MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-171K19
Chromosome	1 (Build37)
Map Location	193,233,472 - 193,416,492
singlet/doublet	doublet
Overlap gene	LOC667044, Dtl, Ints7
Upstream gene	LOC100039394, EG666975, Rps6kc1, Angel2, Vash2, LOC100039445, LOC666987, 9630055N22Rik, 1700022P22Rik, Tatdn3, Nsl1, 9130211I03Rik, 4933417M04Rik, Atf3, Nenf, 2310028N02Rik, Ppp2r5a, LOC100039501
Downstream gene	Lpgat1, Nek2, 4930557M11Rik, Slc30a1, 3322402L07Rik, LOC100042611, Traf5, Traf5, LOC100042625, Rcor3, Kcnh1, Hhat
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG666975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666975 MGI:3648155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rps6kc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320119 MGI:2443419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angel2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52477 MGI:1196310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vash2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226841 MGI:2444826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC666987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	9630055N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226844 MGI:2444881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75558 MGI:1922808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	Tatdn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68972 MGI:1916222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 2 Proteins

name	Nsl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381318 MGI:2685830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130211I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381319 MGI:1925491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933417M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619288 MGI:3588202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 5 Proteins

name	Atf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11910 MGI:109384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nenf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66208 MGI:1913458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310028N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66950 MGI:1914200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226849 MGI:2388479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039501 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dtl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76843 MGI:1924093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77065 MGI:1924315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lpgat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226856 MGI:2446186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18005 MGI:109359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930557M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98736 MGI:2138631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Slc30a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22782 MGI:1345281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3322402L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74023 MGI:1921273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs, 3 Proteins pseudo : _no_value

name	Traf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22033 MGI:107548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22033 MGI:107548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 184 ESTs, 11 Proteins

name	Rcor3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214742 MGI:2441920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16510 MGI:1341721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hhat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226861 MGI:2444681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666975 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364753 GeneID:666975 MGI:3648155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG666975 transcript_id : XM_987363.1

name	Rps6kc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52546980 GeneID:320119 MGI:2443419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase polypeptide 1 transcript_id : NM_178775.3

name	Angel2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794812 GeneID:52477 MGI:1196310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angel homolog 2 (Drosophila) transcript_id : NM_021421.3

name	Vash2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450246 GeneID:226841 MGI:2444826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasohibin 2 transcript_id : NM_144879.1

name	LOC100039445 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149247224 GeneID:100039445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039445 transcript_id : XM_001472897.1

name	9630055N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486924 GeneID:226844 MGI:2444881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630055N22 gene transcript_id : NM_001081259.1

name	1700022P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149247242 GeneID:75558 MGI:1922808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 1700022P22 gene transcript_id : XM_886605.3

name	Tatdn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149247247 GeneID:68972 MGI:1916222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 2 Proteins product : TatD DNase domain containing 3 transcript_id : XM_129661.10

name	Nsl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711342 GeneID:381318 MGI:2685830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) transcript_id : NM_198654.2

name	9130211I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364287 GeneID:381319 MGI:1925491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130211I03 gene transcript_id : NM_030060.2

name	4933417M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364757 GeneID:619288 MGI:3588202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 5 Proteins product : RIKEN cDNA 4933417M04 gene transcript_id : XM_886705.2

name	Atf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542153 GeneID:11910 MGI:109384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 3 transcript_id : NM_007498.2

name	Nenf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377999 GeneID:66208 MGI:1913458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron derived neurotrophic factor transcript_id : NM_025424.2

name	2310028N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802089 GeneID:66950 MGI:1914200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310028N02 gene transcript_id : NM_025864.3

name	Ppp2r5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130061 GeneID:226849 MGI:2388479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), alpha isoform transcript_id : NM_144880.4

name	Dtl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061464 GeneID:76843 MGI:1924093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : denticleless homolog (Drosophila) transcript_id : NM_029766.2

name	Ints7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328518 GeneID:77065 MGI:1924315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 7 transcript_id : NM_178632.4

