MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-132A11
Chromosome	1 (Build37)
Map Location	184,035,115 - 184,036,231
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Nvl, Cnih4, Wdr26, LOC100042363, LOC666519, Cnih3, Ccdc121, A230079K17Rik, Lbr, EG433384, Enah
Downstream gene	Srp9, EG625823, Degs1, 1700047M11Rik, Fbxo28, LOC435657, ENSMUSG00000073482, Trp53bp2, Capn2, LOC666624, Capn8, 4922505E12Rik, Susd4, Tlr5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nvl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67459 MGI:1914709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnih4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98417 MGI:1925828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226757 MGI:1923825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 556 ESTs, 5 Proteins

name	LOC666519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 97 ESTs, 3 Proteins pseudo : _no_value

name	Cnih3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72978 MGI:1920228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403180 MGI:2685601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 3 Proteins

name	A230079K17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240960 MGI:2444525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98386 MGI:2138281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433384 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433384 MGI:3647595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Enah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13800 MGI:108360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Srp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27058 MGI:1350930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625823 MGI:3647849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 50 Proteins

name	Degs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13244 MGI:1097711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700047M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67330 MGI:1914580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs

name	Fbxo28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67948 MGI:1261890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435657 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	ENSMUSG00000073482 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:669853 MGI:3642267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Trp53bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209456 MGI:2138319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12334 MGI:88264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Capn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170725 MGI:2181366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4922505E12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433386 MGI:3618292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Susd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:96935 MGI:2138351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53791 MGI:1858171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nvl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468980 GeneID:67459 MGI:1914709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear VCP-like transcript_id : NM_026171.1

name	Cnih4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68226733 GeneID:98417 MGI:1925828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornichon homolog 4 (Drosophila) transcript_id : NM_030131.2

name	Wdr26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649738 GeneID:226757 MGI:1923825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 26 transcript_id : NM_145514.3

name	LOC100042363 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245459 GeneID:100042363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 556 ESTs, 5 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001478698.1

name	Cnih3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364355 GeneID:72978 MGI:1920228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornichon homolog 3 (Drosophila) transcript_id : NM_028408.2

name	Ccdc121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364589 GeneID:403180 MGI:2685601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 3 Proteins product : coiled-coil domain containing 121 transcript_id : XM_619714.3

name	A230079K17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347386 GeneID:240960 MGI:2444525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230079K17 gene transcript_id : NM_172846.2

name	Lbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527033 GeneID:98386 MGI:2138281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lamin B receptor transcript_id : NM_133815.1

name	Enah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778996 GeneID:13800 MGI:108360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enabled homolog (Drosophila) transcript_id : NM_001083121.1

name	Enah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133779001 GeneID:13800 MGI:108360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enabled homolog (Drosophila) transcript_id : NM_001083120.1

name	Enah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778938 GeneID:13800 MGI:108360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enabled homolog (Drosophila) transcript_id : NM_008680.2

name	Enah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778925 GeneID:13800 MGI:108360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enabled homolog (Drosophila) transcript_id : NM_010135.2

name	Srp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560508 GeneID:27058 MGI:1350930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle 9 transcript_id : NM_012058.2

name	EG625823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364596 GeneID:625823 MGI:3647849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 50 Proteins product : predicted gene, EG625823 transcript_id : XM_890391.2

name	Degs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802252 GeneID:13244 MGI:1097711
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : degenerative spermatocyte homolog 1 (Drosophila) transcript_id : NM_007853.3

name	1700047M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245469 GeneID:67330 MGI:1914580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs product : RIKEN cDNA 1700047M11 gene transcript_id : XM_001478812.1

name	Fbxo28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301478 GeneID:67948 MGI:1261890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 28 transcript_id : NM_175127.2

name	ENSMUSG00000073482 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245411 GeneID:669853 MGI:3642267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, ENSMUSG00000073482 transcript_id : XM_001475966.1

