MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-210N22
Chromosome	1 (Build37)
Map Location	194,048,799 - 194,198,438
singlet/doublet	doublet
Overlap gene	Kcnh1
Upstream gene	Nenf, 2310028N02Rik, Ppp2r5a, LOC100039501, LOC667044, Dtl, Ints7, Lpgat1, Nek2, 4930557M11Rik, Slc30a1, 3322402L07Rik, LOC100042611, Traf5, Traf5, LOC100042625, Rcor3
Downstream gene	Hhat, A730013G03Rik, Sertad4, LOC100039677, Syt14, AA408296, Irf6, A130010J15Rik, Traf3ip3, Hsd11b1, G0s2, Lamb3, Camk1g
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nenf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66208 MGI:1913458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310028N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66950 MGI:1914200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226849 MGI:2388479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039501 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dtl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76843 MGI:1924093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77065 MGI:1924315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lpgat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226856 MGI:2446186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18005 MGI:109359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930557M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98736 MGI:2138631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Slc30a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22782 MGI:1345281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3322402L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74023 MGI:1921273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs, 3 Proteins pseudo : _no_value

name	Traf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22033 MGI:107548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22033 MGI:107548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 184 ESTs, 11 Proteins

name	Rcor3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214742 MGI:2441920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16510 MGI:1341721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hhat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226861 MGI:2444681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730013G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320952 MGI:2445118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	Sertad4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214791 MGI:2443496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039677 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 6 Proteins pseudo : _no_value

name	Syt14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329324 MGI:2444490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA408296 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215193 MGI:2138080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54139 MGI:1859211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130010J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319266 MGI:2441776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf3ip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215243 MGI:2441706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd11b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15483 MGI:103562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	G0s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14373 MGI:1316737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lamb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16780 MGI:99915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215303 MGI:2388073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nenf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377999 GeneID:66208 MGI:1913458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron derived neurotrophic factor transcript_id : NM_025424.2

name	2310028N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802089 GeneID:66950 MGI:1914200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310028N02 gene transcript_id : NM_025864.3

name	Ppp2r5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130061 GeneID:226849 MGI:2388479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), alpha isoform transcript_id : NM_144880.4

name	Dtl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061464 GeneID:76843 MGI:1924093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : denticleless homolog (Drosophila) transcript_id : NM_029766.2

name	Ints7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328518 GeneID:77065 MGI:1924315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 7 transcript_id : NM_178632.4

name	Lpgat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130036 GeneID:226856 MGI:2446186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysophosphatidylglycerol acyltransferase 1 transcript_id : NM_172266.2

name	Nek2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371063 GeneID:18005 MGI:109359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 2 transcript_id : NM_010892.2

name	4930557M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149247253 GeneID:98736 MGI:2138631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930557M11 gene transcript_id : XM_001478622.1

name	Slc30a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490410 GeneID:22782 MGI:1345281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 30 (zinc transporter), member 1 transcript_id : NM_009579.3

name	3322402L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359478 GeneID:74023 MGI:1921273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3322402L07 gene transcript_id : NM_023727.2

name	Traf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755866 GeneID:22033 MGI:107548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 5 transcript_id : NM_011633.1

name	Traf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755866 GeneID:22033 MGI:107548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 5 transcript_id : NM_011633.1

name	LOC100042625 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149247502 GeneID:100042625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 184 ESTs, 11 Proteins product : similar to glutathione S-transferase pi class A transcript_id : XM_001478655.1

name	Rcor3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57634522 GeneID:214742 MGI:2441920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REST corepressor 3 transcript_id : NM_144814.2

name	Kcnh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370338 GeneID:16510 MGI:1341721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 1 transcript_id : NM_010600.2

name	Kcnh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370249 GeneID:16510 MGI:1341721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 1 transcript_id : NM_001038607.1

name	Hhat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802754 GeneID:226861 MGI:2444681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hedgehog acyltransferase transcript_id : NM_144881.3

