MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-146P04
Chromosome	1 (Build37)
Map Location	158,813,764 - 158,935,127
singlet/doublet	doublet
Overlap gene	Ralgps2, 4930439D14Rik
Upstream gene	Cep350, LOC676894, Tor1aip1, Ifrg15, Tor1aip2, A230106N23Rik, Tdrd5, Nphs2, 9430070O13Rik, LOC100038991, Soat1, LOC100039026, Abl2, Tor3a, C530043G21Rik, LOC433368, Angptl1
Downstream gene	1700057K13Rik, Rasal2, Gabarapl2-ps1_1522.1, 2810025M15Rik, BC026585, Lztr2, LOC664935, LOC100039217
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cep350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74081 MGI:1921331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 127 ESTs, 1 Protein

name	LOC676894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tor1aip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208263 MGI:3582693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifrg15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64164 MGI:1929890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor1aip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240832 MGI:3582695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230106N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329274 MGI:3618859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdrd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214575 MGI:2684949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 2 Proteins

name	Nphs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170484 MGI:2157018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430070O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77352 MGI:1924602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 887 ESTs, 5 Proteins

name	Soat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20652 MGI:104665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039026 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 139 ESTs, 13 Proteins

name	Abl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11352 MGI:87860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30935 MGI:1353652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530043G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215015 MGI:2443990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433368 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433368
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs

name	Ralgps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78255 MGI:1925505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72713 MGI:1919963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930439D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78167 MGI:1925417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1700057K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73435 MGI:1920685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226525 MGI:2443881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabarapl2-ps1_1522.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606525
definition	note : GABA(A) receptor-associated protein-like 2 pseudogene 1_1522.1 pseudo : _no_value

name	2810025M15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69953 MGI:1917203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 54 ESTs, 1 Protein

name	BC026585 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226527 MGI:2448516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lztr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:89867 MGI:2148802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664935 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100039217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cep350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234348 GeneID:74081 MGI:1921331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 127 ESTs, 1 Protein product : centrosomal protein 350, transcript variant 1 transcript_id : XM_129509.9

name	LOC676894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234314 GeneID:676894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to Col5a2 protein transcript_id : XM_001479176.1

name	Tor1aip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450140 GeneID:208263 MGI:3582693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin A interacting protein 1 transcript_id : NM_144791.1

name	Ifrg15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803172 GeneID:64164 MGI:1929890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha responsive gene transcript_id : NM_022329.3

name	Tor1aip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048323 GeneID:240832 MGI:3582695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin A interacting protein 2 transcript_id : NM_172843.2

name	A230106N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342884 GeneID:329274 MGI:3618859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230106N23 gene transcript_id : NM_177838.2

name	Tdrd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364454 GeneID:214575 MGI:2684949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 2 Proteins product : tudor domain containing 5 transcript_id : XM_129603.6

name	Nphs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131068 GeneID:170484 MGI:2157018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nephrosis 2 homolog, podocin (human) transcript_id : NM_130456.3

name	9430070O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353474 GeneID:77352 MGI:1924602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430070O13 gene transcript_id : NM_001033180.2

name	LOC100038991 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245215 GeneID:100038991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 887 ESTs, 5 Proteins product : similar to ribosomal protein L35 transcript_id : XM_001471982.1

name	Soat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363102 GeneID:20652 MGI:104665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterol O-acyltransferase 1 transcript_id : NM_009230.3

name	LOC100039026 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245219 GeneID:100039026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 139 ESTs, 13 Proteins product : similar to Casein kinase 2, alpha 1 polypeptide transcript_id : XM_001472047.1

name	Abl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116875855 GeneID:11352 MGI:87860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) transcript_id : NM_009595.2

name	Tor3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963524 GeneID:30935 MGI:1353652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 3, member A transcript_id : NM_023141.1

name	C530043G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802861 GeneID:215015 MGI:2443990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530043G21 gene transcript_id : NM_145413.4

name	LOC433368 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245223 GeneID:433368
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs product : hypothetical LOC433368 transcript_id : XM_001472239.1

name	Ralgps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359081 GeneID:78255 MGI:1925505
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ral GEF with PH domain and SH3 binding motif 2 transcript_id : NM_023884.3

name	Angptl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792795 GeneID:72713 MGI:1919963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 1 transcript_id : NM_028333.2

name	4930439D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245225 GeneID:78167 MGI:1925417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4930439D14 gene transcript_id : XM_001472276.1

