MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-191I18
Chromosome	1 (Build37)
Map Location	9,922,443 - 9,923,469
singlet/doublet	singlet
Overlap gene	6030422M02Rik
Upstream gene	Sntg1, LOC665103, LOC100039464, EG620853, LOC665138, Rrs1, Adhfe1, LOC620542, 3110035E14Rik, Mybl1, Vcpip1, LOC100039536, LOC665173, Sgk3, EG620986, LOC100039643
Downstream gene	LOC100039596, 4930418G15Rik, Cops5, Cspp1, Arfgef1, Cpa6, LOC433271
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sntg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71096 MGI:1918346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 78 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039464 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 47 ESTs

name	EG620853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620853 MGI:3648954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC665138 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Rrs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59014 MGI:1929721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adhfe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76187 MGI:1923437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620542 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620542
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	3110035E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76982 MGI:1924232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17864 MGI:99925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vcpip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70675 MGI:1917925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC665173 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 238 ESTs, 3 Proteins pseudo : _no_value

name	Sgk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170755 MGI:2182368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	EG620986 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620986 MGI:3647661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	LOC100039643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	6030422M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240697 MGI:3045334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100039596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	4930418G15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69312 MGI:1921138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cops5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26754 MGI:1349415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cspp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211660 MGI:2681832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arfgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211673 MGI:2442988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 214 ESTs, 2 Proteins

name	Cpa6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329093 MGI:3045348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 70 Proteins pseudo : _no_value

name	Sntg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971304 GeneID:71096 MGI:1918346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntrophin, gamma 1 transcript_id : NM_027671.4

name	LOC100039464 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233592 GeneID:100039464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs product : similar to gag protein, transcript variant 2 transcript_id : XM_001472866.1

name	LOC100039464 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233590 GeneID:100039464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs product : similar to gag protein, transcript variant 1 transcript_id : XM_001472850.1

name	Rrs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946929 GeneID:59014 MGI:1929721
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) transcript_id : NM_021511.1

name	Adhfe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370905 GeneID:76187 MGI:1923437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alcohol dehydrogenase, iron containing, 1 transcript_id : NM_175236.3

name	3110035E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377518 GeneID:76982 MGI:1924232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110035E14 gene transcript_id : NM_178399.3

name	Mybl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150642 GeneID:17864 MGI:99925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloblastosis oncogene-like 1 transcript_id : NM_008651.2

name	Vcpip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778825 GeneID:70675 MGI:1917925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : valosin containing protein (p97)/p47 complex interacting protein 1 transcript_id : NM_173443.2

name	LOC100039536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233597 GeneID:100039536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039536 transcript_id : XM_001473071.1

name	Sgk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649758 GeneID:170755 MGI:2182368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum/glucocorticoid regulated kinase 3 transcript_id : NM_133220.2

name	Sgk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649752 GeneID:170755 MGI:2182368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum/glucocorticoid regulated kinase 3 transcript_id : NM_177547.3

name	EG620986 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94362713 GeneID:620986 MGI:3647661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : predicted gene, EG620986 transcript_id : XM_885368.2

name	Sgk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649756 GeneID:170755 MGI:2182368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum/glucocorticoid regulated kinase 3 transcript_id : NM_001037759.1

name	6030422M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94362715 GeneID:240697 MGI:3045334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : RIKEN cDNA 6030422M02 gene transcript_id : XM_975177.1

name	LOC100039596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233600 GeneID:100039596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to hCG2037011 transcript_id : XM_001473158.1

name	4930418G15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164765 GeneID:69312 MGI:1921138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930418G15 gene transcript_id : NM_145692.1

name	4930418G15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370505 GeneID:69312 MGI:1921138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930418G15 gene transcript_id : NM_027033.2

name	Cops5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304970 GeneID:26754 MGI:1349415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) transcript_id : NM_013715.1

name	Cspp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301209 GeneID:211660 MGI:2681832
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosome and spindle pole associated protein 1 transcript_id : NM_026493.3

