS]; GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0030157 - pancreatic juice secretion [Evidence ISS]; GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 exception : mismatches in translation product : coatomer protein complex subunit alpha protein_id : NP_034068.2

name	Pex19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543533 CCDS:CCDS15508.1 GeneID:19298 MGI:1334458
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : peroxisomal farnesylated protein product : peroxisome biogenesis factor 19 protein_id : NP_075528.2

name	LOC100041219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245416 GeneID:100041219
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477017.1

name	Wdr42a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956326 CCDS:CCDS15509.1 GeneID:98193 MGI:91860
definition	codon_start : 1 product : H326 protein_id : NP_705783.1

name	Pea15a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426847 CCDS:CCDS15510.1 GeneID:18611 MGI:104799
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS]; GO:0005875 - microtubule associated complex [Evidence NAS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence TAS]; GO:0005351 - sugar porter activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence TAS]; GO:0046325 - negative regulation of glucose import [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; mammary transforming gene 1; phosphoprotein enriched in astrocytes 15 product : phosphoprotein enriched in astrocytes 15 isoform 2 protein_id : NP_035193.1

name	Casq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753290 GeneID:12372 MGI:1309468
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0016529 - sarcoplasmic reticulum [Evidence TAS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence TAS] codon_start : 1 function : calcium binding protein product : calsequestrin 1 protein_id : NP_033943.1

name	Atp1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409956 GeneID:98660 MGI:88106
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IGI]; GO:0002026 - cardiac inotropy [Evidence IMP]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0040011 - locomotion [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0045822 - negative regulation of heart contraction [Evidence IMP]; GO:0002087 - neurological control of breathing [Evidence IMP]; GO:0001504 - neurotransmitter uptake [Evidence IMP]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0051481 - reduction of cytosolic calcium ion concentration [Evidence IMP]; GO:0006937 - regulation of muscle contraction [Evidence IMP]; GO:0006940 - regulation of smooth muscle contraction [Evidence IMP]; GO:0006942 - regulation of striated muscle contraction [Evidence IMP]; GO:0019229 - regulation of vasoconstriction [Evidence IMP] [Evidence IGI]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATPase, Na+/K+ transporting, alpha 2 polypeptide protein_id : NP_848492.1

name	Igsf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189434 CCDS:CCDS15511.1 GeneID:140559 MGI:2154090
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006928 - cell motility [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0007338 - fertilization (sensu Metazoa) [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0007519 - striated muscle development [Evidence ISS] codon_start : 1 note : PG regulatory-like protein product : immunoglobulin superfamily, member 8 protein_id : NP_536344.1

name	Kcnj9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607443 GeneID:16524 MGI:108007
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel subfamily J9 protein_id : NP_032455.2

name	Kcnj10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87116686 CCDS:CCDS15512.1 GeneID:16513 MGI:1194504
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel J10 protein_id : NP_001034573.1

name	Pigm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19920329 CCDS:CCDS15513.1 GeneID:67556 MGI:1914806
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000030 - mannosyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : phosphatidylinositol glycan, class M protein_id : NP_080510.1

name	Slamf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982610 CCDS:CCDS15514.1 GeneID:98365 MGI:1923692
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CD2 antigen family, member 10 product : SLAM family member 9 protein_id : NP_083888.2

name	LOC100040274 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245329 GeneID:100040274
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474451.1

name	Igsf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18426807 CCDS:CCDS15515.1 GeneID:93842 MGI:2135283
definition	GO_component : GO:0030425 - dendrite [Evidence IMP] GO_process : GO:0016358 - dendrite development [Evidence IMP] codon_start : 1 exception : mismatches in translation note : NCAM-like protein NRT1; neural cell adhesion molecule (Ncam)-like product : immunoglobulin superfamily, member 9 protein_id : NP_291086.1

name	Tagln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519911 GeneID:21346 MGI:1312985
definition	codon_start : 1 note : putative; transgelin 2 (MGD\|MGI:1312985 GB\|BC049861, evidence: BLASTN, 99%, match=1379) product : transgelin 2 protein_id : NP_848713.1

name	Ccdc19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63480006 GeneID:71870 MGI:1919120
definition	codon_start : 1 product : nasopharyngeal epithelium specific protein 1 isoform 1 protein_id : XP_355284.3

name	EG240916 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244188 CCDS:CCDS15516.1 GeneID:240916 MGI:3642995
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC240916 protein_id : NP_808391.1

name	Slamf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625804 CCDS:CCDS15517.1 GeneID:74748 MGI:1921998
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : B lymphocyte activator macrophage expressed protein_id : NP_083360.2

name	Fcrl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245418 GeneID:677296 MGI:3618339
definition	codon_start : 1 product : similar to FCRL6 protein_id : XP_001477257.1