name	1700057K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803467 GeneID:73435 MGI:1920685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700057K13 gene transcript_id : NM_028540.2

name	Rasal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686098 GeneID:226525 MGI:2443881
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS protein activator like 2 transcript_id : NM_177644.4

name	BC026585 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701627 GeneID:226527 MGI:2448516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC026585 transcript_id : NM_001033284.1

name	Lztr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254125 GeneID:89867 MGI:2148802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper transcription regulator 2 transcript_id : NM_033354.2

name	LOC676894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234315 GeneID:676894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479226.1

name	Tor1aip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450141 CCDS:CCDS15387.1 GeneID:208263 MGI:3582693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005521 - lamin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : lamina-associated polypeptide 1B protein_id : NP_659040.1

name	Ifrg15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612513 CCDS:CCDS15388.1 GeneID:64164 MGI:1929890
definition	codon_start : 1 note : interferon alpha responsive protein (15 kDa); interferon alpha responsive gene, 15 kDa product : interferon alpha responsive protein_id : NP_071724.1

name	Tor1aip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048324 CCDS:CCDS15389.1 GeneID:240832 MGI:3582695
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : lumenal domain like LAP1 product : torsin A interacting protein 2 protein_id : NP_766431.2

name	A230106N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244410 CCDS:CCDS15390.1 GeneID:329274 MGI:3618859
definition	codon_start : 1 product : RIKEN cDNA A230106N23 protein_id : NP_808506.1

name	Tdrd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364455 GeneID:214575 MGI:2684949
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to Tudor domain-containing protein 5 protein_id : XP_129603.6 transl_except : (pos:complement(158232535..158232537),aa:OTHER) transl_except : (pos:complement(158231973..158231975),aa:OTHER) transl_except : (pos:complement(158231871..158231873),aa:OTHER) transl_except : (pos:complement(158231829..158231831),aa:OTHER) transl_except : (pos:complement(158231823..158231825),aa:OTHER) transl_except : (pos:complement(158231754..158231756),aa:OTHER) transl_except : (pos:complement(158230917..158230919),aa:OTHER) transl_except : (pos:complement(158230896..158230898),aa:OTHER) transl_except : (pos:complement(158230773..158230775),aa:OTHER) transl_except : (pos:complement(158230740..158230742),aa:OTHER) transl_except : (pos:complement(158224593..158224595),aa:OTHER) transl_except : (pos:complement(158224587..158224589),aa:OTHER) transl_except : (pos:complement(158223503..158223505),aa:OTHER) transl_except : (pos:complement(158223476..158223478),aa:OTHER) transl_except : (pos:complement(158223458..158223460),aa:OTHER) transl_except : (pos:complement(158218501..158218503),aa:OTHER) transl_except : (pos:complement(158218438..158218440),aa:OTHER) transl_except : (pos:complement(158218435..158218437),aa:OTHER) transl_except : (pos:complement(158218420..158218422),aa:OTHER) transl_except : (pos:complement(158218411..158218413),aa:OTHER) transl_except : (pos:complement(158218384..158218386),aa:OTHER) transl_except : (pos:complement(158218378..158218380),aa:OTHER) transl_except : (pos:complement(158215661..158215663),aa:OTHER) transl_except : (pos:complement(158215610..158215612),aa:OTHER) transl_except : (pos:complement(158215541..158215543),aa:OTHER) transl_except : (pos:complement(158214464..158214466),aa:OTHER) transl_except : (pos:complement(158214416..158214418),aa:OTHER) transl_except : (pos:complement(158214401..158214403),aa:OTHER) transl_except : (pos:complement(158207611..158207613),aa:OTHER) transl_except : (pos:complement(158207548..158207550),aa:OTHER) transl_except : (pos:complement(158201453..158201455),aa:OTHER) transl_except : (pos:complement(158201432..158201434),aa:OTHER) transl_except : (pos:complement(158201417..158201419),aa:OTHER) transl_except : (pos:complement(158201402..158201404),aa:OTHER) transl_except : (pos:complement(158200793..158200795),aa:OTHER) transl_except : (pos:complement(158200724..158200726),aa:OTHER) transl_except : (pos:complement(158197491..158197493),aa:OTHER) transl_except : (pos:complement(158197488..158197490),aa:OTHER) transl_except : (pos:complement(158197464..158197466),aa:OTHER) transl_except : (pos:complement(158197431..158197433),aa:OTHER) transl_except : (pos:complement(158197407..158197409),aa:OTHER) transl_except : (pos:complement(158197398..158197400),aa:OTHER) transl_except : (pos:complement(158197344..158197346),aa:OTHER) transl_except : (pos:complement(158193714..158193716),aa:OTHER) transl_except : (pos:complement(158193669..158193671),aa:OTHER) transl_except : (pos:complement(158193654..158193656),aa:OTHER) transl_except : (pos:complement(158193080..158193082),aa:OTHER) transl_except : (pos:complement(158193065..158193067),aa:OTHER) transl_except : (pos:complement(158193035..158193037),aa:OTHER) transl_except : (pos:complement(158189959..158189961),aa:OTHER) transl_except : (pos:complement(158189887..158189889),aa:OTHER) transl_except : (pos:complement(158185933..158185935),aa:OTHER) transl_except : (pos:complement(158185930..158185932),aa:OTHER) transl_except : (pos:complement(158185921..158185923),aa:OTHER) transl_except : (pos:complement(158185729..158185731),aa:OTHER)