name	Arfgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233604 GeneID:211673 MGI:2442988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 214 ESTs, 2 Proteins product : ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) transcript_id : XM_975420.2

name	Cpa6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119153 GeneID:329093 MGI:3045348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase A6 transcript_id : NM_177834.3

name	LOC100039464 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233591 GeneID:100039464
definition	codon_start : 1 product : similar to gag protein isoform 1 protein_id : XP_001472900.1

name	LOC100039464 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233593 GeneID:100039464
definition	codon_start : 1 product : similar to gag protein isoform 2 protein_id : XP_001472916.1

name	Rrs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946930 CCDS:CCDS14811.1 GeneID:59014 MGI:1929721
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0042254 - ribosome biogenesis and assembly [Evidence IEA] codon_start : 1 exception : mismatches in translation note : regulator for ribosome resistance homolog product : RRS1 ribosome biogenesis regulator homolog protein_id : NP_067486.1

name	Adhfe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424876 CCDS:CCDS14812.1 GeneID:76187 MGI:1923437
definition	GO_function : GO:0050093 - methanol dehydrogenase activity [Evidence IEA] codon_start : 1 note : alcohol dehydrogenase 8 product : Fe-containing alcohol dehydrogenase 1 protein_id : NP_780445.1

name	3110035E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409966 CCDS:CCDS14813.1 GeneID:76982 MGI:1924232
definition	codon_start : 1 product : hypothetical protein LOC76982 protein_id : NP_848486.1

name	Mybl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150643 GeneID:17864 MGI:99925
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : myeloblastosis oncogene-like 1 protein_id : NP_032677.2

name	Vcpip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778826 CCDS:CCDS14814.1 GeneID:70675 MGI:1917925
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence ISS] GO_process : GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence ISS] [Evidence IEA] codon_start : 1 product : valosin-containing protein (p97)/p47 complex-interacting protein p135 protein_id : NP_775619.2

name	LOC100039536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233598 GeneID:100039536
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473121.1

name	EG620986 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82795390 GeneID:620986 MGI:3647661
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890461.1

name	Sgk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649757 CCDS:CCDS14816.1 GeneID:170755 MGI:2182368
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : serine/threonine protein kinase CISK; cytokine-independent survival kinase product : serum/glucocorticoid regulated kinase 3 protein_id : NP_001032848.1

name	Sgk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18959280 CCDS:CCDS14816.1 GeneID:170755 MGI:2182368
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : serine/threonine protein kinase CISK; cytokine-independent survival kinase product : serum/glucocorticoid regulated kinase 3 protein_id : NP_573483.1

name	Sgk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649753 CCDS:CCDS14816.1 GeneID:170755 MGI:2182368
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : serine/threonine protein kinase CISK; cytokine-independent survival kinase product : serum/glucocorticoid regulated kinase 3 protein_id : NP_808215.2

name	6030422M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94362716 GeneID:240697 MGI:3045334
definition	codon_start : 1 product : hypothetical protein LOC240697 protein_id : XP_980271.1

name	LOC100039596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233601 GeneID:100039596
definition	codon_start : 1 product : similar to hCG2037011 protein_id : XP_001473208.1

name	4930418G15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164766 CCDS:CCDS14817.1 GeneID:69312 MGI:1921138
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC69312 isoform 2 protein_id : NP_663730.1

name	4930418G15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735439 GeneID:69312 MGI:1921138
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC69312 isoform 1 protein_id : NP_081309.1

name	Cops5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304971 CCDS:CCDS14818.1 GeneID:26754 MGI:1349415
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence TAS] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] codon_start : 1 note : Jun coactivator; COP9 complex S5; JUN activation binding protein; COP9 (constitutive photomorphogenic), subunit 5 product : COP9 signalosome subunit 5 protein_id : NP_038743.1

name	Cspp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301210 GeneID:211660 MGI:2681832
definition	codon_start : 1 product : centrosome and spindle pole associated protein 1 protein_id : NP_080769.3