name	Lpgat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130036 GeneID:226856 MGI:2446186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysophosphatidylglycerol acyltransferase 1 transcript_id : NM_172266.2

name	Nek2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371063 GeneID:18005 MGI:109359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 2 transcript_id : NM_010892.2

name	4930557M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149247253 GeneID:98736 MGI:2138631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930557M11 gene transcript_id : XM_001478622.1

name	Slc30a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490410 GeneID:22782 MGI:1345281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 30 (zinc transporter), member 1 transcript_id : NM_009579.3

name	3322402L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359478 GeneID:74023 MGI:1921273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3322402L07 gene transcript_id : NM_023727.2

name	Traf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755866 GeneID:22033 MGI:107548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 5 transcript_id : NM_011633.1

name	Traf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755866 GeneID:22033 MGI:107548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 5 transcript_id : NM_011633.1

name	LOC100042625 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149247502 GeneID:100042625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 184 ESTs, 11 Proteins product : similar to glutathione S-transferase pi class A transcript_id : XM_001478655.1

name	Rcor3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57634522 GeneID:214742 MGI:2441920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REST corepressor 3 transcript_id : NM_144814.2

name	Kcnh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370338 GeneID:16510 MGI:1341721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 1 transcript_id : NM_010600.2

name	Kcnh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370249 GeneID:16510 MGI:1341721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 1 transcript_id : NM_001038607.1

name	Hhat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802754 GeneID:226861 MGI:2444681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hedgehog acyltransferase transcript_id : NM_144881.3

name	EG666975 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364754 GeneID:666975 MGI:3648155
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992457.1

name	Rps6kc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52546981 CCDS:CCDS15611.1 GeneID:320119 MGI:2443419
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : ribosomal protein S6 kinase, 52kDa, polypeptide 1 protein_id : NP_848890.2

name	Angel2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794813 CCDS:CCDS15612.1 GeneID:52477 MGI:1196310
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA] codon_start : 1 product : D1Ertd396e protein protein_id : NP_067396.3

name	Vash2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450247 GeneID:226841 MGI:2444826
definition	codon_start : 1 product : vasohibin 2 protein_id : NP_659128.1

name	LOC100039445 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149247225 GeneID:100039445
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472947.1

name	9630055N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486925 GeneID:226844 MGI:2444881
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC226844 protein_id : NP_001074728.1

name	1700022P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883678 GeneID:75558 MGI:1922808
definition	codon_start : 1 product : hypothetical protein LOC75558 protein_id : XP_891698.1

name	Tatdn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149247248 GeneID:68972 MGI:1916222
definition	codon_start : 1 product : TatD DNase domain containing 3 protein_id : XP_129661.4

name	Nsl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56711343 CCDS:CCDS15614.1 GeneID:381318 MGI:2685830
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : similar to DC8/DC31 protein protein_id : NP_941056.2

name	9130211I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058956 CCDS:CCDS15615.1 GeneID:381319 MGI:1925491
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Jun dimerization protein p21SNFT protein_id : NP_084336.1

name	4933417M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883683 GeneID:619288 MGI:3588202
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891798.1

name	Atf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542154 CCDS:CCDS15616.1 GeneID:11910 MGI:109384
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0006094 - gluconeogenesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating transcription factor 3 protein_id : NP_031524.2

name	Nenf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384818 CCDS:CCDS15618.1 GeneID:66208 MGI:1913458
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] GO_process : GO:0043410 - positive regulation of MAPKKK cascade [Evidence IDA] codon_start : 1 note : neudesin; Spinal cord injury related protein 10; secreted protein of unknown function product : SCIRP10-related protein protein_id : NP_079700.1

name	2310028N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385348 CCDS:CCDS15619.1 GeneID:66950 MGI:1914200
definition	codon_start : 1 product : hypothetical protein LOC66950 protein_id : NP_080140.1

name	Ppp2r5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059051 CCDS:CCDS15620.1 GeneID:226849 MGI:2388479
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2, regulatory subunit B (B56), alpha isoform protein_id : NP_659129.2

