MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-136M13
Chromosome	1 (Build37)
Map Location	35,902,349 - 35,903,430
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Plekhb2, LOC666261, LOC100041544
Downstream gene	LOC666283, LOC100041091, EG666290, Hs6st1, Ugcgl1, LOC100041123, Lincr, Arid5a, 4632411B12Rik, 4930533C12Rik, Lman2l, Cnnm4, Cnnm3, Ankrd23, Ankrd39, Sema4c, 1700024G10Rik, BC050210, EG623414, Cox5b, Actr1b, 4933424G06Rik, Zap70, Tmem131
Link	Open Mouse BAC browser

Click to get alignment info.

name	Plekhb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226971 MGI:2385825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC666283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041091 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666290 MGI:3645026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Hs6st1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50785 MGI:1354958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugcgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320011 MGI:2443162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Lincr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214854 MGI:2429944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214855 MGI:2443039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632411B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226976 MGI:1918055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930533C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211430 MGI:3616091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Lman2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214895 MGI:2443010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnnm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94220 MGI:2151060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94218 MGI:2151055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ankrd23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78321 MGI:1925571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109346 MGI:1914816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20353 MGI:109252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 11 Proteins

name	1700024G10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71849 MGI:1919099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins

name	BC050210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381337 MGI:3026913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623414 MGI:3649065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 167 ESTs, 6 Proteins

name	Cox5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12859 MGI:88475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actr1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226977 MGI:1917446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933424G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71166 MGI:1918416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Zap70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22637 MGI:99613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56030 MGI:1927110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637809 GeneID:226971 MGI:2385825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family B (evectins) member 2 transcript_id : NM_145516.2

name	LOC100041544 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233804 GeneID:100041544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041544 transcript_id : XM_001476287.1

name	LOC100041091 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233793 GeneID:100041091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041091 transcript_id : XM_001475790.1

name	EG666290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363283 GeneID:666290 MGI:3645026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG666290 transcript_id : XM_982794.1

name	Hs6st1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657187 GeneID:50785 MGI:1354958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 1 transcript_id : NM_015818.1

name	Ugcgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45387932 GeneID:320011 MGI:2443162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-glucose ceramide glucosyltransferase-like 1 transcript_id : NM_198899.1

name	Lincr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130116 GeneID:214854 MGI:2429944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lung-inducible neuralized-related C3HC4 RING domain protein transcript_id : NM_153408.2

name	Arid5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803361 GeneID:214855 MGI:2443039
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 5A (Mrf1 like) transcript_id : NM_145996.3

name	4632411B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803445 GeneID:226976 MGI:1918055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632411B12 gene transcript_id : NM_172652.2

name	Lman2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61656185 GeneID:214895 MGI:2443010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, mannose-binding 2-like transcript_id : NM_001013374.1

name	Cnnm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809003 GeneID:94220 MGI:2151060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M4 transcript_id : NM_033570.1

name	Cnnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196783 GeneID:94218 MGI:2151055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M3 transcript_id : NM_001039551.1

name	Cnnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196781 GeneID:94218 MGI:2151055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M3 transcript_id : NM_053186.2

name	Ankrd23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130132 GeneID:78321 MGI:1925571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 23 transcript_id : NM_153502.3

name	Ankrd39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803363 GeneID:109346 MGI:1914816
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 39 transcript_id : NM_026241.2

name	Sema4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363287 GeneID:20353 MGI:109252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 11 Proteins product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C, transcript variant 3 transcript_id : XM_898566.2

name	1700024G10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233811 GeneID:71849 MGI:1919099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : RIKEN cDNA 1700024G10 gene, transcript variant 2 transcript_id : XM_889674.3

name	BC050210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235749 GeneID:381337 MGI:3026913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050210 transcript_id : NM_201365.1

name	EG623414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233812 GeneID:623414 MGI:3649065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 167 ESTs, 6 Proteins product : predicted gene, EG623414 transcript_id : XM_889697.3

name	Cox5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807194 GeneID:12859 MGI:88475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit Vb transcript_id : NM_009942.2

name	Actr1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130225 GeneID:226977 MGI:1917446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ARP1 actin-related protein 1 homolog B (yeast) transcript_id : NM_146107.2

name	4933424G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363298 GeneID:71166 MGI:1918416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 4933424G06 gene transcript_id : XM_129743.5

name	Zap70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981915 GeneID:22637 MGI:99613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zeta-chain (TCR) associated protein kinase transcript_id : NM_009539.2