name	Dusp23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55926215 CCDS:CCDS15518.1 GeneID:68440 MGI:1915690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : low-molecular-mass dual-specificity phosphatase product : dual specificity phosphatase 23 protein_id : NP_081001.1

name	Crp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87162478 GeneID:12944 MGI:88512
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C-reactive protein, petaxin related protein_id : NP_031794.2

name	Apcs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7363449 CCDS:CCDS15520.1 GeneID:20219 MGI:98229
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serum amyloid P-component protein_id : NP_035448.1

name	Olfr16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679172 CCDS:CCDS15521.1 GeneID:18313 MGI:106648
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-893157-892228; olfactory receptor MOR267-13 product : olfactory receptor 16 protein_id : NP_032789.1

name	Olfr1408 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129319 CCDS:CCDS15522.1 GeneID:258759 MGI:3031242
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-715776-716708; olfactory receptor MOR267-4 product : olfactory receptor 1408 protein_id : NP_666975.1

name	Olfr1406 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129325 CCDS:CCDS15523.1 GeneID:258758 MGI:3031240
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2R7CC-664297-665229; olfactory receptor MOR267-5 product : olfactory receptor 1406 protein_id : NP_666974.1

name	Olfr218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227320 CCDS:CCDS15524.1 GeneID:258880 MGI:3030052
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02SYWG4P-534-1100; olfactory receptor MOR267-3; olfactory receptor 218, pseudogene 1 product : olfactory receptor 218 protein_id : NP_001001809.1

name	Olfr1404 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203801 CCDS:CCDS15525.1 GeneID:258881 MGI:3031238
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-630397-629456; olfactory receptor MOR267-2 product : olfactory receptor 1404 protein_id : NP_667092.1

name	Fcer1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753828 GeneID:14125 MGI:95494
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0045121 - lipid raft [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019863 - IgE binding [Evidence IMP] [Evidence IDA]; GO:0019767 - IgE receptor activity [Evidence IDA] [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007257 - activation of JNK activity [Evidence IDA]; GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA] [Evidence IMP]; GO:0019370 - leukotriene biosynthesis [Evidence IDA]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IDA]; GO:0045425 - positive regulation of granulocyte macrophage colony-stimulating factor biosynthesis [Evidence IDA]; GO:0045401 - positive regulation of interleukin-3 biosynthesis [Evidence IDA]; GO:0043306 - positive regulation of mast cell degranulation [Evidence IDA]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0001812 - positive regulation of type I hypersensitivity [Evidence IMP]; GO:0001820 - serotonin secretion [Evidence IDA] [Evidence IMP]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation product : Fc receptor, IgE, high affinity I, alpha polypeptide protein_id : NP_034314.1

name	Olfr1403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203783 CCDS:CCDS15526.1 GeneID:258645 MGI:3031237
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2R7CC-581296-580364; olfactory receptor MOR267-8 product : olfactory receptor 1403 protein_id : NP_666862.1

name	Darc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502090 GeneID:13349 MGI:1097689
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : glycoprotein D; Duffy antigen receptor for chemokines product : Duffy blood group protein_id : NP_034175.2

name	Cadm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716503 CCDS:CCDS15528.1 GeneID:94332 MGI:2137858
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence IDA]; GO:0007156 - homophilic cell adhesion [Evidence IDA]; GO:0008104 - protein localization [Evidence IMP] codon_start : 1 note : nectin-lke 1 product : immunoglobulin superfamily, member 4B protein_id : NP_444429.1

name	Aim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000648 CCDS:CCDS15529.1 GeneID:383619 MGI:2686159
definition	codon_start : 1 product : absent in melanoma 2 protein_id : NP_001013801.1

name	EG240921 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245345 GeneID:240921 MGI:3646410
definition	codon_start : 1 product : hypothetical protein protein_id : XP_136331.5

name	BC094916 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701548 GeneID:545384 MGI:3584522
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC545384 protein_id : NP_001019892.1

name	LOC623121 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245420 GeneID:623121
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477481.1

name	AI447904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923921 GeneID:236312 MGI:2138243
definition	codon_start : 1 product : hypothetical protein LOC236312 protein_id : NP_778191.1

name	AI607873 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245349 GeneID:226691 MGI:2138302
definition	codon_start : 1 note : overriding stop codons product : similar to interferon activated gene 204 protein_id : XP_985790.2 transl_except : (pos:complement(175664737..175664739),aa:OTHER)

name	Ifi204 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130979 GeneID:15951 MGI:96429
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003712 - transcription cofactor activity [Evidence IGI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0042771 - DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0045669 - positive regulation of osteoblast differentiation [Evidence IGI]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : interferon, gamma-inducible protein 16; interferon, gamma-inducible gene 204 product : interferon activated gene 204 protein_id : NP_032355.2