name	Arfgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233605 GeneID:211673 MGI:2442988
definition	codon_start : 1 product : ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) protein_id : XP_980514.2

name	Cpa6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119154 CCDS:CCDS14819.1 GeneID:329093 MGI:3045348
definition	GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : metallocarboxypeptidase product : carboxypeptidase B protein_id : NP_808502.2

name	EG620853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620853
definition	number : 3 pseudo : _no_value

name	EG620853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620853
definition	number : 2 pseudo : _no_value

name	EG620853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620853
definition	number : 1 pseudo : _no_value

name	LOC665138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665138
definition	number : 1 pseudo : _no_value

name	LOC665138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665138
definition	number : 2 pseudo : _no_value

name	LOC665138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665138
definition	number : 3 pseudo : _no_value

name	LOC100039643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039643
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:164112
definition	standard_name : AI648812

name	(CDS detail)
type	STS
link
xref	UniSTS:167288
definition	standard_name : AU015916

name	(CDS detail)
type	STS
link
xref	UniSTS:158772
definition	standard_name : AA415037

name	(CDS detail)
type	STS
link
xref	UniSTS:158771
definition	standard_name : AI043035

name	(CDS detail)
type	STS
link
xref	UniSTS:164107
definition	standard_name : AV164974

name	(CDS detail)
type	STS
link
xref	UniSTS:185428
definition	standard_name : AI415019

name	(CDS detail)
type	STS
link
xref	UniSTS:161980
definition	standard_name : RH125158

name	(CDS detail)
type	STS
link
xref	UniSTS:124235
definition	standard_name : 37.MMHAP50FLE4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:124903
definition	standard_name : L35261

name	(CDS detail)
type	STS
link
xref	UniSTS:128649
definition	standard_name : D1Mit296

name	(CDS detail)
type	STS
link
xref	UniSTS:128916
definition	standard_name : D1Mit58

name	(CDS detail)
type	STS
link
xref	UniSTS:128917
definition	standard_name : D1Mit58.2

name	(CDS detail)
type	STS
link
xref	UniSTS:492351
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:209650
definition	standard_name : RH126502

name	(CDS detail)
type	STS
link
xref	UniSTS:209986
definition	standard_name : RH135990

name	(CDS detail)
type	STS
link
xref	UniSTS:488726
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:123500
definition	standard_name : 20.MMHAP97FLG2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178359
definition	standard_name : AI303502

name	(CDS detail)
type	STS
link
xref	UniSTS:234066
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234067
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122752
definition	standard_name : 03.MMHAP85FLA3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125302
definition	standard_name : MHAa74a4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:116248
definition	standard_name : D1Mit316

name	(CDS detail)
type	STS
link
xref	UniSTS:224810
definition

name	LOC665103 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149233596 GeneID:665103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 78 ESTs, 5 Proteins product : similar to Translocase of inner mitochondrial membrane 23 homolog (yeast) pseudo : _no_value transcript_id : XR_030934.1

name	LOC665173 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149233599 GeneID:665173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 238 ESTs, 3 Proteins product : similar to coiled-coil domain containing 72 pseudo : _no_value transcript_id : XR_031004.1

name	LOC433271 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149233602 GeneID:433271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 70 Proteins product : similar to Potassium inwardly-rectifying channel, subfamily J, member 14 pseudo : _no_value transcript_id : XR_031107.1