name	Sertad4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016191 GeneID:214791 MGI:2443496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SERTA domain containing 4 transcript_id : NM_198247.1

name	Syt14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581544 GeneID:329324 MGI:2444490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin XIV transcript_id : NM_181546.2

name	AA408296 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56790941 GeneID:215193 MGI:2138080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA408296 transcript_id : NM_145415.2

name	Irf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145466 GeneID:54139 MGI:1859211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 6 transcript_id : NM_016851.2

name	A130010J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328434 GeneID:319266 MGI:2441776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130010J15 gene transcript_id : NM_181048.2

name	Traf3ip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347101 GeneID:215243 MGI:2441706
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRAF3 interacting protein 3 transcript_id : NM_153137.3

name	Hsd11b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680740 GeneID:15483 MGI:103562
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid 11-beta dehydrogenase 1 transcript_id : NM_008288.2

name	Hsd11b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680660 GeneID:15483 MGI:103562
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid 11-beta dehydrogenase 1 transcript_id : NM_001044751.1

name	G0s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372632 GeneID:14373 MGI:1316737
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G0/G1 switch gene 2 transcript_id : NM_008059.2

name	Lamb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865980 GeneID:16780 MGI:99915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : laminin, beta 3 transcript_id : NM_008484.2

name	Camk1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110041 GeneID:215303 MGI:2388073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase I gamma transcript_id : NM_144817.2

name	Nenf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384818 CCDS:CCDS15618.1 GeneID:66208 MGI:1913458
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] GO_process : GO:0043410 - positive regulation of MAPKKK cascade [Evidence IDA] codon_start : 1 note : neudesin; Spinal cord injury related protein 10; secreted protein of unknown function product : SCIRP10-related protein protein_id : NP_079700.1

name	2310028N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385348 CCDS:CCDS15619.1 GeneID:66950 MGI:1914200
definition	codon_start : 1 product : hypothetical protein LOC66950 protein_id : NP_080140.1

name	Ppp2r5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059051 CCDS:CCDS15620.1 GeneID:226849 MGI:2388479
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2, regulatory subunit B (B56), alpha isoform protein_id : NP_659129.2

name	Dtl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982955 CCDS:CCDS15621.1 GeneID:76843 MGI:1924093
definition	codon_start : 1 note : retinoic-acid regulated nuclear matrix-associated protein; Meth A ramp product : denticleless homolog protein_id : NP_084042.1

name	Ints7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328519 GeneID:77065 MGI:1924315
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : integrator complex subunit 7 protein_id : NP_848747.3

name	Lpgat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986567 CCDS:CCDS15622.1 GeneID:226856 MGI:2446186
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : lysophosphatidylglycerol acyltransferase 1 protein_id : NP_758470.1

name	Nek2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754818 CCDS:CCDS15623.1 GeneID:18005 MGI:109359
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0030496 - midbody [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000922 - spindle pole [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007126 - meiosis [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000070 - mitotic sister chromatid segregation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : NIMA - related expressed kinase 2; NIMA-related expressed kinase 2 product : NIMA (never in mitosis gene a)-related expressed kinase 2 protein_id : NP_035022.1

name	4930557M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149247254 GeneID:98736 MGI:2138631
definition	codon_start : 1 product : hypothetical protein LOC98736 protein_id : XP_001478672.1

name	Slc30a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678017 CCDS:CCDS15625.1 GeneID:22782 MGI:1345281
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence ISS] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0009935 - nutrient import [Evidence IMP]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence IMP]; GO:0006829 - zinc ion transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : zinc transporter 1 product : solute carrier family 30 (zinc transporter), member 1 protein_id : NP_033605.1

name	3322402L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794152 CCDS:CCDS15626.1 GeneID:74023 MGI:1921273
definition	codon_start : 1 product : hypothetical protein LOC74023 protein_id : NP_076216.1

name	Traf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755867 GeneID:22033 MGI:107548
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy function : an activator of NF-kappaB and putative signal transducer for the lymphotoxin beta receptor product : Tnf receptor-associated factor 5 protein_id : NP_035763.1