name	Tmem131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372305 GeneID:56030 MGI:1927110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 131 transcript_id : NM_018872.2

name	Plekhb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704016 CCDS:CCDS14874.1 GeneID:226971 MGI:2385825
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : evectin-2; pleckstrin homology domain-containing product : pleckstrin homology domain containing, family B (evectins) member 2 protein_id : NP_663491.1

name	LOC100041544 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233805 GeneID:100041544
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476337.1

name	LOC100041091 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233794 GeneID:100041091
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475840.1

name	EG666290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363284 GeneID:666290 MGI:3645026
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987888.1

name	Hs6st1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657188 GeneID:50785 MGI:1354958
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : heparan sulfate 6-O-sulfotransferase 1 protein_id : NP_056633.1

name	Ugcgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45387933 GeneID:320011 MGI:2443162
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS]; GO:0005793 - ER-Golgi intermediate compartment [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0003980 - UDP-glucose:glycoprotein glucosyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence ISS] GO_process : GO:0051084 - posttranslational protein folding [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP-glucose ceramide glucosyltransferase-like 1 protein_id : NP_942602.1

name	Lincr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510281 CCDS:CCDS14875.1 GeneID:214854 MGI:2429944
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lung inducible neuralized-related C3HC4 RING finger product : lung-inducible neuralized-related C3HC4 RING domain protein protein_id : NP_700457.1

name	Arid5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542476 CCDS:CCDS14876.1 GeneID:214855 MGI:2443039
definition	codon_start : 1 product : modulator recognition factor I protein_id : NP_666108.2

name	4632411B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369930 CCDS:CCDS14877.1 GeneID:226976 MGI:1918055
definition	codon_start : 1 product : hypothetical protein LOC226976 protein_id : NP_766240.1

name	Lman2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656186 CCDS:CCDS14878.1 GeneID:214895 MGI:2443010
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0030134 - ER to Golgi transport vesicle [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005537 - mannose binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS]; GO:0006457 - protein folding [Evidence ISS]; GO:0015031 - protein transport [Evidence ISS] codon_start : 1 product : lectin, mannose-binding 2-like protein_id : NP_001013392.1

name	Cnnm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809004 CCDS:CCDS14879.1 GeneID:94220 MGI:2151060
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ancient conserved domain protein 4 product : cyclin M4 protein_id : NP_291048.1

name	Cnnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196782 CCDS:CCDS14880.1 GeneID:94218 MGI:2151055
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ancient conserved domain protein 3 product : cyclin M3 isoform 1 protein_id : NP_444416.2

name	Cnnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196784 CCDS:CCDS14881.1 GeneID:94218 MGI:2151055
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ancient conserved domain protein 3 product : cyclin M3 isoform 2 protein_id : NP_001034640.1

name	Ankrd23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883850 CCDS:CCDS14882.1 GeneID:78321 MGI:1925571
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006631 - fatty acid metabolism [Evidence IDA] codon_start : 1 note : diabetes-realted ankyrin repeat protein product : diabetes related ankyrin repeat protein protein_id : NP_705722.2

name	Ankrd39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037099 CCDS:CCDS14883.1 GeneID:109346 MGI:1914816
definition	codon_start : 1 product : ankyrin repeat domain 39 protein_id : NP_080517.1

name	Sema4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363288 GeneID:20353 MGI:109252
definition	codon_start : 1 product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C isoform 3 protein_id : XP_903659.2

name	1700024G10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82878827 GeneID:71849 MGI:1919099
definition	codon_start : 1 product : hypothetical protein LOC71849 isoform 2 protein_id : XP_894767.1

name	BC050210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235750 CCDS:CCDS14885.1 GeneID:381337 MGI:3026913
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381337 protein_id : NP_958753.1

name	EG623414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82878832 GeneID:623414 MGI:3649065
definition	codon_start : 1 product : similar to putative translation initiation factor A121/Sui1 protein_id : XP_894790.1

name	Cox5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807195 CCDS:CCDS14886.1 GeneID:12859 MGI:88475
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase, subunit Vb protein_id : NP_034072.2

name	Actr1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122615 CCDS:CCDS14887.1 GeneID:226977 MGI:1917446
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : ARP1 actin-related protein 1 homolog B protein_id : NP_666219.1

name	4933424G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363299 GeneID:71166 MGI:1918416
definition	codon_start : 1 product : hypothetical protein LOC71166 protein_id : XP_129743.5