clone name	MSMg01-511C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-045P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244H08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-191I18.b	B6Ng01-191I18.g
ACC	GA015009	GA015010
length	1,041	1,084
definition	B6Ng01-191I18.b	B6Ng01-191I18.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccatatatatttagagacagcaatactcagctcagcatttaagtt gccctaaatgttttatgtgtcttgtttttcttttgaataacagactactt taaaaaaaattgaagtcatgatgtaaataactatactcacatggcaagct taattttctatacaaatattctttctaaatatattgatctttttaaggct atggatatttagatggtagtagaagaaataagcttaacatttggatatga acgtttctttacatagtgttattttttctatacaatgtacttacagtatt aaaaatctggaagcaagcttatgtgaaagaataccagctgagcataagta gcaaatacctgtaatcttagcacttgaaagttagaatcagactagagaga tggctcagcagttaagagcactggttgttccccaagacgtcctgagttcg attcccagcaaccacagattggctcacaaccatctataatgggatccgat gccctcttttggtttatctgaagacagctacagagtcctcacatacataa aataaataaatgagctgggcagtggagtggtggtgcacgcctttaatccc agcacttgggaggcagaggcaggacgatctcttgagttcaaggccagcct ggtctacagagtgagttccaggacagccagggctacacagagaaaccctg tctggaaaaaacaaaaaacaaaaaaaacaaaaacaaacaactacaactaa gcagaaggttcaagactatttcttggcaaccatagtgagggtccaagcag cctgggctacaagaaaaccttgtcttcaaaaaacaaaaacaaaaaacaaa tcaaaatagtgaactagataaaattcttagaagaagaaaaaaataaatgc ccaagtagacttctattaattaagaactgggctgggggaggtgactcatg aagtaaagaccctgttgtcaagcctgacagcccttgagtttgattccctt acgcccacaggatggagggaactgcatttttcaaagttact	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagt agatgctggcatggatgtggagaaagaggaacactcctccattgttggtg ggattgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat cttcatagcagccttatttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtatatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa ggaactcacacaatatgtactcactgataagtggataatagccccaaacc taggattcccaagatataagatacaatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtggacactatgcccctccttagaattgggaa caaaacacccatggaaggagttacagagacaaagtttggagctgagatga aaggatggaccttgtagagactgccatatccagggatccacccccataat cagcatccaaacgctgacaccattgcatacactagcaagattttatcgaa agggacccagatgtagctgtcttcttgtgagactattgccggggcctagc aacacagaaggtggatgctcacagtcagctaatggatggatcacaggctc caatggaggagctagagaaagaacctaaggaagctaaagggaatctgcaa cccctattggtgggaacaatattatgacctaacagttaccccgaagctct tgactcctagcttgctaagtgatcaaaaagaatg
quality values	Open. Hide. 38 32 15 12 58 54 34 17 58 50 51 42 54 52 45 54 54 32 28 45 58 41 48 23 62 62 52 62 62 62 62 47 25 15 11 27 16 11 13 8 10 16 9 10 10 11 16 44 62 62 49 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 46 49 59 62 62 62 62 62 62 51 59 24 24 34 23 27 27 27 27 50 45 28 28 38 39 32 39 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 56 62 48 62 62 62 59 62 54 54 62 59 59 62 62 62 62 62 48 54 48 56 59 59 62 62 59 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 51 51 51 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 51 34 48 32 28 50 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 47 56 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 54 43 62 62 62 62 62 62 54 62 62 62 62 62 62 52 62 51 52 62 62 46 54 42 52 62 62 48 62 62 62 42 38 62 43 38 30 47 9 41 47 50 50 58 54 35 42 58 52 54 58 52 43 58 54 45 34 30 48 41 52 42 48 58 29 45 52 35 34 40 25 34 16 7 24 27 47 39 26 34 45 32 32 52 48 34 39 23 47 41 41 37 54 41 26 37 27 27 33 25 25 22 58 49 52 37 48 46 49 36 25 58 30 54 33 27 35 21 23 23 58 32 37 47 50 46 46 35 42 42 49 51 47 23 16 18 33 14 16 34 16 19 27 27 19 10 18 10 17 9 9 18 15 15 22 14 11 9 16 9 9 12 7 19 28 15 21 10 4 15 14 15 27 16 9 21 24 25 51 28 32 46 53 32 50 51 16 28 36 13 58 16 28 34 31 44 34 46 39 32 41 39 26 39 24 50 43 51 29 17 35 30 17 21 19 26 31 27 28 24 19 29 33 22 50 23 53 35 18 18 29 20 25 12 37 35 40 12 9 20 32 37 52 21 35 10 10 15 25 49 54 50 44 31 17 26 30 26 40 25 18 7 37 29 44 35 49 37 34 39 12 6 28 17 37 28 21 