name	Dtl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982955 CCDS:CCDS15621.1 GeneID:76843 MGI:1924093
definition	codon_start : 1 note : retinoic-acid regulated nuclear matrix-associated protein; Meth A ramp product : denticleless homolog protein_id : NP_084042.1

name	Ints7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328519 GeneID:77065 MGI:1924315
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : integrator complex subunit 7 protein_id : NP_848747.3

name	Lpgat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986567 CCDS:CCDS15622.1 GeneID:226856 MGI:2446186
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : lysophosphatidylglycerol acyltransferase 1 protein_id : NP_758470.1

name	Nek2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754818 CCDS:CCDS15623.1 GeneID:18005 MGI:109359
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0030496 - midbody [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000922 - spindle pole [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007126 - meiosis [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000070 - mitotic sister chromatid segregation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : NIMA - related expressed kinase 2; NIMA-related expressed kinase 2 product : NIMA (never in mitosis gene a)-related expressed kinase 2 protein_id : NP_035022.1

name	4930557M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149247254 GeneID:98736 MGI:2138631
definition	codon_start : 1 product : hypothetical protein LOC98736 protein_id : XP_001478672.1

name	Slc30a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678017 CCDS:CCDS15625.1 GeneID:22782 MGI:1345281
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence ISS] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0009935 - nutrient import [Evidence IMP]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence IMP]; GO:0006829 - zinc ion transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : zinc transporter 1 product : solute carrier family 30 (zinc transporter), member 1 protein_id : NP_033605.1

name	3322402L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794152 CCDS:CCDS15626.1 GeneID:74023 MGI:1921273
definition	codon_start : 1 product : hypothetical protein LOC74023 protein_id : NP_076216.1

name	Traf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755867 GeneID:22033 MGI:107548
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy function : an activator of NF-kappaB and putative signal transducer for the lymphotoxin beta receptor product : Tnf receptor-associated factor 5 protein_id : NP_035763.1

name	Traf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755867 GeneID:22033 MGI:107548
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy function : an activator of NF-kappaB and putative signal transducer for the lymphotoxin beta receptor product : Tnf receptor-associated factor 5 protein_id : NP_035763.1

name	LOC100042625 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149247503 GeneID:100042625
definition	codon_start : 1 product : similar to glutathione S-transferase pi class A protein_id : XP_001478705.1

name	Rcor3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57634523 GeneID:214742 MGI:2441920
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : REST corepressor 3 protein_id : NP_659063.2

name	Kcnh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754422 CCDS:CCDS15627.1 GeneID:16510 MGI:1341721
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ether-a-go-go; ether a go-go; potassium voltage-gated channel, subfamily H, member 1 product : potassium voltage-gated channel, subfamily H, member 1 isoform 1 protein_id : NP_034730.1

name	Kcnh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370250 GeneID:16510 MGI:1341721
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : potassium voltage-gated channel, subfamily H (eag-related), member 1 (MGD\|MGI:1341721 GB\|NM_010600, evidence: BLASTN, 99%, match=2867); putative; isoform 2 is encoded by transcript variant 2; ether-a-go-go; ether a go-go; potassium voltage-gated channel, subfamily H, member 1 product : potassium voltage-gated channel, subfamily H, member 1 isoform 2 protein_id : NP_001033696.1

name	Hhat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559954 CCDS:CCDS15628.1 GeneID:226861 MGI:2444681
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0018345 - protein palmitoylation [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IMP] codon_start : 1 product : hedgehog acyltransferase protein_id : NP_659130.2

name	LOC100039394 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039394
definition	number : 1 pseudo : _no_value

name	LOC100039394 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039394
definition	number : 2 pseudo : _no_value

name	LOC100039394 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039394
definition	number : 3 pseudo : _no_value

name	LOC666987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666987
definition	number : 1 pseudo : _no_value

name	LOC100039501 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039501
definition	number : 1 pseudo : _no_value

name	LOC667044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667044
definition	number : 1 pseudo : _no_value

name	LOC667044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667044
definition	number : 2 pseudo : _no_value