name	Zap70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981916 CCDS:CCDS14888.1 GeneID:22637 MGI:99613
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004715 - non-membrane spanning protein tyrosine kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IPI]; GO:0005515 - protein binding [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IMP] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IMP] [Evidence IDA]; GO:0046638 - positive regulation of alpha-beta T cell differentiation [Evidence IMP] [Evidence IGI]; GO:0046641 - positive regulation of alpha-beta T cell proliferation [Evidence IGI]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IMP]; GO:0045582 - positive regulation of T cell differentiation [Evidence ISS] [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence ISS] [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0050852 - T cell receptor signaling pathway [Evidence IMP]; GO:0045061 - thymic T cell selection [Evidence IMP] codon_start : 1 note : zeta-chain (TCR) associated protein kinase (70kD) product : zeta-chain (TCR) associated protein kinase protein_id : NP_033565.2

name	Tmem131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372306 GeneID:56030 MGI:1927110
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 131 protein_id : NP_061360.2

name	LOC666261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666261
definition	number : 1 pseudo : _no_value

name	LOC666261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666261
definition	number : 2 pseudo : _no_value

name	LOC666261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666261
definition	number : 3 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 1 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 2 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 3 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 4 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 1 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 2 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 3 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 4 pseudo : _no_value

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 1

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 2

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 3

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 4

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 5

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 6

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 7

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 8

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 9

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 10

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 11

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 12

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 13

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 14

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 15

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 16

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 17

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 18

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 19

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 20

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 21

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 22

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 23

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 24

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 25

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 26

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 27

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 28

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 29

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 30

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 31

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 32

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 33

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 34

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 35

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 36

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 37

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 38

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 39

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 40

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 41

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 42

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 43

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 44

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 45

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 46

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 47

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 48

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 49

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 50

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 51

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 52

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 53

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 54

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 55

name	(CDS detail)
type	STS
link
xref	UniSTS:210061
definition	standard_name : RH136066

name	(CDS detail)
type	STS
link
xref	UniSTS:158783
definition	standard_name : AU018239

name	(CDS detail)
type	STS
link
xref	UniSTS:128454
definition	standard_name : D1Mit121

name	(CDS detail)
type	STS
link
xref	UniSTS:128587
definition	standard_name : D1Mit243

name	(CDS detail)
type	STS
link
xref	UniSTS:122520
definition	standard_name : d9rat157

name	(CDS detail)
type	STS
link
xref	UniSTS:128930
definition	standard_name : D1Mit71

name	(CDS detail)
type	STS
link
xref	UniSTS:131148
definition	standard_name : D7Mit252.1

name	(CDS detail)
type	STS
link
xref	UniSTS:131147
definition	standard_name : MT2785

name	(CDS detail)
type	STS
link
xref	UniSTS:125327
definition	standard_name : MHAa78e6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:122839
definition	standard_name : 05.MMHAP9FLB2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128893
definition	standard_name : D1Mit527

name	(CDS detail)
type	STS
link
xref	UniSTS:128775
definition	standard_name : D1Mit412

name	(CDS detail)
type	STS
link
xref	UniSTS:142242
definition	standard_name : D1Mit465

name	(CDS detail)
type	STS
link
xref	UniSTS:128510
definition	standard_name : D1Mit170.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128509
definition	standard_name : MT262

name	(CDS detail)
type	STS
link
xref	UniSTS:128628
definition	standard_name : D1Mit278

name	(CDS detail)
type	STS
link
xref	UniSTS:234108
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:463453
definition	standard_name : Hs6st1

name	(CDS detail)
type	STS
link
xref	UniSTS:463454
definition	standard_name : Hs6st1

name	(CDS detail)
type	STS
link
xref	UniSTS:234109
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165069
definition	standard_name : AI414429

name	(CDS detail)
type	STS
link
xref	UniSTS:164110
definition	standard_name : AI448372

name	(CDS detail)
type	STS
link
xref	UniSTS:161805
definition	standard_name : RH124983

name	(CDS detail)
type	STS
link
xref	UniSTS:225338
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207145
definition	standard_name : RH127223

name	(CDS detail)
type	STS
link
xref	UniSTS:158785
definition	standard_name : AI431067

name	(CDS detail)
type	STS
link
xref	UniSTS:248487
definition	standard_name : BF413022