name	Nphs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485514 CCDS:CCDS15391.1 GeneID:170484 MGI:2157018
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : nephrosis 2 homolog, podocin protein_id : NP_569723.1

name	9430070O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701604 CCDS:CCDS15392.1 GeneID:77352 MGI:1924602
definition	codon_start : 1 product : hypothetical protein LOC77352 protein_id : NP_001028352.1

name	LOC100038991 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245216 GeneID:100038991
definition	codon_start : 1 product : similar to ribosomal protein L35 protein_id : XP_001472032.1

name	Soat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84619697 GeneID:20652 MGI:104665
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004772 - sterol O-acyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IDA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : adrenocortical lipid depletion product : sterol O-acyltransferase 1 protein_id : NP_033256.2

name	LOC100039026 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245220 GeneID:100039026
definition	codon_start : 1 product : similar to Casein kinase 2, alpha 1 polypeptide protein_id : XP_001472097.1

name	Abl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116875856 CCDS:CCDS15393.1 GeneID:11352 MGI:87860
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence TAS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0007015 - actin filament organization [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : v-abl Abelson murine leukemia viral oncogene 2 protein_id : NP_033725.2

name	Tor3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963525 CCDS:CCDS15394.1 GeneID:30935 MGI:1353652
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : ATP-dependent interferon response protein note : ATP-dependant interferon responsive product : torsin family 3, member A protein_id : NP_075630.1

name	C530043G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703824 CCDS:CCDS15395.1 GeneID:215015 MGI:2443990
definition	codon_start : 1 product : hypothetical protein LOC215015 protein_id : NP_663388.1

name	LOC433368 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245224 GeneID:433368
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472289.1

name	Ralgps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560036 CCDS:CCDS15396.1 GeneID:78255 MGI:1925505
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Ral-A exchange factor RalGPS2 protein_id : NP_076373.2

name	Angptl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792796 CCDS:CCDS15397.1 GeneID:72713 MGI:1919963
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005102 - receptor binding [Evidence IPI] GO_process : GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IPI] codon_start : 1 product : angiopoietin-like 1 protein_id : NP_082609.2

name	4930439D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245226 GeneID:78167 MGI:1925417
definition	codon_start : 1 product : hypothetical protein LOC78167 protein_id : XP_001472326.1

name	1700057K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249220 GeneID:73435 MGI:1920685
definition	codon_start : 1 product : hypothetical protein LOC73435 protein_id : NP_082816.1

name	Rasal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199763 GeneID:226525 MGI:2443881
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAS protein activator like 2 protein_id : NP_808312.2

name	BC026585 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701628 CCDS:CCDS15399.1 GeneID:226527 MGI:2448516
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC226527 protein_id : NP_001028456.1

name	Lztr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254126 CCDS:CCDS15400.1 GeneID:89867 MGI:2148802
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : regucalcin gene promotor region related protein product : leucine zipper transcription regulator 2 protein_id : NP_203505.2

name	LOC664935 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664935
definition	number : 1 pseudo : _no_value

name	LOC100039217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039217
definition	number : 1 pseudo : _no_value

name	LOC100039217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039217
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:178481
definition	standard_name : AW060462

name	(CDS detail)
type	STS
link
xref	UniSTS:234244
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234243
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162940
definition	standard_name : RH126232