name	EG666028 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364531 GeneID:666028 MGI:3648011
definition	codon_start : 1 product : similar to Interferon activated gene 205 protein_id : XP_993590.1

name	LOC100040462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245353 GeneID:100040462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474765.1

name	Mnda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781795 CCDS:CCDS15532.1 GeneID:381308 MGI:3041120
definition	codon_start : 1 note : lipopolysaccharide-inducible; interferon activated product : myeloid cell nuclear differentiation antigen protein_id : NP_001028622.1

name	Ifi203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865995 GeneID:15950 MGI:96428
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : interferon activated gene 203 isoform 2 protein_id : NP_032354.2

name	Ifi203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116325981 GeneID:15950 MGI:96428
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : interferon activated gene 203 isoform 1 protein_id : NP_001038946.1

name	LOC665819 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665819
definition	number : 1 pseudo : _no_value

name	LOC665819 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665819
definition	number : 2 pseudo : _no_value

name	LOC665819 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665819
definition	number : 3 pseudo : _no_value

name	LOC665875 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665875
definition	number : 1 pseudo : _no_value

name	LOC665875 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665875
definition	number : 2 pseudo : _no_value

name	LOC665972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665972
definition	number : 2 pseudo : _no_value

name	LOC665972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665972
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:226176
definition	standard_name : Ly108

name	(CDS detail)
type	STS
link
xref	UniSTS:105072
definition	standard_name : G42047

name	(CDS detail)
type	STS
link
xref	UniSTS:105067
definition	standard_name : G42042

name	(CDS detail)
type	STS
link
xref	UniSTS:105050
definition	standard_name : G42025

name	(CDS detail)
type	STS
link
xref	UniSTS:225842
definition	standard_name : G64929

name	(CDS detail)
type	STS
link
xref	UniSTS:105070
definition	standard_name : G42045

name	(CDS detail)
type	STS
link
xref	UniSTS:144017
definition	standard_name : Nhlh1

name	(CDS detail)
type	STS
link
xref	UniSTS:22843
definition	standard_name : RH11634

name	(CDS detail)
type	STS
link
xref	UniSTS:222335
definition	standard_name : RH140256

name	(CDS detail)
type	STS
link
xref	UniSTS:105071
definition	standard_name : G42046

name	(CDS detail)
type	STS
link
xref	UniSTS:151313
definition	standard_name : D1S2004E

name	(CDS detail)
type	STS
link
xref	UniSTS:141376
definition	standard_name : Copa

name	(CDS detail)
type	STS
link
xref	UniSTS:105057
definition	standard_name : G42032

name	(CDS detail)
type	STS
link
xref	UniSTS:209425
definition	standard_name : RH126904

name	(CDS detail)
type	STS
link
xref	UniSTS:158888
definition	standard_name : AU040324

name	(CDS detail)
type	STS
link
xref	UniSTS:144308
definition	standard_name : Pxf

name	(CDS detail)
type	STS
link
xref	UniSTS:234269
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:105069
definition	standard_name : G42044

name	(CDS detail)
type	STS
link
xref	UniSTS:142280
definition	standard_name : D1Ucla4

name	(CDS detail)
type	STS
link
xref	UniSTS:105051
definition	standard_name : G42026

name	(CDS detail)
type	STS
link
xref	UniSTS:161760
definition	standard_name : RH124938

name	(CDS detail)
type	STS
link
xref	UniSTS:105068
definition	standard_name : G42043

name	(CDS detail)
type	STS
link
xref	UniSTS:158889
definition	standard_name : C76055

name	(CDS detail)
type	STS
link
xref	UniSTS:161606
definition	standard_name : RH124784

name	(CDS detail)
type	STS
link
xref	UniSTS:210508
definition	standard_name : RH136526

name	(CDS detail)
type	STS
link
xref	UniSTS:178517
definition	standard_name : AI323543

name	(CDS detail)
type	STS
link
xref	UniSTS:144159
definition	standard_name : Pea15

name	(CDS detail)
type	STS
link
xref	UniSTS:108990
definition	standard_name : G49234

name	(CDS detail)
type	STS
link
xref	UniSTS:217047
definition	standard_name : RH133764

name	(CDS detail)
type	STS
link
xref	UniSTS:105060
definition	standard_name : G42035

name	(CDS detail)
type	STS
link
xref	UniSTS:225846
definition	standard_name : G64925

name	(CDS detail)
type	STS
link
xref	UniSTS:142273
definition	standard_name : D1Sta3

name	(CDS detail)
type	STS
link
xref	UniSTS:105063
definition	standard_name : G42038