name	Trp53bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112799850 GeneID:209456 MGI:2138319
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 binding protein 2 transcript_id : NM_173378.2

name	Capn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345046 GeneID:12334 MGI:88264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 2 transcript_id : NM_009794.2

name	Capn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18700033 GeneID:170725 MGI:2181366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 8 transcript_id : NM_130890.1

name	4922505E12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680843 GeneID:433386 MGI:3618292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4922505E12 gene transcript_id : NM_001033547.2

name	Susd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802284 GeneID:96935 MGI:2138351
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi domain containing 4 transcript_id : NM_144796.3

name	Tlr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248589 GeneID:53791 MGI:1858171
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 5 transcript_id : NM_016928.2

name	Nvl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468981 CCDS:CCDS15581.1 GeneID:67459 MGI:1914709
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : nuclear VCP-like protein_id : NP_080447.1

name	Cnih4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68131553 CCDS:CCDS15582.1 GeneID:98417 MGI:1925828
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : cornichon homolog 4 protein_id : NP_084407.1

name	Wdr26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649739 CCDS:CCDS15583.1 GeneID:226757 MGI:1923825
definition	codon_start : 1 product : WD repeat domain 26 protein_id : NP_663489.3

name	LOC100042363 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245460 GeneID:100042363
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478748.1

name	Cnih3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386310 GeneID:72978 MGI:1920228
definition	codon_start : 1 product : cornichon homolog 3 protein_id : NP_082684.1

name	Ccdc121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63480792 GeneID:403180 MGI:2685601
definition	codon_start : 1 product : coiled-coil domain containing 121 protein_id : XP_619714.1

name	A230079K17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370276 GeneID:240960 MGI:2444525
definition	GO_function : GO:0042624 - ATPase activity, uncoupled [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240960 protein_id : NP_766434.1

name	Lbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527034 CCDS:CCDS15584.1 GeneID:98386 MGI:2138281
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005637 - nuclear inner membrane [Evidence TAS]; GO:0005652 - nuclear lamina [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ichthyosis product : lamin B receptor protein_id : NP_598576.1

name	Enah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778997 GeneID:13800 MGI:108360
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007015 - actin filament organization [Evidence IDA]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0007411 - axon guidance [Evidence IMP] [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006928 - cell motility [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0046907 - intracellular transport [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IGI] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; NPC derived proline rich protein 1 product : enabled homolog isoform 4 protein_id : NP_001076590.1

name	Enah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133779002 GeneID:13800 MGI:108360
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007015 - actin filament organization [Evidence IDA]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0007411 - axon guidance [Evidence IMP] [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006928 - cell motility [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0046907 - intracellular transport [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IGI] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; NPC derived proline rich protein 1 product : enabled homolog isoform 3 protein_id : NP_001076589.1

name	Enah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778939 GeneID:13800 MGI:108360
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007015 - actin filament organization [Evidence IDA]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0007411 - axon guidance [Evidence IMP] [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006928 - cell motility [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0046907 - intracellular transport [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IGI] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; NPC derived proline rich protein 1 product : enabled homolog isoform 2 protein_id : NP_032706.2

name	Enah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778926 GeneID:13800 MGI:108360
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007015 - actin filament organization [Evidence IDA]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0007411 - axon guidance [Evidence IMP] [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006928 - cell motility [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0046907 - intracellular transport [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IGI] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; NPC derived proline rich protein 1 product : enabled homolog isoform 1 protein_id : NP_034265.2

name	Srp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755662 GeneID:27058 MGI:1350930
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0045900 - negative regulation of translational elongation [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 note : signal recognition particle 9 kDa product : signal recognition particle 9 protein_id : NP_036188.1

name	EG625823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883344 GeneID:625823 MGI:3647849
definition	codon_start : 1 product : similar to vomeronasal V1r-type receptor V1ra16 protein_id : XP_895484.1

name	Degs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681175 CCDS:CCDS15587.1 GeneID:13244 MGI:1097711
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA] GO_process : GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 note : dihydroceramide desaturase product : degenerative spermatocyte homolog 1 protein_id : NP_031879.1