name	LOC667044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667044
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:125609
definition	standard_name : Results_ER_9_5_95_44.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207271
definition	standard_name : RH126952

name	(CDS detail)
type	STS
link
xref	UniSTS:161175
definition	standard_name : RH124353

name	(CDS detail)
type	STS
link
xref	UniSTS:234304
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128832
definition	standard_name : ND

name	(CDS detail)
type	STS
link
xref	UniSTS:128833
definition	standard_name : D1Mit462.2

name	(CDS detail)
type	STS
link
xref	UniSTS:167270
definition	standard_name : RH127139

name	(CDS detail)
type	STS
link
xref	UniSTS:158907
definition	standard_name : C85134

name	(CDS detail)
type	STS
link
xref	UniSTS:167286
definition	standard_name : AU015293

name	(CDS detail)
type	STS
link
xref	UniSTS:165134
definition	standard_name : AI845692

name	(CDS detail)
type	STS
link
xref	UniSTS:234307
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234309
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234310
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165133
definition	standard_name : AI451597

name	(CDS detail)
type	STS
link
xref	UniSTS:141125
definition	standard_name : Atf3

name	(CDS detail)
type	STS
link
xref	UniSTS:161818
definition	standard_name : RH124996

name	(CDS detail)
type	STS
link
xref	UniSTS:165135
definition	standard_name : AI118576

name	(CDS detail)
type	STS
link
xref	UniSTS:267867
definition	standard_name : MARC_15687-15688:1013522980:1

name	(CDS detail)
type	STS
link
xref	UniSTS:128645
definition	standard_name : D1Mit292

name	(CDS detail)
type	STS
link
xref	UniSTS:39544
definition	standard_name : SHGC-57254

name	(CDS detail)
type	STS
link
xref	UniSTS:128549
definition	standard_name : D1Mit209

name	(CDS detail)
type	STS
link
xref	UniSTS:210031
definition	standard_name : RH136036

name	(CDS detail)
type	STS
link
xref	UniSTS:234312
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122666
definition	standard_name : 01.MMHAP64FLA1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178552
definition	standard_name : AI649174

name	(CDS detail)
type	STS
link
xref	UniSTS:178553
definition	standard_name : AW112037

name	(CDS detail)
type	STS
link
xref	UniSTS:207274
definition	standard_name : BE688013

name	(CDS detail)
type	STS
link
xref	UniSTS:465400
definition	standard_name : Nek2

name	(CDS detail)
type	STS
link
xref	UniSTS:161346
definition	standard_name : RH124524

name	(CDS detail)
type	STS
link
xref	UniSTS:178554
definition	standard_name : AF007247

name	(CDS detail)
type	STS
link
xref	UniSTS:162802
definition	standard_name : RH126090

name	(CDS detail)
type	STS
link
xref	UniSTS:185462
definition	standard_name : BB016121

name	(CDS detail)
type	STS
link
xref	UniSTS:246020
definition	standard_name : AI029423

name	(CDS detail)
type	STS
link
xref	UniSTS:165136
definition	standard_name : AI839647

name	(CDS detail)
type	STS
link
xref	UniSTS:234313
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:215060
definition	standard_name : RH131777

name	(CDS detail)
type	STS
link
xref	UniSTS:207272
definition	standard_name : BB278993

name	(CDS detail)
type	STS
link
xref	UniSTS:161456
definition	standard_name : RH124634

name	(CDS detail)
type	STS
link
xref	UniSTS:163273
definition	standard_name : D78141

name	(CDS detail)
type	STS
link
xref	UniSTS:128834
definition	standard_name : D1Mit463

name	(CDS detail)
type	STS
link
xref	UniSTS:243478
definition	standard_name : BI283102

name	(CDS detail)
type	STS
link
xref	UniSTS:273095
definition	standard_name : PMC31882P1

name	(CDS detail)
type	STS
link
xref	UniSTS:128882
definition	standard_name : D1Mit511

name	(CDS detail)
type	STS
link
xref	UniSTS:128881
definition	standard_name : D1Mit510