name	(CDS detail)
type	STS
link
xref	UniSTS:178518
definition	standard_name : AW060654

name	(CDS detail)
type	STS
link
xref	UniSTS:105064
definition	standard_name : G42039

name	(CDS detail)
type	STS
link
xref	UniSTS:141127
definition	standard_name : Atp1a2

name	(CDS detail)
type	STS
link
xref	UniSTS:225843
definition	standard_name : G64926

name	(CDS detail)
type	STS
link
xref	UniSTS:105049
definition	standard_name : G42024

name	(CDS detail)
type	STS
link
xref	UniSTS:143020
definition	standard_name : AA033172

name	(CDS detail)
type	STS
link
xref	UniSTS:162045
definition	standard_name : RH125223

name	(CDS detail)
type	STS
link
xref	UniSTS:498314
definition	standard_name : Kcnj9

name	(CDS detail)
type	STS
link
xref	UniSTS:143669
definition	standard_name : Kcnj9

name	(CDS detail)
type	STS
link
xref	UniSTS:143668
definition	standard_name : Kcnj9

name	(CDS detail)
type	STS
link
xref	UniSTS:158890
definition	standard_name : U11860

name	(CDS detail)
type	STS
link
xref	UniSTS:105077
definition	standard_name : G42052

name	(CDS detail)
type	STS
link
xref	UniSTS:105079
definition	standard_name : G42061

name	(CDS detail)
type	STS
link
xref	UniSTS:105062
definition	standard_name : G42037

name	(CDS detail)
type	STS
link
xref	UniSTS:105065
definition	standard_name : G42040

name	(CDS detail)
type	STS
link
xref	UniSTS:225849
definition	standard_name : G64928

name	(CDS detail)
type	STS
link
xref	UniSTS:165123
definition	standard_name : AI465509

name	(CDS detail)
type	STS
link
xref	UniSTS:185458
definition	standard_name : AI644422

name	(CDS detail)
type	STS
link
xref	UniSTS:234270
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178516
definition	standard_name : AV302080

name	(CDS detail)
type	STS
link
xref	UniSTS:105080
definition	standard_name : G42063

name	(CDS detail)
type	STS
link
xref	UniSTS:225844
definition	standard_name : G64924

name	(CDS detail)
type	STS
link
xref	UniSTS:105075
definition	standard_name : G42050

name	(CDS detail)
type	STS
link
xref	UniSTS:165124
definition	standard_name : AI462096

name	(CDS detail)
type	STS
link
xref	UniSTS:144540
definition	standard_name : Tagln2

name	(CDS detail)
type	STS
link
xref	UniSTS:128826
definition	standard_name : D1Mit456

name	(CDS detail)
type	STS
link
xref	UniSTS:123987
definition	standard_name : 32.MMHAP50FRC11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128487
definition	standard_name : D1Mit149.1

name	(CDS detail)
type	STS
link
xref	UniSTS:141404
definition	standard_name : Crp

name	(CDS detail)
type	STS
link
xref	UniSTS:128486
definition	standard_name : D1Mit149

name	(CDS detail)
type	STS
link
xref	UniSTS:141402
definition	standard_name : Crp

name	(CDS detail)
type	STS
link
xref	UniSTS:178519
definition	standard_name : AI255847

name	(CDS detail)
type	STS
link
xref	UniSTS:141403
definition	standard_name : Crp

name	(CDS detail)
type	STS
link
xref	UniSTS:128712
definition	standard_name : D1Mit354

name	(CDS detail)
type	STS
link
xref	UniSTS:128712
definition	standard_name : D1Mit354

name	(CDS detail)
type	STS
link
xref	UniSTS:128715
definition	standard_name : D1Mit356

name	(CDS detail)
type	STS
link
xref	UniSTS:144368
definition	standard_name : Sap

name	(CDS detail)
type	STS
link
xref	UniSTS:492574
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:144082
definition	standard_name : Olfr16

name	(CDS detail)
type	STS
link
xref	UniSTS:125890
definition	standard_name : X92969

name	(CDS detail)
type	STS
link
xref	UniSTS:128546
definition	standard_name : D1Mit206

name	(CDS detail)
type	STS
link
xref	UniSTS:142274
definition	standard_name : D1Sta4

name	(CDS detail)
type	STS
link
xref	UniSTS:178197
definition	standard_name : G66993

name	(CDS detail)
type	STS
link
xref	UniSTS:493907
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485158
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178279
definition	standard_name : G67070

name	(CDS detail)
type	STS
link
xref	UniSTS:489629
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495359
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143081
definition	standard_name : Fcer1a

name	(CDS detail)
type	STS
link
xref	UniSTS:491681
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158891
definition	standard_name : AF016697