name	Traf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755867 GeneID:22033 MGI:107548
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy function : an activator of NF-kappaB and putative signal transducer for the lymphotoxin beta receptor product : Tnf receptor-associated factor 5 protein_id : NP_035763.1

name	LOC100042625 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149247503 GeneID:100042625
definition	codon_start : 1 product : similar to glutathione S-transferase pi class A protein_id : XP_001478705.1

name	Rcor3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57634523 GeneID:214742 MGI:2441920
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : REST corepressor 3 protein_id : NP_659063.2

name	Kcnh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754422 CCDS:CCDS15627.1 GeneID:16510 MGI:1341721
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ether-a-go-go; ether a go-go; potassium voltage-gated channel, subfamily H, member 1 product : potassium voltage-gated channel, subfamily H, member 1 isoform 1 protein_id : NP_034730.1

name	Kcnh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370250 GeneID:16510 MGI:1341721
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : potassium voltage-gated channel, subfamily H (eag-related), member 1 (MGD\|MGI:1341721 GB\|NM_010600, evidence: BLASTN, 99%, match=2867); putative; isoform 2 is encoded by transcript variant 2; ether-a-go-go; ether a go-go; potassium voltage-gated channel, subfamily H, member 1 product : potassium voltage-gated channel, subfamily H, member 1 isoform 2 protein_id : NP_001033696.1

name	Hhat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559954 CCDS:CCDS15628.1 GeneID:226861 MGI:2444681
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0018345 - protein palmitoylation [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IMP] codon_start : 1 product : hedgehog acyltransferase protein_id : NP_659130.2

name	Sertad4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016192 CCDS:CCDS15630.1 GeneID:214791 MGI:2443496
definition	codon_start : 1 product : SERTA domain containing 4 protein_id : NP_937890.1

name	Syt14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559805 GeneID:329324 MGI:2444490
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA] codon_start : 1 product : synaptotagmin XIV protein_id : NP_853524.1

name	AA408296 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56790942 CCDS:CCDS15631.1 GeneID:215193 MGI:2138080
definition	codon_start : 1 product : digestive-organ expansion factor homolog protein_id : NP_663390.2

name	Irf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145467 CCDS:CCDS15632.1 GeneID:54139 MGI:1859211
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon regulatory factor 6 protein_id : NP_058547.2

name	A130010J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794524 CCDS:CCDS15633.1 GeneID:319266 MGI:2441776
definition	codon_start : 1 product : hypothetical protein LOC319266 protein_id : NP_851391.1

name	Traf3ip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981967 CCDS:CCDS15634.1 GeneID:215243 MGI:2441706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRAF3-interacting Jun N-terminal kinase (JNK)-activating modulator product : TRAF3-interacting JNK-activating modulator protein_id : NP_694777.2

name	Hsd11b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680661 GeneID:15483 MGI:103562
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0003845 - 11-beta-hydroxysteroid dehydrogenase activity [Evidence IDA] [Evidence IMP]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : 11beta-HSD-1; 11beta-hydroxysteroid dehydrogenase type 1 product : hydroxysteroid 11-beta dehydrogenase 1 protein_id : NP_001038216.1

name	Hsd11b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680741 CCDS:CCDS15635.1 GeneID:15483 MGI:103562
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0003845 - 11-beta-hydroxysteroid dehydrogenase activity [Evidence IDA] [Evidence IMP]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : 11beta-HSD-1; 11beta-hydroxysteroid dehydrogenase type 1 product : hydroxysteroid 11-beta dehydrogenase 1 protein_id : NP_032314.2

name	G0s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679889 CCDS:CCDS15636.1 GeneID:14373 MGI:1316737
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 product : G0/G1 switch gene 2 protein_id : NP_032085.1