name	(CDS detail)
type	STS
link
xref	UniSTS:125644
definition	standard_name : U04294

name	(CDS detail)
type	STS
link
xref	UniSTS:158908
definition	standard_name : U04294

name	(CDS detail)
type	STS
link
xref	UniSTS:143657
definition	standard_name : Kcnh1

name	(CDS detail)
type	STS
link
xref	UniSTS:234315
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234314
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128552
definition	standard_name : D1Mit210

name	LOC100042611 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149247255 GeneID:100042611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs, 3 Proteins product : similar to Cks1 protein homologue pseudo : _no_value transcript_id : XR_033810.1

clone name	MSMg01-421F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-171K19.b	B6Ng01-171K19.g
ACC	GA000493	GA000494
length	962	689
definition	B6Ng01-171K19.b	B6Ng01-171K19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(193,415,539 - 193,416,492)	(193,233,472 - 193,234,159)
sequence	gaattcctgactcagtctaaagaattacaaagctgcaaggaggaaaaacc aagactgtgagcacacgattccttgcagtgcagacgctaatgtactgttt tccttgtaaagacactaacttcctgtcttactcaacaaaactctttcaca aagaactaagatgccaatgacatttcaacgactattttgagactatgagc tggaattcaaagagtagggctgagtgttttagcaacaggcagctgtgctc cttacaaacagctcagtgcttgaaagcactggctcctactgcacaagacc cagggttggttcccaggacccatccagcagcttacaaccacctatatctc tagttgcaggagatccaatgatctcttctggcctctgtgggctccaggca catatgtgcacatagaatcagtcacggttaattggcacagtgcctcagcc aagcaagaacacacttgaactgaggggctgccagctcatgccgcccgcac cgactgcagtcagtgaggagatcaagcactgcccgtgtctgactgcggtg aggggtttgcaacagttccacctaattacagaatgttttcttttacatga actcttgacaacaaacacattttgtgttaagtaacatttgcttcagtctc atggcttatccaggtacaatggcattggcatcatccatccacccacccac ccaccccatccatccaccatgttttggtaaaggacatggatgaggtagca agaaccaaggcaatgccagcaactgtcccaggtcacgtgttcttcattac tgtaaactcatattaaggagagaacacaagcttagttggtatgcaacagt tctcagcaaaactgaactactcattggtattcaatttaaaaaacactaca gccaccagtccaaatgtttggggataagaatataaatggtatgcttttcc tgggacacagat	gaattcacgagcgaggagcgcaaaggcagagaaacttcggacttgagttg ggtttaacatgtctgtgcactctccaagggaatatactcactaaggcttg ggaagagggcctgcagggaggatggttatagtctatgcagccccagtttc tccatttcaaaggcagaggtgagcatgctcacttcaggttgttttgggaa acaaacacactgctttagaaaacacttagcacagtgcttgactcaagcca gcaggcaccataacgctgctgtggctgcctcagaaatggttgctctgttc ttcccggtagcccttttattctctccaggattcttcctcagtgccggcaa acaaaaacacacggcagacacacgctgcagccacagttgcattttggtgc agtgactaaagctagacaggttaactggctccgtttcccccaacaaccgc cagactccaggataactaactactcagcctctggtaaatggagttctgct gaatgcctttctaatttgtcttccttctccatgcacaagggttcataaaa tgataaccttgtattcattaatgcatgggattaaaacatgtaaagtatta tgtattgcttatgaatacatggaatatatatattatatgtatatatatat atgtatatatatatatatatatatatatatatatatata