name	(CDS detail)
type	STS
link
xref	UniSTS:143021
definition	standard_name : AA162249

name	(CDS detail)
type	STS
link
xref	UniSTS:256664
definition	standard_name : Darc

name	(CDS detail)
type	STS
link
xref	UniSTS:234272
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142257
definition	standard_name : D1Mit522

name	(CDS detail)
type	STS
link
xref	UniSTS:128713
definition	standard_name : MJ4236

name	(CDS detail)
type	STS
link
xref	UniSTS:128714
definition	standard_name : D1Mit355.2

name	(CDS detail)
type	STS
link
xref	UniSTS:142276
definition	standard_name : D1Sta6

name	(CDS detail)
type	STS
link
xref	UniSTS:122842
definition	standard_name : 06.MHAa63a6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207256
definition	standard_name : BE691665

name	(CDS detail)
type	STS
link
xref	UniSTS:123721
definition	standard_name : 26.MMHAP11FLA5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:142278
definition	standard_name : D1Sta8

name	(CDS detail)
type	STS
link
xref	UniSTS:178522
definition	standard_name : AI447904

name	(CDS detail)
type	STS
link
xref	UniSTS:142278
definition	standard_name : D1Sta8

name	(CDS detail)
type	STS
link
xref	UniSTS:123721
definition	standard_name : 26.MMHAP11FLA5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207256
definition	standard_name : BE691665

name	(CDS detail)
type	STS
link
xref	UniSTS:158892
definition	standard_name : M31419

name	(CDS detail)
type	STS
link
xref	UniSTS:158892
definition	standard_name : M31419

name	LOC100040320 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245340 GeneID:100040320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 168 ESTs, 2 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_031779.1

name	E430029J22Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149245423 GeneID:100033459 MGI:2442822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : RIKEN cDNA E430029J22 gene transcript_id : XR_035320.1