name	1700047M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245470 GeneID:67330 MGI:1914580
definition	codon_start : 1 product : hypothetical protein LOC67330 protein_id : XP_001478862.1

name	Fbxo28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201989 CCDS:CCDS15588.1 GeneID:67948 MGI:1261890
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : F-box protein 28 protein_id : NP_780336.1

name	ENSMUSG00000073482 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245412 GeneID:669853 MGI:3642267
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476016.1

name	Trp53bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112799851 GeneID:209456 MGI:2138319
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0007417 - central nervous system development [Evidence IMP]; GO:0009792 - embryonic development (sensu Metazoa) [Evidence IGI]; GO:0007507 - heart development [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS]; GO:0010212 - response to ionizing radiation [Evidence IMP] codon_start : 1 product : tumor protein p53 binding protein, 2 protein_id : NP_775554.2

name	Capn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753254 GeneID:12334 MGI:88264
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence TAS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cysteine proteinase; m-calpain 80 kDa large subunit; m-calpain large subunit product : calpain 2 protein_id : NP_033924.1

name	Capn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700034 GeneID:170725 MGI:2181366
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : calcium-dependent cysteine protease note : stomach-specific calpain (nCL-2) product : calpain 8 protein_id : NP_570960.1

name	4922505E12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702055 CCDS:CCDS15589.1 GeneID:433386 MGI:3618292
definition	codon_start : 1 product : hypothetical protein LOC433386 protein_id : NP_001028719.1

name	Susd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061331 CCDS:CCDS15590.1 GeneID:96935 MGI:2138351
definition	codon_start : 1 product : sushi domain containing 4 protein_id : NP_659045.2

name	Tlr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248590 GeneID:53791 MGI:1858171
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 product : toll-like receptor 5 protein_id : NP_058624.2

name	LOC435657 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435657
definition	number : 1 pseudo : _no_value

name	LOC666624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666624
definition	number : 1 pseudo : _no_value

name	LOC666624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666624
definition	number : 2 pseudo : _no_value

name	LOC666624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666624
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:178547
definition	standard_name : AI647760

name	(CDS detail)
type	STS
link
xref	UniSTS:178532
definition	standard_name : AW050376

name	(CDS detail)
type	STS
link
xref	UniSTS:158898
definition	standard_name : AU044014

name	(CDS detail)
type	STS
link
xref	UniSTS:234284
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158904
definition	standard_name : AI447817

name	(CDS detail)
type	STS
link
xref	UniSTS:162994
definition	standard_name : RH126286

name	(CDS detail)
type	STS
link
xref	UniSTS:124158
definition	standard_name : 35.MMHAP85FLD5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:209715
definition	standard_name : RH126601

name	(CDS detail)
type	STS
link
xref	UniSTS:128911
definition	standard_name : D1Mit542

name	(CDS detail)
type	STS
link
xref	UniSTS:125435
definition	standard_name : MHAa88e6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234293
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128622
definition	standard_name : D1Mit273

name	(CDS detail)
type	STS
link
xref	UniSTS:123519
definition	standard_name : 21.MMHAP34FRG9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128891
definition	standard_name : D1Mit525

name	(CDS detail)
type	STS
link
xref	UniSTS:128891
definition	standard_name : D1Mit525

name	(CDS detail)
type	STS
link
xref	UniSTS:178546
definition	standard_name : AI505894

name	(CDS detail)
type	STS
link
xref	UniSTS:128729
definition	standard_name : D1Mit37

name	(CDS detail)
type	STS
link
xref	UniSTS:234292
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165131
definition	standard_name : AW045240

name	(CDS detail)
type	STS
link
xref	UniSTS:265075
definition	standard_name : Enah

name	(CDS detail)
type	STS
link
xref	UniSTS:165130
definition	standard_name : AI464316

name	(CDS detail)
type	STS
link
xref	UniSTS:124725
definition	standard_name : D10727