quality values	Open. Hide. 58 26 21 28 54 54 54 45 58 28 44 58 34 20 54 62 62 62 62 62 54 62 62 47 38 39 27 42 23 19 26 20 27 46 56 62 62 62 62 62 47 49 62 49 62 62 62 62 59 62 59 62 62 59 59 62 62 62 59 46 62 62 59 62 62 62 62 59 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 59 62 62 62 62 62 62 62 62 62 33 54 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 45 62 54 47 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 54 42 54 42 54 51 62 56 62 56 54 62 62 62 62 62 62 62 54 62 62 62 62 54 38 62 62 62 38 47 39 62 47 42 62 62 62 42 62 62 56 62 56 62 62 56 62 62 62 62 62 42 54 62 47 62 62 48 47 52 62 49 52 62 43 49 62 43 62 62 62 52 62 62 62 62 50 54 52 47 62 62 62 47 62 62 62 62 62 49 46 43 47 62 42 62 62 52 48 42 42 58 58 58 58 41 46 54 50 42 39 54 46 48 54 39 46 48 45 58 58 54 34 58 52 50 46 32 46 50 49 52 52 54 58 58 40 58 54 54 39 58 35 38 54 40 54 38 54 37 52 47 58 49 42 34 54 54 54 31 28 24 41 30 46 52 46 30 29 50 52 46 42 22 52 42 32 35 52 54 33 52 52 52 32 35 52 52 14 30 42 25 41 35 50 24 50 34 42 47 25 38 45 39 49 58 18 54 12 12 58 54 58 10 48 35 33 24 42 50 28 26 26 50 58 13 54 34 28 35 47 33 35 32 34 16 26 32 19 23 22 21 17 49 15 18 28 20 51 27 25 33 25 22 34 19 52 31 19 14 41 21 22 50 32 19 17 32 42 46 26 22 18 34 32 39 49 31 19 30 28 32 42 51 28 39 36 28 14 25 28 7 17 32 32 25 33 28 22 13 21 15 28 10 22 8 17 13 21 21 15 18 26 19 9 22 14 19 33 19 16 15 18 28 28 35 15 6 12 12 11 19 7 10 13 23 22 9 26 30 30 40 21 11 15 42 33 17 15 9 16 28 42 30 25 32 19 7 15 6 6 23 21 37 34 35 46 44 37 24 44 40 44 34 14 7 13 9 6 6 12 12 17 6 17 26 27 27 14 6 24 20 19 25 19 21 16 25 7 24 40 23 21 32 16 20 10 23 29 6 14 15 9 6 14 38 47 8 32 9 18 6 10 15 33 30 31 45 23 15 13 9 15 9 6 21 28 13 12 10 11 6 25 9	Open. Hide. 62 47 44 47 62 33 26 11 26 56 28 28 31 34 44 49 44 59 62 59 62 62 62 62 62 49 62 62 62 59 59 59 62 59 59 62 54 62 62 62 59 59 62 62 62 59 62 62 62 62 49 42 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 53 54 62 62 62 62 62 46 62 49 52 62 62 54 54 54 62 62 62 62 62 62 54 62 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 49 54 58 54 58 58 58 54 58 58 58 54 58 54 58 58 53 54 54 52 52 58 54 50 42 45 58 51 58 54 58 54 51 51 54 58 58 41 48 50 58 58 40 51 58 58 58 58 51 58 51 42 53 58 51 40 58 58 51 49 43 58 52 50 51 58 58 54 49 50 53 42 51 44 44 50 50 49 58 40 58 58 58 53 53 53 53 53 53 49 54 52 40 51 58 58 44 58 51 44 41 51 58 39 52 50 54 32 51 58 58 58 58 41 58 50 58 40 54 52 58 54 54 54 45 54 51 54 41 54 39 54 42 54 53 53 45 53 49 54 41 54 44 44 54 51 50 44 51 41 39 39 42 40 46 44 47 47 41 35 44 41 39 38 29 21 31 31 13 15 9 11 19 19 22 10 22 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_193415539_193416492
seq2: B6Ng01-171K19.b_44_1005 (reverse)

seq1  ATCTGTGTCCCAGG-AAAGCATA-CATTTATA-TCTTAT-CCCAAACATT  46
      |||||||||||||| |||||||| |||||||| |||||| ||||||||||
seq2  ATCTGTGTCCCAGGAAAAGCATACCATTTATATTCTTATCCCCAAACATT  50