clone name	MSMg01-307P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-316B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505L22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-527J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082G13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-440N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110E09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456A06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-116G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-191O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506N16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-068D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-478J20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398K14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478B06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-521L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064C06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-486A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137K20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463O11
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-164K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-085N10.b	B6Ng01-085N10.g
ACC	DH899398	DH899399
length	1,193	1,122
definition	DH899398\|Mus musculus domesticus DNA, BAC clone: B6Ng01-085N10, 5' end.	DH899399\|Mus musculus domesticus DNA, BAC clone: B6Ng01-085N10, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctccaaataacccaggtcatttccaagcctattgattgttgtcaa caaactgacaagttcctgctgctgaggcaacacctacataactccctgaa cacaaagaagttgaactggtacctaccacctagagcctccacacatatta accagtgtttgtggtactggaaggtacacggcatgctaccagaggagaaa ggtaaacaccaacccagttacaaacccttccatctgcaatgatgatctgc ctgccatatatgctggtgcaactgtagcaggagagttgcagtagcaatta accactatctgcttgaattaaggtccgctccatgagataaaaccacaacc caccatttcttggtaaagaaatcagaaactaaataggccatggacctaga aatataacaaatgatactgttctgctaaaggaatgtagcttttaaattac tcctaatgacattctgatactcttatagatcaatgtcttcctcagccaga gcaagcttcctcctgaagcagatgggaacaaacacagagacccacagctg gacaatgtgcagagagtaaaaaaaaaaaaaatccttggagcattccatcc taaatgtgctatctccaccaaatccttctcctcagagttcatggaactct gcagaagaggaggcaggcagatgataagagacagtgaagatgaagaacac cacggaaacaaagggttctatgcacaacaggattaaactcaaagagaatg tggcagcatgcatgagacctgcccagccctaagccacatgaggccccagg gttgagaggggaagtggaaactagcgcccatccctaattcagaaactatc tcaaatagataatcccttgcagaagaaaagcgggtgttctccaacagggc ctcaccggggatgcaaacagtacttaatagcagcctcattagccagcctt gatggcaacacaaatacatgatatttagaggctttttgtctcactatgtg attttttgctactgatatggtttgttatcatttatgggcttgtgtgtgtg cagatgtgtggtgtctggggctttttttactttgatttttgatgttgctg tctgtccaataggcctaattcttcctggggctgttgttcaagggaataca agatggaatgtcattgaaagggaaatctgggggaattggcaat	gaattcaaaagaatatttatcctttcacaggtaaaaggtttagaaaggag gaaaaaataccttgcatttggaacaatatgagagatgtcttaacattatc aaaggacttgccaagaccttgtctaccacaagtttctgtgtcaaagtgta gaattatttgaaagatgttgttttagaagagagctctgcccacacatcct gcttcttggggcttcctggaatgttgcttcatcagaattcatttcattac actcaggcacacagaggtcagcacaactgtggtccaagttcaagctggag gcagaacttaccattgtccatgcaatgctgattctgcaggtacgtggaat gccataggtacagggtcatggaggttttctcagggatttaaaaggaaatc ctgaaattcagccaatatatagcagtttggattctctgtgagtagtttct agataagaggatgtgtgaagctcagagggcaaaatttaagccacagtgga tacagggactagaaatcactgaggacatggaacatctacaaagaaaaagc ctaggcagtgagaagagccagcctgaaggagaaccatgtggtttgatggc atcaaggtcttagaagctcacattctactaccaattctcgtgactccaga cagactgatgagatttagtgtttactttcatgggcttaggtcttgcctaa ttctgcccccattctttgtcccatttttccttttgggaatgatggtactt actctgtgcaattgtttctgtttatatttgctttattttataggagctca caaccaacattgtctgccttgatagggagcctcagaggacactttgagtt tggaattttgagaaatgtccttagaaaatactaaatgcattttatattat gatataaaattgagcttctgaggaccaggggtggaagttgtgtggtttgg gatatgaagggtcctataaggctcatgttaaagtcttgatcttaagcaga tggcattactatgaagtgactggatcgtgaaggtgctggagttttactag attgtaatgcaccgaggttcatagctgaatggtcttttggaactaaggcc tacttgggggattaagtcatca