name	(CDS detail)
type	STS
link
xref	UniSTS:234245
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207236
definition	standard_name : AW742543

name	(CDS detail)
type	STS
link
xref	UniSTS:128616
definition	standard_name : D1Mit267

name	(CDS detail)
type	STS
link
xref	UniSTS:466073
definition	standard_name : Tdrd5

name	(CDS detail)
type	STS
link
xref	UniSTS:207238
definition	standard_name : BB203080

name	(CDS detail)
type	STS
link
xref	UniSTS:165111
definition	standard_name : AV209277

name	(CDS detail)
type	STS
link
xref	UniSTS:273192
definition	standard_name : PMC343810P1

name	(CDS detail)
type	STS
link
xref	UniSTS:165112
definition	standard_name : AI790225

name	(CDS detail)
type	STS
link
xref	UniSTS:128672
definition	standard_name : D1Mit313

name	(CDS detail)
type	STS
link
xref	UniSTS:178480
definition	standard_name : AW550831

name	(CDS detail)
type	STS
link
xref	UniSTS:125766
definition	standard_name : U51866

name	(CDS detail)
type	STS
link
xref	UniSTS:207235
definition	standard_name : BB283609

name	(CDS detail)
type	STS
link
xref	UniSTS:128791
definition	standard_name : D1Mit425

name	(CDS detail)
type	STS
link
xref	UniSTS:234240
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161321
definition	standard_name : RH124499

name	(CDS detail)
type	STS
link
xref	UniSTS:248586
definition	standard_name : AA925877

name	(CDS detail)
type	STS
link
xref	UniSTS:123624
definition	standard_name : 24.MHAa58b12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128476
definition	standard_name : D1Mit14

name	(CDS detail)
type	STS
link
xref	UniSTS:158869
definition	standard_name : AU043409

name	(CDS detail)
type	STS
link
xref	UniSTS:164134
definition	standard_name : AW046161

name	(CDS detail)
type	STS
link
xref	UniSTS:128543
definition	standard_name : D1Mit202

name	(CDS detail)
type	STS
link
xref	UniSTS:128617
definition	standard_name : D1Mit268

name	(CDS detail)
type	STS
link
xref	UniSTS:207239
definition	standard_name : AW742196

name	(CDS detail)
type	STS
link
xref	UniSTS:128644
definition	standard_name : D1Mit290

name	2810025M15Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149245229 GeneID:69953 MGI:1917203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 54 ESTs, 1 Protein product : RIKEN cDNA 2810025M15 gene transcript_id : XR_035184.1