name	(CDS detail)
type	STS
link
xref	UniSTS:217761
definition	standard_name : RH134481

name	(CDS detail)
type	STS
link
xref	UniSTS:210258
definition	standard_name : RH136265

name	(CDS detail)
type	STS
link
xref	UniSTS:258254
definition	standard_name : Enah

name	(CDS detail)
type	STS
link
xref	UniSTS:125319
definition	standard_name : MHAa78b5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128828
definition	standard_name : D1Mit458

name	(CDS detail)
type	STS
link
xref	UniSTS:124371
definition	standard_name : 40.MMHAP61FLF4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:161109
definition	standard_name : RH124287

name	(CDS detail)
type	STS
link
xref	UniSTS:207262
definition	standard_name : AW822031

name	(CDS detail)
type	STS
link
xref	UniSTS:213389
definition	standard_name : RH130101

name	(CDS detail)
type	STS
link
xref	UniSTS:167281
definition	standard_name : D1Ertd578e

name	(CDS detail)
type	STS
link
xref	UniSTS:128719
definition	standard_name : D1Mit360

name	(CDS detail)
type	STS
link
xref	UniSTS:162131
definition	standard_name : RH125309

name	(CDS detail)
type	STS
link
xref	UniSTS:164142
definition	standard_name : AI746547

name	(CDS detail)
type	STS
link
xref	UniSTS:158900
definition	standard_name : AI326419

name	(CDS detail)
type	STS
link
xref	UniSTS:124546
definition	standard_name : RH118246

name	(CDS detail)
type	STS
link
xref	UniSTS:162985
definition	standard_name : RH126277

name	(CDS detail)
type	STS
link
xref	UniSTS:125499
definition	standard_name : N28096

name	(CDS detail)
type	STS
link
xref	UniSTS:178535
definition	standard_name : AI848994

name	(CDS detail)
type	STS
link
xref	UniSTS:234286
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:479048
definition	standard_name : Tlr5

name	(CDS detail)
type	STS
link
xref	UniSTS:270622
definition	standard_name : PMC133006P2

name	(CDS detail)
type	STS
link
xref	UniSTS:271724
definition	standard_name : PMC187346P1

name	(CDS detail)
type	STS
link
xref	UniSTS:166559
definition	standard_name : Tlr5

name	LOC666519 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245405 GeneID:666519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 97 ESTs, 3 Proteins product : similar to 2310022K01Rik protein pseudo : _no_value transcript_id : XR_032406.1

name	EG433384 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149245410 GeneID:433384 MGI:3647595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG433384 transcript_id : XR_035284.1