name	Lamb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865981 CCDS:CCDS15637.1 GeneID:16780 MGI:99915
definition	GO_component : GO:0005605 - basal lamina [Evidence IEA]; GO:0005604 - basement membrane [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : nicein, 125kD; nicein, 125kDa product : laminin, beta 3 protein_id : NP_032510.2

name	Camk1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450191 CCDS:CCDS15638.1 GeneID:215303 MGI:2388073
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence IDA]; GO:0012505 - endomembrane system [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence IDA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : CLICK III product : calcium/calmodulin-dependent protein kinase I gamma protein_id : NP_659066.1

name	LOC100039501 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039501
definition	number : 1 pseudo : _no_value

name	LOC667044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667044
definition	number : 1 pseudo : _no_value

name	LOC667044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667044
definition	number : 2 pseudo : _no_value

name	LOC667044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667044
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:161818
definition	standard_name : RH124996

name	(CDS detail)
type	STS
link
xref	UniSTS:165135
definition	standard_name : AI118576

name	(CDS detail)
type	STS
link
xref	UniSTS:267867
definition	standard_name : MARC_15687-15688:1013522980:1

name	(CDS detail)
type	STS
link
xref	UniSTS:128645
definition	standard_name : D1Mit292

name	(CDS detail)
type	STS
link
xref	UniSTS:39544
definition	standard_name : SHGC-57254

name	(CDS detail)
type	STS
link
xref	UniSTS:128549
definition	standard_name : D1Mit209

name	(CDS detail)
type	STS
link
xref	UniSTS:210031
definition	standard_name : RH136036

name	(CDS detail)
type	STS
link
xref	UniSTS:234312
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122666
definition	standard_name : 01.MMHAP64FLA1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178552
definition	standard_name : AI649174

name	(CDS detail)
type	STS
link
xref	UniSTS:178553
definition	standard_name : AW112037

name	(CDS detail)
type	STS
link
xref	UniSTS:207274
definition	standard_name : BE688013

name	(CDS detail)
type	STS
link
xref	UniSTS:465400
definition	standard_name : Nek2

name	(CDS detail)
type	STS
link
xref	UniSTS:161346
definition	standard_name : RH124524

name	(CDS detail)
type	STS
link
xref	UniSTS:178554
definition	standard_name : AF007247

name	(CDS detail)
type	STS
link
xref	UniSTS:162802
definition	standard_name : RH126090

name	(CDS detail)
type	STS
link
xref	UniSTS:185462
definition	standard_name : BB016121

name	(CDS detail)
type	STS
link
xref	UniSTS:246020
definition	standard_name : AI029423

name	(CDS detail)
type	STS
link
xref	UniSTS:165136
definition	standard_name : AI839647

name	(CDS detail)
type	STS
link
xref	UniSTS:234313
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:215060
definition	standard_name : RH131777

name	(CDS detail)
type	STS
link
xref	UniSTS:207272
definition	standard_name : BB278993

name	(CDS detail)
type	STS
link
xref	UniSTS:161456
definition	standard_name : RH124634

name	(CDS detail)
type	STS
link
xref	UniSTS:163273
definition	standard_name : D78141

name	(CDS detail)
type	STS
link
xref	UniSTS:128834
definition	standard_name : D1Mit463

name	(CDS detail)
type	STS
link
xref	UniSTS:243478
definition	standard_name : BI283102

name	(CDS detail)
type	STS
link
xref	UniSTS:273095
definition	standard_name : PMC31882P1

name	(CDS detail)
type	STS
link
xref	UniSTS:128882
definition	standard_name : D1Mit511

name	(CDS detail)
type	STS
link
xref	UniSTS:128881
definition	standard_name : D1Mit510

name	(CDS detail)
type	STS
link
xref	UniSTS:125644
definition	standard_name : U04294

name	(CDS detail)
type	STS
link
xref	UniSTS:158908
definition	standard_name : U04294

name	(CDS detail)
type	STS
link
xref	UniSTS:143657
definition	standard_name : Kcnh1

name	(CDS detail)
type	STS
link
xref	UniSTS:234315
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234314
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128552
definition	standard_name : D1Mit210