8 13 23 42 32 14 6 15 20 25 9 14 17 28 35 31 30 20 33 21 8 17 21 9 24 17 6 9 35 23 53 51 27 52 52 32 32 19 13 47 8 17 31 9 38 22 46 28 25 28 31 13 29 26 40 43 32 20 22 33 20 16 23 21 32 28 34 23 28 29 17 15 22 31 33 21 26 16 52 17 16 15 18 15 32 10 18 14 18 12 31 9 5 6 18 18 14 31 36 51 48 36 12 6 13 22 16 31 32 36 39 27 34 29 16 10 20 11 18 15 24 16 9 16 12 43 13 6 25 21 27 8 20 21 19 30 25 14 19 12 22 6 8 11 9 11 9 6 27 18 12 30 13 13 12 14 6 14 6 7 16 17 11 6 16 13 11 29 10 13 23 39 29 20 18 11 21 30 17 22 8 11 22 25 7	Open. Hide. 56 35 51 56 62 56 56 47 42 47 51 11 10 9 7 13 11 9 14 18 12 22 27 25 34 43 56 62 59 62 59 59 59 59 62 59 59 51 59 62 59 59 59 62 62 62 62 59 49 62 62 62 59 59 62 62 59 62 27 28 34 34 23 36 32 35 49 51 46 44 35 62 54 59 62 62 62 62 59 59 59 62 62 62 59 59 59 59 59 59 62 62 62 62 62 59 54 46 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 59 62 62 62 38 54 59 46 46 56 62 62 62 62 62 62 62 59 62 59 62 54 62 56 49 49 59 49 59 62 62 62 62 62 59 56 62 62 62 62 54 62 62 62 62 59 62 56 62 62 54 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 59 62 62 62 56 48 50 62 51 62 62 62 59 59 62 59 59 56 59 51 62 62 59 62 62 62 62 59 59 59 59 49 43 46 48 56 59 62 59 59 62 59 62 62 62 62 62 62 59 54 54 59 59 59 59 62 59 59 59 59 62 59 51 62 59 59 62 59 62 59 59 62 54 59 62 59 59 59 62 59 56 59 59 59 62 54 59 59 59 59 59 59 62 62 62 62 62 59 62 59 62 62 59 59 59 59 51 46 59 59 38 54 49 56 59 62 59 59 59 51 59 59 62 59 51 59 59 56 62 59 59 62 62 59 59 59 59 62 59 51 51 51 51 43 59 59 49 56 48 59 56 59 59 59 62 62 49 50 43 50 59 56 59 62 62 62 62 59 62 59 62 62 62 59 62 62 62 59 59 62 59 56 59 59 59 51 45 45 45 59 59 47 59 56 50 43 62 59 62 62 62 62 62 59 62 56 49 62 59 51 62 56 62 62 62 62 62 59 59 51 51 59 43 45 62 59 59 59 59 62 62 62 62 59 59 62 62 62 62 59 59 62 59 62 51 56 59 62 59 62 56 62 62 56 56 56 56 56 56 62 56 62 62 62 47 47 62 62 62 62 62 39 62 56 44 56 56 62 62 62 56 56 62 62 62 47 54 62 62 56 62 41 47 47 62 47 62 62 56 62 43 41 56 56 56 56 56 51 62 62 62 62 47 42 62 62 62 56 56 56 37 56 56 62 62 62 47 47 43 62 36 33 62 37 56 62 56 43 56 50 56 56 56 27 56 39 47 38 62 62 62 43 38 38 42 27 30 27 62 42 62 62 54 54 48 38 29 41 46 43 52 62 62 62 54 42 47 36 62 52 62 43 43 50 47 42 49 47 42 50 52 47 42 39 43 52 52 52 52 49 41 52 34 34 52 52 46 41 35 30 28 36 23 26 52 22 34 42 52 37 41 52 24 50 52 54 52 43 42 48 20 48 52 52 35 39 35 52 47 48 52 52 46 42 33 31 41 42 58 48 35 42 23 54 52 58 58 42 58 46 49 58 33 45 30 52 52 37 49 35 42 34 27 41 22 42 39 50 33 48 47 54 46 46 54 38 32 46 34 18 16 41 40 48 34 30 23 15 34 9 47 47 42 37 31 27 29 33 27 24 41 46 49 43 48 32 41 41 46 47 26 46 6 31 54 28 29 46 32 32 36 27 36 58 21 42 16 25 23 23 36 31 54 17 50 42 39 35 58 25 17 33 29 24 47 50 50 29 28 25 32 49 27 50 12 49 32 33 31 28 38 16 27 13 52 33 46 32 40 29 53 54 44 35 49 26 51 19 11 44 52 53 13 16 32 43 36 34 28 31 33 26 18 37 22 31 11 19 16 17 18 28 40 39 33 26 21 45 38 23 40 45 52 26 28 42 34 22 23 20 13 35 15 47 18 26 41 18 10 54 54 33 19 24 30 21 21 27 29 11 28 24 28 11 31 18 14 23 26 22 29 13 6 7 7 25 21 13 12 6 17 12 27 35 35 28 27 34 13 30 10 8 11 21 14 13 13 27 17 36 46 27 29 18 34 25 11 10 9 22 26 31 42 25 17 42 33 10 8 9 33 23 12 7 27 20 13 20 17 28 23 17 17 42 33 30 31 30 13 46 9 15 31 9 10 27 15 8 7 26 24 31 17 24 9 6 24 41 37 13 17 18 33 17 22 23 22 17 9 24 27 33 32 23 8 7 41 19 18 33 21 29 15 6 12 8 13 18 17 18 8 10 24 13 28 10 9 29 25 11 10 8 9 15 32 32 18 21 22 37 44 18 19 7 9 19 29 24 25 23 44 25 19 24 14 6 8 5 5 17 8 5 8 16 31 5 6 7 6 5 13 4 14 7 18 19 33 33 34 31 5 4 11 8 23 32 22 30 10 10 22 6 6 5 9 6 5 16 10 8 7 6 3 3 4 8 7 13 5 4 5 4 20 28 21 19 24 9 15 20 10 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_9922443_9923469
seq2: B6Ng01-191I18.b_33_1073 (reverse)