seq1  TGGACTGGT-GCTGTATGTGTTTTTTAAATTGAATA-CAATGAGTAGTTT  94
      ||||||||| |||||| ||||||||||||||||||| |||||||||| ||
seq2  TGGACTGGTGGCTGTA-GTGTTTTTTAAATTGAATACCAATGAGTAG-TT  98

seq1  CAGTTTTGCTGAG-ACTGTTGCATA-CAACT-AGCTTGTGTTCTCTCCTT  141
      ||||||||||||| ||||||||||| ||||| ||||||||||||||||||
seq2  CAGTTTTGCTGAGAACTGTTGCATACCAACTAAGCTTGTGTTCTCTCCTT  148

seq1  AATATGAGTTTACAGTAATGAAGAACACGTGACCTGGGACAGTTGCTGGC  191
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATGAGTTTACAGTAATGAAGAACACGTGACCTGGGACAGTTGCTGGC  198

seq1  ATTGCCTTGGTTCTTGCTACCTCATCCATGTCCTTTTACCAAACATGGTG  241
      ||||||||||||||||||||||||||||||||||||  | ||||||||||
seq2  ATTGCCTTGGTTCTTGCTACCTCATCCATGTCCTTTACCAAAACATGGTG  248

seq1  GATGGAT-GGGTGGGTGGGTGGGTGGATGGATGATGCCAATGCCATTGTA  290
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGATGGGGTGGGTGGGTGGGTGGATGGATGATGCCAATGCCATTGTA  298

seq1  CCTGGATAAGCCATGAGACTGAAGCAAATGTTACTTAACACAAAATGTGT  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGATAAGCCATGAGACTGAAGCAAATGTTACTTAACACAAAATGTGT  348

seq1  TTGTTGTCAAGAGTTCATGTAAAAGAAAACATTCTGTAATTAGGTGGAAC  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGTCAAGAGTTCATGTAAAAGAAAACATTCTGTAATTAGGTGGAAC  398

seq1  TGTTGCAAACCCCTCACCGCAGTCAGACACGGGCAGTGCTTGATCTCCTC  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGCAAACCCCTCACCGCAGTCAGACACGGGCAGTGCTTGATCTCCTC  448

seq1  ACTGACTGCAGTCGGTGCGGGCGGCATGAGCTGGCAGCCCCTCAGTTCAA  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACTGCAGTCGGTGCGGGCGGCATGAGCTGGCAGCCCCTCAGTTCAA  498

seq1  GTGTGTTCTTGCTTGGCTGAGGCACTGTGCCAATTAACCGTGACTGATTC  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTTCTTGCTTGGCTGAGGCACTGTGCCAATTAACCGTGACTGATTC  548

seq1  TATGTGCACATATGTGCCTGGAGCCCACAGAGGCCAGAAGAGATCATTGG  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTGCACATATGTGCCTGGAGCCCACAGAGGCCAGAAGAGATCATTGG  598

seq1  ATCTCCTGCAACTAGAGATATAGGTGGTTGTAAGCTGCTGGATGGGTCCT  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCCTGCAACTAGAGATATAGGTGGTTGTAAGCTGCTGGATGGGTCCT  648

seq1  GGGAACCAACCCTGGGTCTTGTGCAGTAGGAGCCAGTGCTTTCAAGCACT  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAACCAACCCTGGGTCTTGTGCAGTAGGAGCCAGTGCTTTCAAGCACT  698

seq1  GAGCTGTTTGTAAGGAGCACAGCTGCCTGTTGCTAAAACACTCAGCCCTA  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTGTTTGTAAGGAGCACAGCTGCCTGTTGCTAAAACACTCAGCCCTA  748

seq1  CTCTTTGAATTCCAGCTCATAGTCTCAAAATAGTCGTTGAAATGTCATTG  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTGAATTCCAGCTCATAGTCTCAAAATAGTCGTTGAAATGTCATTG  798

seq1  GCATCTTAGTTCTTTGTGAAAGAGTTTTGTTGAGTAAGACAGGAAGTTAG  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATCTTAGTTCTTTGTGAAAGAGTTTTGTTGAGTAAGACAGGAAGTTAG  848