name	(CDS detail)
type	STS
link
xref	UniSTS:164143
definition	standard_name : AI851948

name	(CDS detail)
type	STS
link
xref	UniSTS:215751
definition	standard_name : RH132468

name	(CDS detail)
type	STS
link
xref	UniSTS:128646
definition	standard_name : D1Mit293

name	(CDS detail)
type	STS
link
xref	UniSTS:123324
definition	standard_name : 16.MMHAP90FRF7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:162538
definition	standard_name : RH125792

name	(CDS detail)
type	STS
link
xref	UniSTS:165138
definition	standard_name : AW045375

name	(CDS detail)
type	STS
link
xref	UniSTS:178557
definition	standard_name : AI876454

name	(CDS detail)
type	STS
link
xref	UniSTS:207275
definition	standard_name : BE196897

name	(CDS detail)
type	STS
link
xref	UniSTS:165137
definition	standard_name : AI115021

name	(CDS detail)
type	STS
link
xref	UniSTS:125871
definition	standard_name : X83202

name	(CDS detail)
type	STS
link
xref	UniSTS:178555
definition	standard_name : X83202

name	(CDS detail)
type	STS
link
xref	UniSTS:128883
definition	standard_name : D1Mit512

name	(CDS detail)
type	STS
link
xref	UniSTS:178556
definition	standard_name : AV006465

name	(CDS detail)
type	STS
link
xref	UniSTS:492227
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210014
definition	standard_name : RH136018

name	(CDS detail)
type	STS
link
xref	UniSTS:143753
definition	standard_name : Lamb3

name	(CDS detail)
type	STS
link
xref	UniSTS:125748
definition	standard_name : U43298

name	(CDS detail)
type	STS
link
xref	UniSTS:143754
definition	standard_name : Lamb3

name	LOC100042611 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149247255 GeneID:100042611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs, 3 Proteins product : similar to Cks1 protein homologue pseudo : _no_value transcript_id : XR_033810.1

name	A730013G03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149247504 GeneID:320952 MGI:2445118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : RIKEN cDNA A730013G03 gene transcript_id : XR_035377.1

name	LOC100039677 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149247497 GeneID:100039677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 6 Proteins product : similar to hCG1789691 pseudo : _no_value transcript_id : XR_031150.1