name	(CDS detail)
type	STS
link
xref	UniSTS:178376
definition	standard_name : AI647574

name	(CDS detail)
type	STS
link
xref	UniSTS:163045
definition	standard_name : RH126337

name	(CDS detail)
type	STS
link
xref	UniSTS:261569
definition	standard_name : AA859983

name	(CDS detail)
type	STS
link
xref	UniSTS:165070
definition	standard_name : AI853437

name	(CDS detail)
type	STS
link
xref	UniSTS:165071
definition	standard_name : AI851923

name	(CDS detail)
type	STS
link
xref	UniSTS:158784
definition	standard_name : AA960180

name	(CDS detail)
type	STS
link
xref	UniSTS:116249
definition	standard_name : D1Mit171

name	(CDS detail)
type	STS
link
xref	UniSTS:178375
definition	standard_name : AI327364

name	(CDS detail)
type	STS
link
xref	UniSTS:125022
definition	standard_name : MDB0491

name	(CDS detail)
type	STS
link
xref	UniSTS:142229
definition	standard_name : D1Bwg0491e

name	(CDS detail)
type	STS
link
xref	UniSTS:231591
definition	standard_name : RH142344

clone name	MSMg01-364O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-136M13.b	B6Ng01-136M13.g
ACC	DH936466	DH936467
length	1,078	1,227
definition	DH936466\|Mus musculus domesticus DNA, BAC clone: B6Ng01-136M13, 5' end.	DH936467\|Mus musculus domesticus DNA, BAC clone: B6Ng01-136M13, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccaaaagcttgcaacaaccagggatcaagagaaaagtgaatttcc tgttctgtttgcagatcaacagtggcacacaacctattcctctcagttca ctctgacgggcaaccatttatctagataatgcatttattatcacagttcc actgtttcctgttgagatagatgtgcaaaaaccgaagcgccgatgacttg cttgcacacattaactgtagggaaggaatacaaaattggacatattagat tattttggcgttaattcaatgtttgcagcctcccgttgttctccatcacc ccctctcctacaaatcaatttacaagggtttcgttggaaataatacttag tagcaagagctgtgggcgaacccagctgcagcgaatactctgttactaga agacagggaggctgaggggaccgatctccctggctcctgacagagcagct gtgctgaatgggtctcctacctcctactcttaaaatttggtggcctaggg caagaacacagataatgtaccacacatgagcaacactctagtattgattt acatgcaagcatgtgtatatgttcatgtatatgcaggtacacatgtgtgt tccatgtatgtgaggaccaatggccaacctcaggtgttctgtaggagtta tgcaccttggtctttgagactggccctctcatgaggacctgaggcttggc atttatttaagctggactggcaggccagtgagctccaagaatccacttgt ctctgcctcccttctcagtaggagagttaccaagcagacattattattat gtccagttttggggcgtgaattagcatgtgaagttttcaagttctgtgtg ggccgcatgccactgagtttcagtttccatatctgtacaatgggatgact gttgctctgctcacttaacatggagtaatttcccacatatcatcgttaga tgtggggctgtggtatctgggccttgttccggtttgctagcttggtgact tggggaaagctgttcagcctctgtaacttggcattctcatctataacact tctttaaaggaattcttcttgtagactc	gaattccttgctcagatccaaagccctttttaaaaaaaaataagccatta attcttgacttgttttgagtttgttaatattctggatattaatactatag cagatgcatagccaatattatctccaactgtggggagctcaatgcttcca tcactctccaggcccttctcagttttacgaggtcccatttgtcagcattg gccttaattcctggccaaatggatttttatttggtaggtgcttttatacc cctatgccctgcagggtgatacttaagttttttttttctagcaattctgg aatttctgttttgacaatgagattgttgatccatttggagagtatttctg tgcagaatgaaaatatgtctcatttaattctgctacatgtggacatctat