clone name	MSMg01-381J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-049L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154M13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-132A11.b	B6Ng01-132A11.g
ACC	DH932940	DH932941
length	1,224	1,120
definition	DH932940\|Mus musculus domesticus DNA, BAC clone: B6Ng01-132A11, 5' end.	DH932941\|Mus musculus domesticus DNA, BAC clone: B6Ng01-132A11, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccaggaacagagagaaggatagggtagcatgaggatattttttct cactacacacacctggtgcacctggtagttgtggtgacaggccattgctt aaggagctgctaggtcccagagggacattttcctctattgcttctctacc ttattttgagtacttaaaaattattctcagtgttgttagcatgtgtacat gtgtatgtatgtgaatgttagcacacatgtgacagcgtgcatatgtgcca ctatatggaggtcagagaacaactttcaggagtcagttctctgctgcctt ccaccttgctaaggcagagtttctttgtacctcccatgctctataaccca agctacctggtacttgaactccccagcaatgtgtctctgcttcctgtagc tggtctctgcttttttataaggtctttttcttccgccctttattccccag gtgtttattcaccccctaacattagataggagagaaacaaagagagagga gggagaggattaggaaattttctgaatctaatttcttttgtgttgttcct tctttgagattgactactaacaaaccacagccaaccccccctaaatgacc aacaaccaaacacctcacctattaggactctagcaataaaccctcagaag tttccagagttccaaaactcacacaatcacagatactatctgcagctggc aaaaccatgcctctgctaaagcacaaggcaaatcacagtcagctctgtgg agagttcaaagctgccctgattcccacactgggaatgaaaatgaaaacac attcttataatatttctgtgtgttttaaagaaaccagaatccaaaattgt cacaatttccccctttccgttccaaaccattaattatgctgagtgtggta ggaaatgataaacacagacattttcaatgaaataagcacattttgagtca ttagccaagtttcagagactctctgctcaactctaatctaatcagtttga tgtatcacagctttcatactgtggaaaataaaacaatttggtccacataa acttcactgtttctttctgatgtaatggatcttataaatgtaaggctgat taatctacagtccttctaaaccaatgtctccgccttggtctcttttcata aacttcaaaatttaggtaacgagacatattgctttgagttatcggaagac tcaactctgtggtgtcgtaagata	gaattcattattaatggagagagatctggggaagcagaaaggaggtgcct tccagacatctctttgcaaaatgaaccctgtccatgcctgaggctgggtt atgggaaagtttcgagcagtgctttcacaaaagcatctcaggactgaaca gatgctggtagacaggcaagcgagcctggctggctttctagtgacagtgg ccagatgaccacagaggtgggagggatgtcatcctgagacctgcaggcag catacggttggtcagggacctgggactggtttacactggcaatgtgccat catgttctgagcttggaaataattgatgtgacacagtcttttaggggaaa ataaaggcatttcaggatgaggggagctcagaatctccaaagataacacc agcagctctgtgaggggtgaattcagtgagaagaggcaaagtggagagga ttaatgaatgttaaaatgaacatcgttgatcaagttctgagcacagaaac aggaactacaagaaggggccattttgagaccatggtagtataagcgatag acttggatggcaagtttgactcagaagaagaaatagtcaggaagagatgc tgtggatggacagactagataaggtgtctgggactcatttttaaagaggt caagttgggtcaagggattctgatgtcatgggggaggggtgagatttaaa actgaaagagctttagggattctaattaattaaacttttaatgccatcta ttactcgactgcatgtgtgcccacaagtggaggcagaggacaaccatggg tccgtctgtctttccaccacttcttgatttcaggttacggagctggatgg cagacccctttctctactgagccatcttgccagttcttgaacttattttt tgagacaggatcttcatcaagtagcccaggctgggttggaactatagctc tcctatttcagactcccgaactccattatagattctccctgcttcttgaa cagctgcaatttgcatgtcactataaaggtcaaagacacctccacctaga attcagtaccttcgggggccaaatattttccgatccatcctgaatggtgt gttcccaaatcaaatttccc
quality values	Open. Hide. 61 41 42 39 61 61 37 27 53 61 61 53 61 27 61 61 61 61 61 61 61 61 61 36 30 13 16 17 12 13 12 10 13 13 10 36 55 59 61 59 37 59 59 61 61 61 61 59 59 61 59 61 61 61 59 59 59 55 55 61 59 61 59 61 61 61 61 61 61 59 59 59 44 37 35 28 52 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 39 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 53 61 61 61 61 61 53 61 61 61 61 53 61 47 61 61 61 61 61 61 61 61 61 53 61 39 61 61 61 61 57 50 57 47 47 47 53 52 57 57 53 53 53 53 47 53 53 47 39 53 53 47 47 47 47 47 53 52 53 57 47 53 57 52 34 47 52 57 53 52 53 53 47 28 53 47 53 52 52 53 53 45 52 38 53 53 53 53 50 53 27 57 52 33 53 53 50 53 50 53 39 47 50 42 36 45 32 39 45 39 52 52 42 57 53 38 52 47 38 38 57 50 42 53 37 50 50 37 38 32 52 46 43 47 47 50 52 53 35 47 