clone name	MSMg01-406P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188D17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-135F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204H08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-534F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-146P04.b	B6Ng01-146P04.g
ACC	DH943959	DH943960
length	837	1,199
definition	DH943959\|Mus musculus domesticus DNA, BAC clone: B6Ng01-146P04, 5' end.	DH943960\|Mus musculus domesticus DNA, BAC clone: B6Ng01-146P04, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(158,934,295 - 158,935,127)	(158,813,764 - 158,814,992)
sequence	gaattcatctcttttaaactttttcgcttatagcctctgggaggagcttt ggatgaaacgcttgcttggtgagtaagagtcattgttgctaacagttgac attggtgaagtaacagctgtgtgttccagggtaacttactgcttcccata gcctaaaccgagccctgggaagtaggactgatttcgactgaacagctgag aaaactgaaatacaagaaattgacaagaacacggcagtaccgccaaatct gctgatctcatccacggatcatgatgtccaaggttatccattaagttctg ctcgggtacactcaaagctttatttccactcaaaataacctctcccttct cggaattttcctggttcttcaactgcctctgagcctcccacgtgaacccc attagaagccccccgtagaggcccaatgatcattttcgatttggaggccc acatagtctgtcacaacctctcagctctgctgcccactgtagcataagac tggccatcaacaataaacaaattaatgagcatggctgcatttcagttaaa ttgtacttaggcgtgttgagattttatgggggtgggggtctggggagata gcttagttagtaaagtgcttcccttgcaagcaagaggacctgcgtttggt ccccagaataaaactggatgtgatagcgcctgtttgtagtcccagcaatt ggaaaggtggacacagggtggatcccaggggctcagtggttgacctgata aggtcaagggcagcaagacagcttatctcaaaaaccaatctggggatctc tgactcagtgggttaagagcactgaattgctcttcca	gaattccagaaaatccagggctacacagagaaaccctgtcttgaaaaaca aaaagacattaatcttttaaaaaatatatagtaatattttcagcacggta tatggtccacctgtaatcctagtacttgtgaggctgaggcagaaccatga ctttaaagctagcttgggctataaaaaaagactgtgtgtgtgtgtacgcg cacacaccccttcatagaggctagtatatcaggcttataactccagctac ttgactggccaagaaaggaagtccccaacttgaaagcaactttgggtgac ttagcaagataccttaaacgaggccgtagtttcaaaataagaaataaaag aaagaaaaggggaagagataacctagaaagattgagtatggtatcattct actcagagatacaaatactgatcatgccaaaaatcatactttgcttttgt caaagtaacagaacctaatatggtggctgttgtaacagaaagtagcatgt ttatcatgagatttttctatactcaagatttatggctaaaaaataatgga gtcaaaattaataaaagaactttaaaggtcatgatttagattttcagatt tacaagaagtataatctgtacacaattaaattctaattatcaggtaagta ttacatgtgatattatcaacaaggtatgaaaatgattctctgaagagcaa aataagcactgccctcaacattccctcaaaagctcagtgcaatgttttaa aagtcttaaatgttggtttcaaagaacaaagtgcaagacaatttaagaat tcttatctattatatttgtctaagacttacaaaagaaacaaataatattt ctacttcgcacaaaagtctatgcttcattaaactaggcagagttactcac cgcccacgtcttagtcaaccggaaaatcggcgcactctgtaagccagaaa cacagccataagtgcgtgaaggttgttaagttcatatagttctgaagatt taagaaaaagggggaggaggatgtttttttaagaaatgactgcaggaaat aagatagcacatttaggcagtggaagaataactatttatattgtactgtc actttgggaaactgtcttctaggatccagtattatttttgggctaaatta gtcagtttcactggcacttcccagcgtgggaataaccacctctaaatgg
quality values	Open. Hide. 61 41 28 32 61 38 31 47 61 61 61 61 61 61 47 55 55 61 61 61 61 61 61 61 61 37 37 55 31 49 52 40 22 43 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 55 44 55 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 55 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 59 59 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 44 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 53 61 61 61 61 61 50 61 61 61 61 61 42 53 61 61 61 61 61 61 39 61 31 53 39 50 61 50 27 14 11 10 9 8 15 25 46 47 36 35 45 38 47 39 27 23 21 25 31 34 40 36 17 11 24 37 47 45 53 45 47 24 12 53 30 38 19 20 20 45 40 36 36 38 32 45 42 26 36 18 38 28 21 14 30 46 53 47 53 41 17 30 28 27 22 30 38 32 35 23 39 33 33 35 24 37 34 36 24 28 27 28 24 28 24 16 17 20 14 31 30 30 25 29 28 17 9 23 17 8 15 8 6 8 16 24 24 22 12 8 19 25 27 41 36 45 24 28 37 26 20 30 38 46 52 39 42 42 29 17 8 30 17 12 21 23 18 11 25 38 53 32 29 37 15 9 32 10 36 23 18 14 18 15 5 13 10 16 12 15 8 15 20 32 14 23 25 31 33 32 12 33 19 10 32 37 23 30 17 23 16 20 31 29 29 37 36 15 17 24 8 10 12 11 10 9 15 10 24 20 17 10 10 8 20 23 30 29 31 23 18 13 10 14 22 14 12 12 10 9 8 8 21 27 15 15 9 12 26 32 13	Open. Hide. 55 61 59 59 61 59 59 29 36 55 43 43 30 59 52 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 42 43 61 61 61 61 61 61 61 61 53 57 57 53 45 57 53 57 53 57 57 57 53 57 57 53 53 45 57 47 47 47 57 53 53 53 57 57 57 57 57 57 57 53 57 57 53 47 57 53 57 53 57 57 57 57 57 57 53 53 57 57 47 53 57 47 57 46 28 57 52 57 57 53 52 57 52 57 45 52 47 57 57 53 53 52 42 57 45 57 53 52 53 38 57 53 57 57 53 53 53 53 57 53 53 57 57 52 53 53 53 50 52 31 57 53 52 50 57 41 38 57 53 50 57 53 52 52 52 52 57 50 37 46 42 53 57 52 53 42 41 52 53 57 44 57 57 50 53 52 42 42 37 39 53 50 52 50 57 52 38 46 38 57 19 24 34 57 52 57 57 50 34 50 38 24 57 52 53 42 53 39 53 48 37 53 29 37 22 57 57 39 37 32 53 40 53 36 39 53 53 37 41 38 44 33 30 37 37 23 37 53 29 53 44 44 40 30 57 57 48 40 40 47 34 34 37 37 53 34 29 33 37 48 14 57 57 32 48 57 57 47 38 36 40 33 29 34 47 44 30 48 35 29 30 30 20 51 33 30 28 51 45 29 47 30 38 28 51 32 30 34 38 27 31 30 30 38 26 23 26 27 46 30 28 48 25 47 30 23 26 35 30 31 29 29 29 33 29 29 29 27 30 32 35 46 45 31 33 33 29 18 46 29 43 24 20 21 24 32 23 51 43 43 30 40 51 29 32 22 39 25 21 8 43 29 26 28 51 39 34 28 21 28 14 20 28 20 28 17 20 14 39 39 39 28 29 29 29 27 29 35 31 21 19 24 20 25 25 31 51 26 28 29 23 30 21 22 28 23 43 17 25 19 15 35 36 34 22 20 29 21 25 36 21 18 24 16 35 27 15 33 28 17 28 38 30 22 24 26 26 26 36 51 51 20 26 33 25 23 24 16 26 20 27 26 29 28 32 19 18 19 18 17 14 19 19 35 38 14 20 9 14 10 27 25 18 19 33 9 23 17 16 32 31 23 28 32 19 13 12 8 16 14 25 8 20 17 28 24 18 14 28 25 26 19 12 8 7 6 9 19 22 26 19 5 6 25 14 28 20 17 29 17 29 37 30 42 12 24 37 42 36 16 20 5 6 17 11 15 29 14 8 9 36 36 42 42 34 16 3 4 4 6 42 23 11 26 22 24 19 23 23 8 12 4 4 16 4 4 5 4 6 3 4 4 8 22 5 5 10 6 26 11 6 13 20 15 12 25 5 10 5 3 1 3 5 20 3 7 20 24 17 19 16 28 17 11 18 12 17 8 7 15 9 20 6 18 9 7 4 7 16 30 12 7 16 7 13 22 10 14 5 5 3 4 4 18 10 7 15 11 8 6 1 4 6 4 6 4 4 3 3 5 10 30 25 24 14 7 14 8 17 3 4 5 18 3 2 4 3 3 7 9 7 3 11 6 5 9 17 3 11 6 2 4 4 12 4 4 3 13 4 6 9 7 12 15 27 13 6 3 1 6 6 17 4 4 4 4 4 7 8 17 7 3 1 6 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_158934295_158935127
seq2: B6Ng01-146P04.b_43_879 (reverse)