clone name	MSMg01-266M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-210N22.b	B6Ng01-210N22.g
ACC	GA029093	GA029094
length	823	1,071
definition	B6Ng01-210N22.b	B6Ng01-210N22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(194,048,799 - 194,049,617)	(194,197,367 - 194,198,438)
sequence	gaattccttcgaaattctgatgtacaagaagaacagtgagtatccgaggc tcagagcccagtttcatgtgtgtagagggtgaggtattacttccacttct gtgactgtttggttttgattctttcccctcatctagttactagaagccat tgtgtgtcactaaccaattaagacttcatctatttttctctcaagagtta gtcttgtccctcttggttcatttatgaattgctcctgggaggcaccaggg gagaggcaggagaagccctgtcctgtctgtcttaggttctacctcccata acttctagctcagtgagagactcttccaggtgcccagctaagagtctgtg agtaacggtctcatgatgacccaaggagacagtattaactgcgtggcatt atatattttcgcattggtcttggccacagttacttctaccaagtatacaa taaagtttgtagccatgcccaagtatagaccttgtcttcctcttaggtgg cttcttgctgaacagaggtgagctgtcctaagaagtgaggaagtagagtg atgtcaacctctggtctgtctccacacccatgtacacctgcactcacaca tgcacatgatgcaaacatgtgttcacacatgcatatcacacacacagcca atgaagaatcctgctttttataatagtagaattgatcgacaggttgttgg ttcaactaaacatgtctggagtggcccagatggggcatgagggtgtgtgt ctatttgggtggtgttctgggctcattgaattgacagcttgctttgagaa tgcacatgctgctttcatctcaa	gaattccatacttaggatctagcacttaggaggaagagcagccagcatag gctatgtgtgaggctgtctttaagacaaacggatttcaaaggtaggagca gccaggtgtctctgcaggacaagacacttgatgtcaaacctggtgacatg catttgacttctggggcaagttgtcctctggcctcacagggcaccgccat atgtgtgctctcctcacccacaaaacaaacagatgtagaacactttcttt ttgattataagaaggtggaaccaggtggagttaggggcacaaaataggac gtgaaaaggatcggattatatcgcatgaagttctcagagaactaataaaa atactatattaaaaaagtacaagtgtagtgaagaaagtggatcccatccc ccacaaacttgttaattaaccagagttcactgatcctcaacttcttatga tacacatgataaaaatcaatactttctagaagattaaagttttaaataaa attcaaatgtttcacctgacaaaatgtgtatggaaaatttatggagaaaa ttatcaagccttcatcataggaattttaaatttttggaataaatcgttaa gtataataacaccattattaagacattaatttttcctgatttactactgc attcaaatggattccaagaaaattcccccgaggctctagggcacttggac taattttaaaattcaacacatggataacagtatatgaactactggcagga gagctgacttaccaattagagcagagttggggacccagagacacagtggt agaagaggagctcaagttaaagtgcttctggaaaagcttttttggatatt tttagtgtagcacacccaaaataaaaactactccttgtctgtctccccat aacccccaccgaccaatttctgactcccactggggctggtgccactcttg ggtttccggctgttaaacagaaatacgtttttttgccacttttctacaag ttcagtctggctgtgcggctttatgaatgctctgacaaatgcctgcagtc aatttataagaatggagggtg
quality values	Open. Hide. 58 22 22 26 58 49 41 36 58 58 47 49 58 62 62 62 62 47 47 47 41 49 62 56 56 43 47 62 62 62 62 20 11 16 7 9 11 14 19 13 13 22 16 13 18 13 50 62 62 62 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 56 46 50 46 34 32 30 28 48 30 46 28 30 48 49 59 62 62 59 62 62 62 62 62 62 62 62 59 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 50 38 32 32 28 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 51 62 47 56 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 56 62 62 34 62 62 62 62 47 32 62 54 41 41 62 62 62 62 62 54 47 62 48 62 54 62 52 52 54 54 62 52 62 62 62 62 54 62 62 62 62 43 62 62 62 47 62 62 52 52 52 54 54 39 47 53 58 54 58 58 54 32 48 49 58 58 52 54 54 58 54 54 58 54 52 54 54 45 54 58 54 52 52 54 54 52 33 54 58 45 52 52 51 58 48 46 54 46 54 54 54 54 58 37 52 54 58 40 48 54 58 58 45 26 58 34 41 54 58 48 58 46 58 58 58 58 40 52 40 35 58 50 42 42 50 46 32 58 25 50 51 51 50 40 46 42 58 52 50 30 47 25 32 50 41 37 51 45 40 47 18 14 50 40 40 9 50 18 35 37 50 49 36 54 50 58 58 54 24 39 58 21 16 58 28 31 15 41 29 51 44 42 51 46 53 46 52 49 32 58 42 35 50 40 42 37 35 31 46 53 35 12 58 6 16 35 33 39 53 50 36 32 19 54 50 28 37 39 23 8 18 13 13 10 18 32 30 16 24 32 17 11 16 16 21 27 27 36 37 24 18 30 28 19 8 11 6 13 6 7 6 9 13 6 13 13 12 10 9 10 9 9 15 10 21 35 9 13 13 15 10	Open. Hide. 62 38 40 39 62 62 47 24 62 62 62 24 16 12 10 18 12 18 25 25 21 25 19 23 24 34 39 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 36 48 34 32 31 30 54 40 38 54 46 48 48 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 59 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 54 58 58 58 54 46 58 58 58 54 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 51 58 54 54 58 58 58 58 58 58 58 58 58 54 58 58 54 54 54 54 58 54 58 58 54 54 52 58 58 52 54 58 41 49 58 58 49 58 58 58 58 58 58 54 58 58 58 58 58 41 58 34 50 51 58 58 51 58 45 38 42 46 58 51 51 53 53 52 58 51 58 51 58 32 51 39 47 58 58 53 49 37 49 58 53 58 50 50 58 58 58 58 58 58 58 58 58 51 58 52 58 58 40 58 41 49 51 52 53 53 53 58 53 53 51 50 47 37 58 50 50 58 49 51 31 38 52 53 26 51 50 54 58 58 40 40 51 40 44 19 15 44 40 53 30 58 40 51 39 53 38 19 50 51 34 49 42 54 34 39 49 38 37 53 52 33 34 54 49 53 32 54 54 41 46 53 45 32 53 53 41 50 42 42 54 49 17 29 38 54 39 35 40 37 53 52 32 40 33 31 28 40 42 37 36 33 53 54 37 42 24 54 37 23 45 27 33 45 47 27 19 53 53 28 21 18 14 52 53 42 32 25 52 35 32 37 33 32 16 17 33 31 52 51 46 29 16 41 30 30 20 27 7 14 15 24 45 28 27 11 16 22 13 22 23 51 42 30 51 18 31 51 20 31 38 32 26 42 38 38 29 33 46 33 32 19 41 12 7 13 25 33 27 41 33 46 46 46 24 36 31 46 46 46 46 22 15 31 12 6 6 9 31 48 46 7 22 18 25 41 30 28 13 32 25 31 23 14 38 12 6 22 46 34 34 30 38 41 39 30 24 31 32 33 31 22 21 22 24 38 23 26 7 12 27 31 31 35 44 44 31 24 22 17 20 32 48 44 48 31 30 21 17 31 37 24 34 14 30 20 39 16 27 15 31 10 12 33 20 37 16 19 32 13 26 48 48 33 22 29 30 20 6 4 4 9 32 15 14 12 12 14 21 39 20 10 19 16 10 10 20 17 18 21 10 5 12 15 32 27 14 14 20 38 38 24 24 28 19 6 18 40 40 40 47 34 17 11 19 20 7 6 19 28 25 6 17 4 20 15 8 5 4 8 21 20 27 5 3 16 7 20 21 9 6 4 3 3 5 3 14 11 18 28 6 4 9 17 11 14 8 18 13 14 15 8 9 6 4 13 28 22 5 22 7 22 10 3 1 3 17 10 16 10 4 17 26 14 11 6 14 6 10 3 9 5 6 6 16 8 27 11 1 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_194048799_194049617
seq2: B6Ng01-210N22.b_45_867