quality values	Open. Hide. 61 47 43 38 61 61 61 61 38 25 61 61 61 61 61 61 61 49 49 61 61 61 49 61 61 61 61 61 59 32 59 55 55 61 61 61 61 61 61 61 59 61 59 61 61 59 59 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 44 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 53 61 61 53 53 61 47 61 61 61 61 61 61 52 61 47 61 61 61 61 61 61 53 61 47 53 57 57 53 53 57 53 47 53 57 57 53 53 53 53 57 57 57 57 53 53 47 57 53 57 53 57 57 57 53 57 45 57 57 50 57 57 47 57 57 47 57 57 57 57 57 57 57 53 53 53 53 53 52 53 53 57 42 57 39 40 53 53 41 38 53 53 53 53 50 57 57 52 52 38 57 53 53 53 45 53 53 52 38 30 52 52 42 57 53 53 43 46 43 46 50 50 38 46 53 50 43 38 57 35 53 53 39 45 50 57 57 53 57 50 57 50 57 57 53 45 35 57 53 30 57 24 41 34 18 43 27 37 47 57 38 40 38 52 30 53 52 24 47 53 37 57 37 34 33 33 50 38 53 34 34 20 40 29 35 53 53 28 57 45 37 30 41 44 30 47 39 57 46 53 38 34 15 53 37 33 57 52 23 42 44 41 48 36 37 35 28 47 33 40 40 33 19 57 37 34 37 36 57 45 40 41 36 34 57 53 37 53 25 53 32 24 40 25 57 40 35 31 27 39 29 30 39 29 24 31 40 47 20 31 16 30 29 41 27 45 30 32 35 31 44 32 34 33 48 21 30 32 30 29 30 29 29 38 21 36 19 45 45 30 23 30 51 51 12 30 25 36 19 48 34 51 51 29 33 33 25 29 34 29 33 51 29 28 28 34 21 37 22 28 39 29 28 34 25 46 30 29 25 18 19 29 29 28 27 43 51 29 29 24 29 29 29 29 28 33 51 33 30 31 26 29 21 26 24 27 31 43 27 19 28 29 25 28 15 41 38 14 43 51 51 39 28 29 32 46 29 20 40 23 11 29 29 22 29 23 23 23 16 20 36 25 20 18 20 28 17 9 21 20 41 51 27 14 14 29 25 23 51 18 26 26 30 19 27 33 26 17 28 13 16 28 17 25 20 20 38 20 31 31 22 22 15 29 19 24 27 27 22 26 26 22 19 25 18 12 26 8 25 13 10 12 10 14 19 44 17 27 16 9 19 11 32 22 14 14 30 44 34 31 19 33 14 31 14 28 44 44 42 16 13 7 21 15 18 15 14 16 29 15 30 15 26 19 22 42 42 42 42 21 4 9 29 8 20 18 29 16 29 6 5 22 15 6 24 7 5 3 5 19 10 23 20 23 37 16 5 4 17 34 22 13 22 8 4 5 11 5 16 8 14 10 16 24 5 4 24 5 9 7 21 6 9 9 4 7 8 19 22 15 17 5 11 6 20 35 35 36 35 35 18 10 7 8 30 10 4 4 12 30 36 26 4 2 4 2 6 4 7 6 2 4 1 4 4 4 3 3 11 16 4 3 15 5 3 3 4 5 18 11 11 9 13 11 7 5 4 2 4 7 9 5 2 4 3 5 4 16 10 10 18 8 4 4 13 5 5 14 2 1 3 1 4 6 4 1 3 7 9 5 4 10 7 1 3 3 3 6 9 14 4 9 4 5 13 3 4 11 5 6 5 20 24 20 9 8 3 9 13 10 12 5 2 4 4 3	Open. Hide. 61 49 52 49 13 11 13 12 9 12 10 13 9 11 19 24 59 59 59 61 61 61 61 61 61 59 59 61 59 61 61 61 59 61 61 59 55 59 61 61 61 61 59 61 61 61 61 61 34 19 24 23 18 23 18 18 18 29 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 61 61 55 59 59 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 50 50 61 37 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 53 61 61 53 61 61 61 42 61 61 61 53 61 57 53 53 57 53 57 57 57 53 40 57 53 45 53 57 57 57 57 57 53 53 57 57 47 53 53 53 57 57 53 57 47 57 57 53 45 52 53 53 53 40 53 53 53 53 53 57 57 45 57 57 45 57 50 53 53 52 50 53 53 53 53 57 47 24 47 57 42 57 38 36 52 52 57 57 52 57 41 45 57 52 57 53 39 57 52 45 50 50 52 45 52 52 57 45 53 53 53 53 34 57 57 50 53 53 47 50 53 50 52 57 53 42 53 47 46 50 46 37 35 53 50 57 50 53 52 53 42 57 43 43 43 41 57 38 52 52 38 36 36 52 36 53 57 38 36 50 57 23 38 32 51 47 53 39 53 57 37 57 50 38 39 53 57 52 42 36 53 53 57 39 37 53 44 40 21 52 34 48 27 52 53 42 57 33 53 52 33 53 44 33 37 36 57 57 57 53 29 39 45 33 13 57 53 46 31 37 57 47 30 33 57 57 57 30 29 40 25 57 57 40 53 53 45 33 41 21 47 33 26 41 57 27 30 33 43 41 34 44 40 44 30 47 32 48 31 28 44 19 28 47 19 51 28 41 35 46 25 46 30 30 36 29 47 46 30 38 39 38 51 32 29 25 51 51 43 43 29 33 39 35 48 16 32 29 34 24 33 20 31 26 24 21 44 29 28 34 21 30 29 29 35 31 19 29 33 29 44 29 34 33 28 51 28 38 20 16 25 30 28 29 21 41 11 29 29 12 24 28 24 43 25 29 30 28 29 46 34 35 21 30 29 18 51 46 39 16 41 22 29 51 29 27 29 28 25 31 27 36 28 21 41 46 51 41 23 28 28 20 31 39 24 28 31 31 31 30 51 51 32 15 26 25 23 30 28 24 20 29 15 11 11 27 51 51 23 17 32 23 29 14 29 26 31 28 28 26 22 26 15 29 17 19 26 29 51 51 36 18 17 33 12 8 6 6 17 19 18 29 21 26 32 12 51 28 23 51 6 26 14 21 27 22 33 18 13 51 22 27 20 31 22 27 15 21 19 16 19 11 15 25 13 9 17 11 20 25 44 24 22 11 19 22 25 32 17 20 18 9 26 12 25 22 16 13 19 33 19 26 28 16 23 25 31 21 31 26 31 31 31 30 30 12 10 27 28 23 23 30 25 12 22 22 12 12 26 12 12 17 9 8 14 26 18 30 5 9 5 27 37 37 30 10 29 12 8 5 9 5 6 4 4 3 8 18 29 18 10 7 15 7 8 5 5 23 14 15 5 5 6 6 15 16 14 13 14 5 7 19 2 3 16 32 32 11 17 7 15 23 9 7 7 12 13 8 10 9 8 4 4 10 9 6 21 36 35 19 24 4 3 4 14 15 20 24 13 13 8 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_174859906_174861032
seq2: B6Ng01-085N10.g_71_1192