tttttttccagcaccatttgttaaagaggcggtactttctctagtgtata tctctattttggcatctttgtcaaatctcagatggctgtagttacatgta ttcatgttttgttccactgatctacatgtctgttttagcaccatgctgtc tttgttactatgtatatgtaataaacaggaaattctggccatccctccaa cattgttctttttattcaatattgctttggctctctgacatcttttatga ttccatataaattttaggatttttttttctatttctataaaaaataaaaa cactgtgagaattttgattgggatttcatgaaatctacaggttggttttg ccagaattgttatttttaaaatattaattctaccaatctatgagcatggg aggtcttctagtgtctataccatatctttgcttagatatttgaagtttct attgttgaggtcttctgtctcctcagtcaggtttatgttcagatatatat attttttaagctatgggaatgggactgttttcattactcctttctcagag tatctgtcatttgcttatggaacggctactgatctcataagtcattatta ttctgccacgttgctgaaattttgttcattctccaagtttctggaggaat ttgggtttcatgttaacgaaaaatcatctacatattggaaaaattatact ttctcttcataccctaatttcctagcccttatgctcaggtagcgttgaga ccaattgtaaacgtggatggatttaagagatgtgtacagtgactctccct aaagtgctggtgcatagaagctgttat
quality values	Open. Hide. 61 41 31 38 61 61 38 19 61 61 55 47 61 61 61 47 61 61 61 49 55 61 61 49 49 43 13 32 22 27 15 13 14 12 26 13 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 44 59 59 61 59 61 61 61 61 61 59 61 59 43 36 44 37 43 52 61 61 61 61 61 61 61 59 61 61 61 59 44 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 55 59 59 61 55 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 55 61 61 55 55 61 61 55 61 61 61 61 55 61 55 55 61 61 55 61 61 61 55 61 61 61 61 55 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 55 55 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 61 61 61 61 61 53 61 61 61 61 61 53 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 53 53 52 53 53 53 61 61 61 61 61 61 61 61 61 61 61 47 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 52 61 61 53 61 53 61 53 61 53 52 53 53 61 52 61 61 61 57 57 57 53 52 43 47 32 53 57 57 43 39 47 53 57 57 34 53 47 24 47 47 52 57 57 47 34 47 40 52 47 53 53 47 50 27 57 50 57 45 53 45 57 53 30 53 23 47 57 30 53 53 42 43 52 52 40 37 53 53 53 53 57 53 50 57 57 53 45 53 40 53 38 47 47 39 15 39 47 53 42 53 42 39 53 57 53 45 47 30 24 47 45 57 36 13 40 33 53 52 47 25 43 30 53 53 32 41 43 57 36 30 52 27 53 53 46 43 29 23 45 53 47 30 42 20 57 21 53 30 40 39 52 42 33 40 50 38 39 20 34 24 53 52 40 50 50 33 50 26 57 38 31 53 50 43 50 34 21 44 38 33 45 37 33 37 29 32 35 31 30 29 48 31 37 48 28 52 28 48 35 30 40 38 24 32 24 38 35 28 25 10 17 44 41 40 29 30 39 33 29 35 29 40 36 33 39 23 37 33 57 57 44 43 51 51 30 29 30 30 31 36 30 30 36 35 20 30 24 32 38 25 29 29 48 29 29 46 46 24 29 29 29 31 21 38 29 28 31 37 29 28 38 44 30 20 39 24 29 24 25 31 23 27 16 29 29 29 43 25 35 51 29 25 32 23 29 51 29 28 30 17 30 25 28 33 28 29 20 24 29 26 14 22 29 51 26 27 13 22 28 27 19 39 16 23 29 19 24 29 25 31 28 28 29 23 27 25 32 27 26 27 20 21 20 28 36 20 51 19 21 18 51 25 21 51 23 8 13 17 21 28 28 28 33 31 35 18 23 19 33 19 28 8 23 11 17 44 51 38 23 20 6 9 8 30 17 22 26 19 14 26 38 25 15 