seq1  TGGAAGAGC-AGTCAGTGCTCTTAA-CCACTGAGTCAGAGATCCCCAGAT  48
      ||||||||| | ||||||||||||| ||||||||||||||||||||||||
seq2  TGGAAGAGCAATTCAGTGCTCTTAACCCACTGAGTCAGAGATCCCCAGAT  50

seq1  TGGTTTTTGAGATAAGCTGTCTTGCTGCCCTGGACCTTATCAGGTCAACC  98
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TGGTTTTTGAGATAAGCTGTCTTGCTGCCCTTGACCTTATCAGGTCAACC  100

seq1  ACTGAGCCCCTGGGATCCA-CCTGTGTCCACC-TTCCAATTGCTGGGACT  146
      ||||||||||||||||||| |||||||||||| |||||||||||||||||
seq2  ACTGAGCCCCTGGGATCCACCCTGTGTCCACCTTTCCAATTGCTGGGACT  150

seq1  ACAAACAGGCGCTATCACATCCAGTTTTATTCTGGGGACCAAACGCAGGT  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAGGCGCTATCACATCCAGTTTTATTCTGGGGACCAAACGCAGGT  200

seq1  CCTCTTGCTTGCAAGGGAAGCACTTTACTAACTAAGCTATCTCCCCAGAC  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTGCTTGCAAGGGAAGCACTTTACTAACTAAGCTATCTCCCCAGAC  250

seq1  CCCCACCCCCATAAAATCTCAACACGCCTAAGTACAATTTAACTGAAATG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACCCCCATAAAATCTCAACACGCCTAAGTACAATTTAACTGAAATG  300