seq1  GAATTCAAAAGAATATTTATCCTTTCACAGGTAAAAGGTTTAGAAAGGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAAGAATATTTATCCTTTCACAGGTAAAAGGTTTAGAAAGGAG  50

seq1  GAAAAAATACCTTGCATTTGGAACAATATGAGAGATGTCTTAACATTATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAAATACCTTGCATTTGGAACAATATGAGAGATGTCTTAACATTATC  100

seq1  AAAGGACTTGCCAAGACCTTGTCTACCACAAGTTTCTGTGTCAAAGTGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGACTTGCCAAGACCTTGTCTACCACAAGTTTCTGTGTCAAAGTGTA  150

seq1  GAATTATTTGAAAGATGTTGTTTTAGAAGAGAGCTCTGCCCACACATCCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTATTTGAAAGATGTTGTTTTAGAAGAGAGCTCTGCCCACACATCCT  200

seq1  GCTTCTTGGGGCTTCCTGGAATGTTGCTTCATCAGAATTCATTTCATTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCTTGGGGCTTCCTGGAATGTTGCTTCATCAGAATTCATTTCATTAC  250

seq1  ACTCAGGCACACAGAGGTCAGCACAACTGTGGTCCAAGTTCAAGCTGGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAGGCACACAGAGGTCAGCACAACTGTGGTCCAAGTTCAAGCTGGAG  300

seq1  GCAGAACTTACCATTGTCCATGCAATGCTGATTCTGCAGGTACGTGGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAACTTACCATTGTCCATGCAATGCTGATTCTGCAGGTACGTGGAAT  350

seq1  GCCATAGGTACAGGGTCATGGAGGTTTTCTCAGGGATTTAAAAGGAAATC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATAGGTACAGGGTCATGGAGGTTTTCTCAGGGATTTAAAAGGAAATC  400

seq1  CTGAAATTCAGCCAATATATAGCAGTTTGGATTCTCTGTGAGTAGTTTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAATTCAGCCAATATATAGCAGTTTGGATTCTCTGTGAGTAGTTTCT  450

seq1  AGATAAGAGGATGTGTGAAGCTCAGAGGGCAAAATTTAAGCCACAGTGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAAGAGGATGTGTGAAGCTCAGAGGGCAAAATTTAAGCCACAGTGGA  500

seq1  TACAGGGACTAGAAATCACTGAGGACATGGAACATCTACAAAGAAAAAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGGGACTAGAAATCACTGAGGACATGGAACATCTACAAAGAAAAAGC  550

seq1  CTAGGCAGTGAGAAGAGCCAGCCTGAAGGAGAACCATGTGGTTTGATGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGCAGTGAGAAGAGCCAGCCTGAAGGAGAACCATGTGGTTTGATGGC  600

seq1  ATCAAGGTCTTAGAAGCTCACATTCTACTACCAATTCTCGTGACTCCAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGGTCTTAGAAGCTCACATTCTACTACCAATTCTCGTGACTCCAGA  650

seq1  CAGACTGATGAGATTTAGTGTTTACTTTCATGGGCTTAGGTCTTGCCTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTGATGAGATTTAGTGTTTACTTTCATGGGCTTAGGTCTTGCCTAA  700

seq1  TTCTGCCCCCATTCTTTGTCCCATTTTTCCTTTTGGGAATGATGGTACTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCCCCCATTCTTTGTCCCATTTTTCCTTTTGGGAATGATGGTACTT  750

seq1  ACTCTGTGCAATTGTTTCTGTTTATATTTGCTTTATTTTATAGGAGCTCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTGTGCAATTGTTTCTGTTTATATTTGCTTTATTTTATAGGAGCTCA  800

seq1  CAACCAACATTGTCTGCCTTGATAGGGAGCCTCAGAGGACACTTTGAGTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCAACATTGTCTGCCTTGATAGGGAGCCTCAGAGGACACTTTGAGTT  850

seq1  TGGAATTTTGAGAAATGTCCTTAGAAAAATACTAAATGCATTTTATATTA  900
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TGGAATTTTGAGAAATGTCCTTAG-AAAATACTAAATGCATTTTATATTA  899

seq1  TGATATAAAATTGAGCTTCTGAGGACCAGGGGTGGAAGGTTGTGTGGTTT  950
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TGATATAAAATTGAGCTTCTGAGGACCAGGGGTGGAA-GTTGTGTGGTTT  948

seq1  -GGATATGAAGGGTCCTATAAAGGCTCATGTTAAAGTCTTGATCTTAAGC  999
       |||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  GGGATATGAAGGGTCCTAT-AAGGCTCATGTTAAAGTCTTGATCTTAAGC  997

seq1  AGATGGCATTACTATGAAGTGACTGGATCGTGAAGGTGCTGGAGTTTTTA  1049
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  AGATGGCATTACTATGAAGTGACTGGATCGTGAAGGTGCTGGAG-TTTTA  1046

seq1  CTAGATTGGTTAATGCA-CGA-GTTCATAGCTGAATGGGTCTTTTGGGAA  1097
      ||||||||  ||||||| ||| |||||||||||||| |||||||| ||||
seq2  CTAGATTG--TAATGCACCGAGGTTCATAGCTGAAT-GGTCTTTT-GGAA  1092

seq1  CT-AGGCCTACTTGGGGGATGTAAGTCATCA  1127
      || ||||||||||||||||| ||||||||||
seq2  CTAAGGCCTACTTGGGGGAT-TAAGTCATCA  1122

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information