22 18 19 25 21 6 11 8 10 22 16 31 16 27 22 22 23 19 23 23 18 16 21 14 7 19 23 19 22 15 35 29 15 7 42 30 13 25 7 9 14 13 31 19 19 34 7 13 10 10 12 14 31 17 22 15 13 13 21 20 18 33 33 9 4 13 11 20 10 12 10 12 8 16 4 4 6 10 8 12 8 33 29 8 12 7 9 19 9 31 7 5 3 4 6 9 14 14 14 5 6 6 11 6 5 4	Open. Hide. 61 61 36 47 61 16 13 11 10 17 12 22 7 6 20 28 31 43 59 37 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 52 49 43 37 59 52 59 59 61 61 61 61 61 61 61 61 59 59 59 44 44 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 50 61 61 55 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 55 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 39 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 53 61 47 53 61 61 61 61 61 61 61 61 61 61 40 61 61 61 61 61 61 61 61 61 53 61 61 61 61 57 57 53 53 53 47 53 50 57 52 53 53 53 53 53 57 57 57 53 47 53 53 53 57 45 53 53 53 42 47 57 57 53 53 53 53 53 57 52 57 53 53 57 57 57 57 50 53 57 57 53 53 53 57 53 57 57 53 47 40 32 46 47 37 42 52 30 21 16 50 53 50 37 47 53 45 53 47 46 57 57 57 52 42 41 57 50 47 47 42 53 50 57 57 42 57 57 47 41 47 46 57 53 45 50 53 47 41 36 43 53 53 52 57 57 37 45 50 38 50 30 53 47 46 23 52 43 52 57 57 38 41 57 57 34 50 33 52 41 21 57 57 57 57 57 57 57 33 39 30 36 31 57 50 36 37 37 34 20 57 57 57 57 44 38 29 57 57 52 40 37 28 52 37 53 40 52 40 27 53 20 25 57 57 41 24 36 33 38 57 57 35 38 15 57 44 37 34 37 37 37 57 33 40 42 37 37 40 31 31 46 30 30 42 37 29 57 57 14 24 19 53 30 28 53 32 35 41 40 22 40 36 40 57 57 57 34 36 57 57 48 40 34 37 14 9 45 29 30 33 37 33 24 16 15 30 29 32 28 32 34 29 40 19 29 23 29 28 46 30 44 14 48 20 30 16 32 44 27 30 24 32 48 26 29 33 33 29 28 24 30 20 29 29 25 39 25 46 29 33 31 18 25 29 13 36 15 33 28 46 31 18 29 48 23 15 46 19 29 28 35 23 17 30 15 32 25 36 28 30 28 34 29 35 29 23 29 23 28 18 24 29 32 29 30 33 30 31 14 27 12 15 46 27 9 7 7 7 6 30 16 18 29 18 25 28 14 20 29 35 28 29 41 51 51 51 32 21 28 28 31 29 26 19 26 51 29 26 33 27 43 51 13 25 19 25 29 20 51 30 9 27 14 29 26 17 25 25 25 22 28 51 29 30 26 21 12 6 26 5 9 17 28 31 21 28 16 17 21 12 51 5 13 23 28 24 16 15 20 20 21 27 26 29 28 27 34 19 19 15 18 5 9 10 6 5 10 18 38 10 13 9 5 8 4 5 6 4 5 6 13 14 30 15 27 20 29 12 21 21 26 25 10 13 17 8 26 35 23 6 5 3 6 7 9 6 4 7 7 14 14 26 7 4 6 11 3 4 4 15 5 3 3 5 9 12 11 20 14 4 24 8 7 7 4 1 6 5 5 5 4 6 6 6 10 6 5 4 8 29 31 42 3 3 5 6 8 25 13 10 19 24 13 9 5 6 16 14 5 11 27 26 20 11 4 7 7 7 10 16 22 8 14 8 4 2 3 9 5 4 23 6 14 5 3 3 7 4 9 16 6 9 4 6 9 11 15 18 9 7 10 10 16 10 8 10 10 4 5 5 3 3 3 8 7 17 5 7 9 9 6 4 4 8 5 10 7 2 13 4 1 1 3 6 10 5 3 1 4 7 4 4 2 5 9 4 12 9 5 7 3 4 10 4 17 3 4 8 19 11 5 6 17 3 14 3 7 23 5 2 3 1 4 7 3 3 1 3 14 16 4 4 6 7 3 7 16 5 4 3 8 9 3 1 2 2 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_35902349_35903430
seq2: B6Ng01-136M13.b_48_1125 (reverse)