seq1  AGTAACTTTGTAAAATGCAGTTCCCTCC-TCCTGT-GGCGTATGGGGATC  48
      |||||||||| ||||||||||||||||| |||||| |||||| ||| |||
seq2  AGTAACTTTGAAAAATGCAGTTCCCTCCATCCTGTGGGCGTAAGGGAATC  50

seq1  AAACTCA--GGCTGTCAGGCTTGACAACAGTGTCTTTACTCACTGAGTCA  96
      |||||||  ||||||||||||||||||||| |||||||||   |||||||
seq2  AAACTCAAGGGCTGTCAGGCTTGACAACAGGGTCTTTACTTCATGAGTCA  100

seq1  CCT-CACCAGCCCAGTTCTTAATTTAATAGAAGTCTACTTTGGCA-TTAT  144
      ||| | |||||||||||||||| ||||||||||||||||| |||| ||||
seq2  CCTCCCCCAGCCCAGTTCTTAA-TTAATAGAAGTCTACTTGGGCATTTAT  149

seq1  TTTTTTCTTCTTCT-AGAATTTTATCTAGTTCACT-TTTTG-TTTGTTTT  191
      |||||||||||||| |||||||||||||||||||| ||||| ||||||||
seq2  TTTTTTCTTCTTCTAAGAATTTTATCTAGTTCACTATTTTGATTTGTTTT  199