47 53 41 41 36 46 45 37 37 42 36 53 53 53 46 47 53 43 33 34 39 47 37 39 34 28 43 57 50 47 37 50 30 50 50 39 50 37 40 42 50 43 42 38 53 53 30 36 35 39 36 52 36 57 35 38 50 40 40 37 35 40 52 33 40 33 35 37 36 38 36 37 52 34 40 44 38 35 47 36 35 40 37 40 53 34 34 37 43 30 19 39 44 35 40 32 24 37 17 53 40 28 37 27 31 33 47 57 53 40 29 22 40 37 53 53 37 40 36 44 45 44 35 33 25 41 30 31 33 32 32 48 34 35 28 30 29 29 24 51 30 30 33 36 25 44 27 32 32 51 51 30 30 46 47 33 39 48 30 18 13 18 18 43 29 26 14 30 30 38 48 13 12 30 34 27 29 21 30 27 30 28 29 17 15 25 27 37 11 10 25 25 20 30 29 32 24 28 28 18 31 29 23 33 25 35 29 20 17 15 5 11 22 28 30 31 33 34 21 25 27 11 26 39 17 26 7 29 29 51 21 16 29 29 28 21 51 21 19 15 29 16 22 29 25 14 11 51 51 29 28 21 21 18 29 28 51 9 8 5 31 19 29 21 23 16 26 39 30 25 22 27 23 25 23 12 23 28 31 23 31 34 20 11 11 5 44 16 21 7 6 13 9 23 36 24 17 27 16 23 33 19 12 18 16 23 19 33 25 14 26 15 9 29 38 18 19 21 28 25 13 23 38 22 20 30 9 31 6 9 9 32 10 20 27 11 13 20 51 28 19 12 38 17 33 16 30 13 26 21 20 17 11 5 4 5 27 28 5 4 19 9 7 5 4 4 7 6 5 10 28 8 6 7 10 24 22 10 29 25 6 10 14 17 10 3 20 9 10 4 18 10 6 9 16 19 9 14 7 10 24 11 8 9 6 7 14 3 5 10 12 20 30 17 9 30 11 16 4 17 5 8 7 6 26 9 9 27 4 14 5 5 4 7 13 9 8 6 3 17 13 18 9 5 19 3 9 6 8 23 6 6 4 4 16 9 9 5 3 5 16 8 9 7 9 15 10 6 4 9 13 9 11 7 18 7 19 7 3 7 10 10 16 25 30 13 12 13 8 21 5 3 7 14 17 4 6 7 4 4 4 5 7 3 4 3 3 1 12 13 10 1 4 4 5 9 6 3 4 5 5 5 3 5 5 4 5 9 3 6 4 12 4 5 14 4 14 17 3 2 1 1 4 3 3 9 5 4 5 1	Open. Hide. 55 47 52 49 61 17 11 28 21 22 21 26 25 23 24 44 55 61 59 61 61 61 61 49 49 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 44 55 59 59 40 28 35 59 52 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 47 43 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 47 47 50 61 61 61 61 50 61 61 61 61 61 61 53 52 47 61 47 61 61 61 33 61 61 61 53 61 61 61 61 61 61 61 52 61 53 61 53 61 61 61 61 61 53 61 61 53 61 61 61 61 61 61 61 61 53 61 61 47 23 61 53 39 57 57 35 57 57 53 52 53 53 57 53 52 47 53 57 57 46 57 45 43 34 53 52 53 53 50 53 53 47 30 57 57 47 47 50 52 47 43 57 57 45 53 38 50 47 19 42 34 57 52 52 53 57 57 53 42 32 53 52 40 52 57 57 57 45 47 46 52 52 53 33 41 30 47 37 57 53 57 53 47 47 43 42 50 42 50 53 52 57 36 21 36 48 53 52 52 33 37 37 39 28 53 42 57 57 57 53 46 21 33 28 33 45 53 47 29 45 23 25 34 24 57 57 50 30 41 52 37 45 30 28 52 27 40 45 40 38 11 5 36 34 18 8 57 34 27 47 39 23 53 30 33 33 15 8 46 25 34 27 57 53 29 19 34 33 39 52 42 22 41 53 35 36 27 33 29 32 19 25 23 37 31 31 34 34 16 41 35 29 22 13 32 29 37 39 27 37 31 47 41 42 52 24 25 16 31 18 32 27 26 9 38 31 12 18 30 27 17 20 33 35 53 57 34 25 25 20 21 32 31 30 16 28 16 29 32 18 10 9 15 22 18 29 26 30 14 7 9 25 29 32 45 17 17 26 24 33 23 30 24 22 6 44 24 17 33 28 19 37 32 31 18 22 13 29 6 33 20 32 29 21 22 33 31 9 5 22 25 25 18 23 38 29 27 29 34 14 29 14 8 10 30 31 14 18 18 14 13 31 7 16 23 21 25 27 22 12 20 18 26 29 51 31 8 10 31 9 29 28 21 21 24 21 28 25 14 13 11 14 15 12 11 8 17 35 23 5 17 37 31 29 13 22 12 7 16 16 29 19 18 11 7 10 18 16 10 29 29 29 25 18 23 20 16 14 27 14 29 19 29 12 8 7 8 9 7 14 33 29 12 6 6 16 11 21 25 27 19 29 25 14 20 29 7 20 29 9 11 11 12 36 17 17 27 19 18 21 9 5 5 29 19 10 7 16 18 24 9 7 30 12 29 22 51 10 11 25 22 8 29 8 9 8 6 5 8 8 7 7 17 21 24 13 19 24 26 27 15 22 14 14 26 29 9 18 35 14 30 32 36 25 7 15 31 12 35 23 15 18 9 19 7 30 14 22 23 6 4 10 6 5 4 6 7 5 12 21 6 6 34 39 9 38 35 8 29 8 7 5 5 5 12 16 13 17 20 21 11 11 4 3 3 5 16 5 4 6 19 17 5 33 5 29 16 14 17 6 9 21 11 28 22 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_184035115_184036231
seq2: B6Ng01-132A11.g_70_1189