seq1  GAGTCTACAAG-AGGATTCCTCTAAAGGAAGTGTTATAGATGAGAAATGC  49
      ||||||||||| || |||||| |||| ||||||||||||||||| |||||
seq2  GAGTCTACAAGAAGAATTCCTTTAAA-GAAGTGTTATAGATGAG-AATGC  48

seq1  CAAGTTTACAGAGGCTGAACAGCTTTCCCCAAGTCACCAAGCTAGCAAAC  99
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAG-TTACAGAGGCTGAACAGCTTTCCCCAAGTCACCAAGCTAGCAAAC  97

seq1  CGGGACAAGGCCCAGATACCACAAGCCCCACATCTAACGATGATATGTGG  149
      ||| |||||||||||||||||| |||||||||||||||||||||||||||
seq2  CGGAACAAGGCCCAGATACCAC-AGCCCCACATCTAACGATGATATGTGG  146

seq1  GAAATTAACTCCATGTTAAGTGAGCAGAGCAACAGTCATCCCATTGTACA  199
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATT-ACTCCATGTTAAGTGAGCAGAGCAACAGTCATCCCATTGTACA  195

seq1  GATATGGAAACTGAAACTCAGTGGCATGCGGCCCACACAGAACTTGAAAA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATGGAAACTGAAACTCAGTGGCATGCGGCCCACACAGAACTTGAAAA  245

seq1  CTTCACATGCTAATTCACGCCCCAAAACTGGACATAATAATAATGTCTGC  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCACATGCTAATTCACGCCCCAAAACTGGACATAATAATAATGTCTGC  295

seq1  TTGGTAACTCTCCTACTGAGAAGGGAGGCAGAGACAAGTGGATTCTTGGA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTAACTCTCCTACTGAGAAGGGAGGCAGAGACAAGTGGATTCTTGGA  345

seq1  GCTCACTGGCCTGCCAGTCCAGCTTAAATAAATGCCAAGCCTCAGGTCCT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCACTGGCCTGCCAGTCCAGCTTAAATAAATGCCAAGCCTCAGGTCCT  395

seq1  CATGAGAGGGCCAGTCTCAAAGACCAAGGTGCATAACTCCTACAGAACAC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAGAGGGCCAGTCTCAAAGACCAAGGTGCATAACTCCTACAGAACAC  445

seq1  CTGAGGTTGGCCATTGGTCCTCACATACATGGAACACACATGTGTACCTG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGGTTGGCCATTGGTCCTCACATACATGGAACACACATGTGTACCTG  495

seq1  CATATACATGAACATATACACATGCTTGCATGTAAATCAATACTAGAGTG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATACATGAACATATACACATGCTTGCATGTAAATCAATACTAGAGTG  545

seq1  TTGCTCATGTGTGGTACATTATCTGTGTTCTTGCCCTAGGCCACCAAATT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTCATGTGTGGTACATTATCTGTGTTCTTGCCCTAGGCCACCAAATT  595

seq1  TTAAGAGTAGGAGGTAGGAGACCCATTCAGCACAGCTGCTCTGTCAGGAG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGAGTAGGAGGTAGGAGACCCATTCAGCACAGCTGCTCTGTCAGGAG  645

seq1  CCAGGGAGATCGGTCCCCTCAGCCTCCCTGTCTTCTAGTAACAGAGTATT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGGAGATCGGTCCCCTCAGCCTCCCTGTCTTCTAGTAACAGAGTATT  695

seq1  CGCTGCAGCTGGGTTCGCCCACAGCTCTTGCTACTAAGTATTATTTCCAA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTGCAGCTGGGTTCGCCCACAGCTCTTGCTACTAAGTATTATTTCCAA  745

seq1  CGAAACCCTTGTAAATTGATTTGTAGGAGAGGGGGTGATGGAGAACAACG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAAACCCTTGTAAATTGATTTGTAGGAGAGGGGGTGATGGAGAACAACG  795

seq1  GGAGGCTGCAAACATTGAATTAACGCCAAAATAATCTAATATGTCCAATT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGCTGCAAACATTGAATTAACGCCAAAATAATCTAATATGTCCAATT  845

seq1  TTGTATTCCTTCCCTACAGTTAATGTGTGCAAGCAAGTCATCGGCGCTTC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATTCCTTCCCTACAGTTAATGTGTGCAAGCAAGTCATCGGCGCTTC  895

seq1  GGTTTTTGCACATCTATCTCAACAGGAAACAGTGGAACTGTGATAATAAA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTTTGCACATCTATCTCAACAGGAAACAGTGGAACTGTGATAATAAA  945

seq1  TGCATTATCTAGATAAATGGTTGCCCGTCAGAGTGAACTGAGAGGAATAG  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATTATCTAGATAAATGGTTGCCCGTCAGAGTGAACTGAGAGGAATAG  995

seq1  GTTGTGTGCCACTGTTGATCTGCAAACAGAACAGGAAATTCACTTTTCTC  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTGTGCCACTGTTGATCTGCAAACAGAACAGGAAATTCACTTTTCTC  1045

seq1  TTGATCCCTGGTTGTTGCAAGCTTTTGGAATTC  1082
      |||||||||||||||||||||||||||||||||
seq2  TTGATCCCTGGTTGTTGCAAGCTTTTGGAATTC  1078

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information