seq1  CAGCCATGCTCATTAATTTGTTTATTGTTGATGGCCAGTCTTATGCTACA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCATGCTCATTAATTTGTTTATTGTTGATGGCCAGTCTTATGCTACA  350

seq1  GTGGGCAGCAGAGCTGAGAGGTTGTGACAGACTATGTGGGCCTCCAAATC  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGCAGCAGAGCTGAGAGGTTGTGACAGACTATGTGGGCCTCCAAATC  400

seq1  GAAAATGATCATTGGGCCTCTACGGGGGGCTTCTAATGGGGTTCACGTGG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATGATCATTGGGCCTCTACGGGGGGCTTCTAATGGGGTTCACGTGG  450

seq1  GAGGCTCAGAGGCAGTTGAAGAACCAGGAAAATTCCGAGAAGGGAGAGGT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCTCAGAGGCAGTTGAAGAACCAGGAAAATTCCGAGAAGGGAGAGGT  500

seq1  TATTTTGAGTGGAAATAAAGCTTTGAGTGTACCCGAGCAGAACTTAATGG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTGAGTGGAAATAAAGCTTTGAGTGTACCCGAGCAGAACTTAATGG  550

seq1  ATAACCTTGGACATCATGATCCGTGGATGAGATCAGCAGATTTGGCGGTA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACCTTGGACATCATGATCCGTGGATGAGATCAGCAGATTTGGCGGTA  600

seq1  CTGCCGTGTTCTTGTCAATTTCTTGTATTTCAGTTTTCTCAGCTGTTCAG  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCGTGTTCTTGTCAATTTCTTGTATTTCAGTTTTCTCAGCTGTTCAG  650

seq1  TCGAAATCAGTCCTACTTCCCAGGGCTCGGTTTAGGCTATGGGAAGCAGT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAAATCAGTCCTACTTCCCAGGGCTCGGTTTAGGCTATGGGAAGCAGT  700

seq1  AAGTTACCCTGGAACACACAGCTGTTACTTCACCAATGTCAACTGTTAGC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTACCCTGGAACACACAGCTGTTACTTCACCAATGTCAACTGTTAGC  750

seq1  AACAATGACTCTTACTCACCAAGCAAGCGTTTCATCCAAAGCTCCTCCCA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAATGACTCTTACTCACCAAGCAAGCGTTTCATCCAAAGCTCCTCCCA  800

seq1  GAGGCTATAAGCGAAAAAGTTTAAAAGAGATGAATTC  833
      |||||||||||||||||||||||||||||||||||||
seq2  GAGGCTATAAGCGAAAAAGTTTAAAAGAGATGAATTC  837

seq1: chr1_158813764_158814992
seq2: B6Ng01-146P04.g_69_1267

seq1  GAATTCCAGAAAATCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGAAAATCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAACA  50

seq1  AAAAGACATTAATCTTTTAAAAAATATATAGTAATATTTTCAGCACGGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGACATTAATCTTTTAAAAAATATATAGTAATATTTTCAGCACGGTA  100

seq1  TATGGTCCACCTGTAATCCTAGTACTTGTGAGGCTGAGGCAGAACCATGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGTCCACCTGTAATCCTAGTACTTGTGAGGCTGAGGCAGAACCATGA  150

seq1  CTTTAAAGCTAGCTTGGGCTATAAAAAAAGACTGTGTGTGTGTGTACGCG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAAAGCTAGCTTGGGCTATAAAAAAAGACTGTGTGTGTGTGTACGCG  200

seq1  CACACACCCCTTCATAGAGGCTAGTATATCAGGCTTATAACTCCAGCTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACCCCTTCATAGAGGCTAGTATATCAGGCTTATAACTCCAGCTAC  250

seq1  TTGACTGGCCAAGAAAGGAAGTCCCCAACTTGAAAGCAACTTTGGGTGAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACTGGCCAAGAAAGGAAGTCCCCAACTTGAAAGCAACTTTGGGTGAC  300

seq1  TTAGCAAGATACCTTAAACGAGGCCGTAGTTTCAAAATAAGAAATAAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCAAGATACCTTAAACGAGGCCGTAGTTTCAAAATAAGAAATAAAAG  350

seq1  AAAGAAAAGGGGAAGAGATAACCTAGAAAGATTGAGTATGGTATCATTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAAAGGGGAAGAGATAACCTAGAAAGATTGAGTATGGTATCATTCT  400