seq1  GAATTCATTATTAATGGAGAGAGATCTGGGGAAGCAGAAAGGAGGTGCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTATTAATGGAGAGAGATCTGGGGAAGCAGAAAGGAGGTGCCT  50

seq1  TCCAGACATCTCTTTGCAAAATGAACCCTGTCCATGCCTGAGGCTGGGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGACATCTCTTTGCAAAATGAACCCTGTCCATGCCTGAGGCTGGGTT  100

seq1  ATGGGAAAGTTTCGAGCAGTGCTTTCACAAAAGCATCTCAGGACTGAACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGAAAGTTTCGAGCAGTGCTTTCACAAAAGCATCTCAGGACTGAACA  150

seq1  GATGCTGGTAGACAGGCAAGCGAGCCTGGCTGGCTTTCTAGTGACAGTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCTGGTAGACAGGCAAGCGAGCCTGGCTGGCTTTCTAGTGACAGTGG  200

seq1  CCAGATGACCACAGAGGTGGGAGGGATGTCATCCTGAGACCTGCAGGCAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGATGACCACAGAGGTGGGAGGGATGTCATCCTGAGACCTGCAGGCAG  250

seq1  CATACGGTTGGTCAGGGACCTGGGACTGGTTTACACTGGCAATGTGCCAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATACGGTTGGTCAGGGACCTGGGACTGGTTTACACTGGCAATGTGCCAT  300

seq1  CATGTTCTGAGCTTGGAAATAATTGATGTGACACAGTCTTTTAGGGGAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTTCTGAGCTTGGAAATAATTGATGTGACACAGTCTTTTAGGGGAAA  350

seq1  ATAAAGGCATTTCAGGATGAGGGGAGCTCAGAATCTCCAAAGATAACACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAGGCATTTCAGGATGAGGGGAGCTCAGAATCTCCAAAGATAACACC  400