seq1  TGTCTTTACAAGGAAAACAGTACATTAGCGTCTGCACTGCAAGGAATCGT  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTTACAAGGAAAACAGTACATTAGCGTCTGCACTGCAAGGAATCGT  898

seq1  GTGCTCACAGTCTTGGTTTTTCCTCCTTGCAGCTTTGTAATTCTTTAGAC  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTCACAGTCTTGGTTTTTCCTCCTTGCAGCTTTGTAATTCTTTAGAC  948

seq1  TGAGTCAGGAATTC  954
      ||||||||||||||
seq2  TGAGTCAGGAATTC  962

seq1: chr1_193233472_193234159
seq2: B6Ng01-171K19.g_67_755

seq1  GAATTCA-GAGCGAGGAGCGCAAAGGCAGAGAAACTTCGGACTTGAGTTG  49
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACGAGCGAGGAGCGCAAAGGCAGAGAAACTTCGGACTTGAGTTG  50

seq1  GGTTTAACATGTCTGTGCACTCTCCAAGGGAATATACTCACTAAGGCTTG  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTAACATGTCTGTGCACTCTCCAAGGGAATATACTCACTAAGGCTTG  100

seq1  GGAAGAGGGCCTGCAGGGAGGATGGTTATAGTCTATGCAGCCCCAGTTTC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAGGGCCTGCAGGGAGGATGGTTATAGTCTATGCAGCCCCAGTTTC  150

seq1  TCCATTTCAAAGGCAGAGGTGAGCATGCTCACTTCAGGTTGTTTTGGGAA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATTTCAAAGGCAGAGGTGAGCATGCTCACTTCAGGTTGTTTTGGGAA  200

seq1  ACAAACACACTGCTTTAGAAAACACTTAGCACAGTGCTTGACTCAAGCCA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACACACTGCTTTAGAAAACACTTAGCACAGTGCTTGACTCAAGCCA  250

seq1  GCAGGCACCATAACGCTGCTGTGGCTGCCTCAGAAATGGTTGCTCTGTTC  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGCACCATAACGCTGCTGTGGCTGCCTCAGAAATGGTTGCTCTGTTC  300

seq1  TTCCCGGTAGCCCTTTTATTCTCTCCAGGATTCTTCCTCAGTGCCGGCAA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCGGTAGCCCTTTTATTCTCTCCAGGATTCTTCCTCAGTGCCGGCAA  350

seq1  ACAAAAACACACGGCAGACACACGCTGCAGCCACAGTTGCATTTTGGTGC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAAACACACGGCAGACACACGCTGCAGCCACAGTTGCATTTTGGTGC  400

seq1  AGTGACTAAAGCTAGACAGGTTAACTGGCTCCGTTTCCCCCAACAACCGC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACTAAAGCTAGACAGGTTAACTGGCTCCGTTTCCCCCAACAACCGC  450

seq1  CAGACTCCAGGATAACTAACTACTCAGCCTCTGGTAAATGGAGTTCTGCT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTCCAGGATAACTAACTACTCAGCCTCTGGTAAATGGAGTTCTGCT  500

seq1  GAATGCCTTTCTAATTTGTCTTCCTTCTCCATGCACAAGGGTTCATAAAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGCCTTTCTAATTTGTCTTCCTTCTCCATGCACAAGGGTTCATAAAA  550

seq1  TGATAACCTTGTATTCATTAATGCATGGGATTAAAACATGTAAAGTATTA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAACCTTGTATTCATTAATGCATGGGATTAAAACATGTAAAGTATTA  600

seq1  TGTATTGCTTATGAATACATGGAATATATATATTATATGTATATATATAT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTGCTTATGAATACATGGAATATATATATTATATGTATATATATAT  650

seq1  ATGTATATATATATATATATATATATATATATATATATA  688
      |||||||||||||||||||||||||||||||||||||||
seq2  ATGTATATATATATATATATATATATATATATATATATA  689

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information