seq1  ACTCAGAGATACAAATACTGATCATGCCAAAAATCATACTTTGCTTTTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAGAGATACAAATACTGATCATGCCAAAAATCATACTTTGCTTTTGT  450

seq1  CAAAGTAACAGAACCTAATATGGTGGCTGTTGTAACAGAAAGTAGCATGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGTAACAGAACCTAATATGGTGGCTGTTGTAACAGAAAGTAGCATGT  500

seq1  TTATCATGAGATTTTTCTATACTCAAGATTTATGGCTAAAAAATAATGGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCATGAGATTTTTCTATACTCAAGATTTATGGCTAAAAAATAATGGA  550

seq1  GTCAAAATTAATAAAAGAACTTTAAAGGTCATGATTTAGATTTTCAGATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAAAATTAATAAAAGAACTTTAAAGGTCATGATTTAGATTTTCAGATT  600

seq1  TACAAGAAGTATAATCTGTACACAATTAAATTCTAATTATCAGGTAAGTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAGAAGTATAATCTGTACACAATTAAATTCTAATTATCAGGTAAGTA  650

seq1  TTACATGTGATATTATCAACAAGGTATGAAAATGATTCTCTGAAGAGCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACATGTGATATTATCAACAAGGTATGAAAATGATTCTCTGAAGAGCAA  700

seq1  AATAAGCACTGCCCTCAACATTCCCTCAAAAGCTCAGTGCAATGTTTTAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAGCACTGCCCTCAACATTCCCTCAAAAGCTCAGTGCAATGTTTTAA  750

seq1  AAGTCTTAAATGTTGGTTTCAAAGAACAAAGTGCAAGACAATTTAAGAAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTTAAATGTTGGTTTCAAAGAACAAAGTGCAAGACAATTTAAGAAT  800

seq1  TCTTATCTATTATATTTGTCTAAGACTTACAAAAGAAACAAATAATATTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATCTATTATATTTGTCTAAGACTTACAAAAGAAACAAATAATATTT  850

seq1  CTACTTCGCACAAAAGTCTATGCTTCATTAAACTAGGCAGAGTTACTCAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTCGCACAAAAGTCTATGCTTCATTAAACTAGGCAGAGTTACTCAC  900

seq1  CGCCCACGTCTTAGTCAACCGGAAAATCGGCGCACTCTGTAAGCCAGAAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCCACGTCTTAGTCAACCGGAAAATCGGCGCACTCTGTAAGCCAGAAA  950

seq1  CCACAGCCATAAGTGCGTGAAGGTTGTTAAGTTCATATAGTTTCTGAAGA  1000
       ||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  -CACAGCCATAAGTGCGTGAAGGTTGTTAAGTTCATATAG-TTCTGAAGA  998

seq1  TTTAAGAAAAAGGGGGAAGAGGATTGTTTTTTTAAGAAAATGACTGCAGG  1050
      ||||||||||||||||| ||||| |||||||||||| ||||||||||| |
seq2  TTTAAGAAAAAGGGGGAGGAGGA-TGTTTTTTTAAG-AAATGACTGCA-G  1045

seq1  GAAATACAGATTAGCACAATTTAGGCAGTGGATAGAATAACTATTTATTA  1100
      |||||| ||| |||||| |||||||||||||| |||||||||||||| ||
seq2  GAAATA-AGA-TAGCAC-ATTTAGGCAGTGGA-AGAATAACTATTTA-TA  1090

seq1  TTGTTACTGTCACTTTTGGAAACTGTCTTCTAGGATACCCAGTAAATTAT  1150
      ||| |||||||||||| |||||||||||||||||||  |||||  |||||
seq2  TTG-TACTGTCACTTTGGGAAACTGTCTTCTAGGAT--CCAGT--ATTAT  1135

seq1  TTTTGGCCTATAATATAATGTTCATGTTCTACCCTGGCACTTTCACCCAA  1200
      |||||| ||| | ||      |||  ||   | |||||||||    || |
seq2  TTTTGGGCTAAATTA-----GTCAGTTT---CACTGGCACTT----CCCA  1173

seq1  GCTGTGGGAATAAACCCAACTCTAAATGG  1229
      || ||||||||||  ||| ||||||||||
seq2  GC-GTGGGAATAA--CCACCTCTAAATGG  1199

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information