seq1  AGCAGCTCTGTGAGGGGTGAATTCAGTGAGAAGAGGCAAAGTGGAGAGGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGCTCTGTGAGGGGTGAATTCAGTGAGAAGAGGCAAAGTGGAGAGGA  450

seq1  TTAATGAATGTTAAAATGAACATCGTTGATCAAGTTCTGAGCACAGAAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATGAATGTTAAAATGAACATCGTTGATCAAGTTCTGAGCACAGAAAC  500

seq1  AGGAACTACAAGAAGGGGCCATTTTGAGACCATGGTAGTATAAGCGATAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAACTACAAGAAGGGGCCATTTTGAGACCATGGTAGTATAAGCGATAG  550

seq1  ACTTGGATGGCAAGTTTGACTCAGAAGAAGAAATAGTCAGGAAGAGATGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGATGGCAAGTTTGACTCAGAAGAAGAAATAGTCAGGAAGAGATGC  600

seq1  TGTGGATGGACAGACTAGATAAGGTGTCTGGGACTCATTTTTAAAGAGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGATGGACAGACTAGATAAGGTGTCTGGGACTCATTTTTAAAGAGGT  650

seq1  CAAGTTGGGTCAAGGGATTCTGATGTCATGGGGGAGGGGTGAGATTTAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTTGGGTCAAGGGATTCTGATGTCATGGGGGAGGGGTGAGATTTAAA  700

seq1  ACTGAAAGAGCTTTAGGGATTCTAATTAATTAAACTTTTAATGCCATCTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAAAGAGCTTTAGGGATTCTAATTAATTAAACTTTTAATGCCATCTA  750

seq1  TTACTCGACTGCATGTGTGCCCACAAGTGGAGGCAGAGGACAACCATGGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTCGACTGCATGTGTGCCCACAAGTGGAGGCAGAGGACAACCATGGG  800

seq1  TCCGTCTGTCTTTCCACCACTTC-TGATTTCAGGTTACGGAGCTGGATGG  849
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  TCCGTCTGTCTTTCCACCACTTCTTGATTTCAGGTTACGGAGCTGGATGG  850

seq1  CAGACCCCTTTC-CTACTGAGCCATC-TGCCAG-TCCTGAACTTA-TTTT  895
      |||||||||||| ||||||||||||| |||||| || |||||||| ||||
seq2  CAGACCCCTTTCTCTACTGAGCCATCTTGCCAGTTCTTGAACTTATTTTT  900

seq1  TGAGACAGGATC-TCATCAAGTAGCCCAGGCTGGGTTGGAACTATAGCTC  944
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  TGAGACAGGATCTTCATCAAGTAGCCCAGGCTGGGTTGGAACTATAGCTC  950

seq1  TCCTATTTCAGACTCCCCAGACTCCCATTATAGATTCT-CCTGCTTC-TG  992
      ||||||||||||||||| | ||| |||||||||||||| |||||||| ||
seq2  TCCTATTTCAGACTCCCGA-ACT-CCATTATAGATTCTCCCTGCTTCTTG  998

seq1  GACAGCTGCCAATTTGCAGGTCAC-ATAGAGGTCAAAGACACC-CCACCT  1040
       ||||||| ||||||||| ||||| ||| |||||||||||||| ||||| 
seq2  AACAGCTG-CAATTTGCATGTCACTATAAAGGTCAAAGACACCTCCACC-  1046

seq1  TAGAATTCAGTACCTTCTGTGGGTCAATTATTTTCCCAATCCA-CCTGAA  1089
      ||||||||||||||||| | ||| ||| |||||| || ||||| ||||||
seq2  TAGAATTCAGTACCTTC-GGGGGCCAAATATTTT-CCGATCCATCCTGAA  1094

seq1  TTGTCTTGTTCCCTAATTCAAATTTCCC  1117
      | ||  ||||||| || |||||||||||
seq2  TGGT-GTGTTCCC-AAATCAAATTTCCC  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information