seq1  GAATTCCTTCGAAATTCTGATGTACAAGAAGAACAGTGAGTATCCGAGGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTCGAAATTCTGATGTACAAGAAGAACAGTGAGTATCCGAGGC  50

seq1  TCAGAGCCCAGTTTCATGTGTGTAGAGGGTGAGGTATTACTTCCACTTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAGCCCAGTTTCATGTGTGTAGAGGGTGAGGTATTACTTCCACTTCT  100

seq1  GTGACTGTTTGGTTTTGATTCTTTCCCCTCATCTAGTTACTAGAAGCCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACTGTTTGGTTTTGATTCTTTCCCCTCATCTAGTTACTAGAAGCCAT  150

seq1  TGTGTGTCACTAACCAATTAAGACTTCATCTATTTTTCTCTCAAGAGTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTCACTAACCAATTAAGACTTCATCTATTTTTCTCTCAAGAGTTA  200

seq1  GTCTTGTCCCTCTTGGTTCATTTATGAATTGCTCCTGGGAGGCACCAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTGTCCCTCTTGGTTCATTTATGAATTGCTCCTGGGAGGCACCAGGG  250

seq1  GAGAGGCAGGAGAAGCCCTGTCCTGTCTGTCTTAGGTTCTACCTCCCATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGGCAGGAGAAGCCCTGTCCTGTCTGTCTTAGGTTCTACCTCCCATA  300