seq1  TTGTTTTTGTTTTTTG-AGACAAGG-TTTCTTGTAGCCCAGGCTGCTTGG  239
      |||||||||||||||| |||||||| ||||||||||||||||||||||||
seq2  TTGTTTTTGTTTTTTGAAGACAAGGTTTTCTTGTAGCCCAGGCTGCTTGG  249

seq1  A-CCTCACTATGGTTGCCAAG-AATAGTCTTGAACCTTCTGCTTTGTTGT  287
      | ||||||||||||||||||| |||||||||||||||||||||| |||||
seq2  ACCCTCACTATGGTTGCCAAGAAATAGTCTTGAACCTTCTGCTTAGTTGT  299

seq1  TGTTGTTTGTTTTTGTTTTTTT--GTTTTTGTTTTTTCCAGACAGGGTTT  335
       |||||||||||||||||||||   |||||||||||||||||||||||||
seq2  AGTTGTTTGTTTTTGTTTTTTTTGTTTTTTGTTTTTTCCAGACAGGGTTT  349

seq1  CTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGC  385
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGC  399

seq1  CTTGAACTCAAGAGATCGTCCTGCCTCTGCCTCCCAAGTGCTGGGATTAA  435
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAACTCAAGAGATCGTCCTGCCTCTGCCTCCCAAGTGCTGGGATTAA  449

seq1  AGGCGTGCACCACCACTCCACTGCCCAGCTCATTTATTTATTTTATGTAT  485
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCGTGCACCACCACTCCACTGCCCAGCTCATTTATTTATTTTATGTAT  499

seq1  GTGAGGACTCTGTAGCTGTCTTCAGATAAACCAAAAGAGGGCATCGGATC  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGGACTCTGTAGCTGTCTTCAGATAAACCAAAAGAGGGCATCGGATC  549

seq1  CCATTATAGATGGTTGTGAGCCAATCTGTGGTTGCTGGGAATCGAACTCA  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTATAGATGGTTGTGAGCCAATCTGTGGTTGCTGGGAATCGAACTCA  599

seq1  GGACGTCTTGGGGAACAACCAGTGCTCTTAACTGCTGAGCCATCTCTCTA  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACGTCTTGGGGAACAACCAGTGCTCTTAACTGCTGAGCCATCTCTCTA  649

seq1  GTCTGATTCTAACTTTCAAGTGCTAAGATTACAGGTATTTGCTACTTATG  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGATTCTAACTTTCAAGTGCTAAGATTACAGGTATTTGCTACTTATG  699

seq1  CTCAGCTGGTATTCTTTCACATAAGCTTGCTTCCAGATTTTTAATACTGT  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGCTGGTATTCTTTCACATAAGCTTGCTTCCAGATTTTTAATACTGT  749

seq1  AAGTACATTGTATAGAAAAAATAACACTATGTAAAGAAACGTTCATATCC  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTACATTGTATAGAAAAAATAACACTATGTAAAGAAACGTTCATATCC  799

seq1  AAATGTTAAGCTTATTTCTTCTACTACCATCTAAATATCCATAGCCTTAA  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTTAAGCTTATTTCTTCTACTACCATCTAAATATCCATAGCCTTAA  849

seq1  AAAGATCAATATATTTAGAAAGAATATTTGTATAGAAAATTAAGCTTGCC  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATCAATATATTTAGAAAGAATATTTGTATAGAAAATTAAGCTTGCC  899

seq1  ATGTGAGTATAGTTATTTACATCATGACTTCAATTTTTTTTAAAGTAGTC  935
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGAGTATAGTTATTTACATCATGACTTCAATTTTTTTTAAAGTAGTC  949

seq1  TGTTATTCAAAAGAAAAACAAGACACATAAAACATTTAGGGCAACTTAAA  985
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTATTCAAAAGAAAAACAAGACACATAAAACATTTAGGGCAACTTAAA  999

seq1  TGCTGAGCTGAGTATTGCTGTCTCTAAATATATATGGAATTC  1027
      ||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGAGCTGAGTATTGCTGTCTCTAAATATATATGGAATTC  1041

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information