seq1  ACTTCTAGCTCAGTGAGAGACTCTTCCAGGTGCCCAGCTAAGAGTCTGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCTAGCTCAGTGAGAGACTCTTCCAGGTGCCCAGCTAAGAGTCTGTG  350

seq1  AGTAACGGTCTCATGATGACCCAAGGAGACAGTATTAACTGCGTGGCATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAACGGTCTCATGATGACCCAAGGAGACAGTATTAACTGCGTGGCATT  400

seq1  ATATATTTTCGCATTGGTCTTGGCCACAGTTACTTCTACCAAGTATACAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATTTTCGCATTGGTCTTGGCCACAGTTACTTCTACCAAGTATACAA  450

seq1  TAAAGTTTGTAGCCATGCCCAAGTATAGACCTTGTCTTCCTCTTAGGTGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGTTTGTAGCCATGCCCAAGTATAGACCTTGTCTTCCTCTTAGGTGG  500

seq1  CTTCTTGCTGAACAGAGGTGAGCTGTCCTAAGAAGTGAGGAAGTAGAGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTGCTGAACAGAGGTGAGCTGTCCTAAGAAGTGAGGAAGTAGAGTG  550

seq1  ATGTCAACCTCTGGTCTGTCTCCACACCCATGTACACCTGCACTCACACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCAACCTCTGGTCTGTCTCCACACCCATGTACACCTGCACTCACACA  600

seq1  TGCACATGATGCAAACATGTGTTCACACATGCATATCACACACACAGCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACATGATGCAAACATGTGTTCACACATGCATATCACACACACAGCCA  650

seq1  ATGAAGAATCCTGCTTTTTATAATAGTAGAATTGATCGACAGGTTGTTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGAATCCTGCTTTTTATAATAGTAGAATTGATCGACAGGTTGTTGG  700

seq1  TTCAACT-AACATGTCTGGAGTGGCCCAGATGGGGCATGAGGGTGTGTGT  749
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAACTAAACATGTCTGGAGTGGCCCAGATGGGGCATGAGGGTGTGTGT  750

seq1  CTA-TTGGGTGGTGTTCTGGGCTCAGTG-ATTGACAGCTTGC-TTGGGAA  796
      ||| ||||||||||||||||||||| || ||||||||||||| ||| |||
seq2  CTATTTGGGTGGTGTTCTGGGCTCATTGAATTGACAGCTTGCTTTGAGAA  800

seq1  AGCACATGCTGCGTTCATCTCAA  819
       ||||||||||| ||||||||||
seq2  TGCACATGCTGCTTTCATCTCAA  823

seq1: chr1_194197367_194198438
seq2: B6Ng01-210N22.g_67_1137 (reverse)

seq1  CACCCTCATTCCTTATAAATTGACCTCCAGGCATTTTGTCAGAGCA-TCA  49
      |||||||  | |||||||||||| || |||||| |||||||||||| |||
seq2  CACCCTCCATTCTTATAAATTGA-CTGCAGGCA-TTTGTCAGAGCATTCA  48

seq1  TAAAGCCGGCACAGCCAGAACTGAAC-TGTAGGAAAGTGGGCAAAAAACG  98
      ||||||| |||||||||| ||||||| ||||| |||||||  ||||||||
seq2  TAAAGCC-GCACAGCCAG-ACTGAACTTGTAGAAAAGTGGCAAAAAAACG  96

seq1  TATTTCTGTTTAAACAGCC-GAAACCCAAGAGTGGCCACCAGCCCCAGTG  147
      ||||||||||| ||||||| ||||||||||||||| ||||||||||||| 
seq2  TATTTCTGTTT-AACAGCCGGAAACCCAAGAGTGG-CACCAGCCCCAGT-  143

seq1  GGGAGTCAG-AATTGGTCGGTGGGGGTTATGGGGAGACAGACAAGGAGTA  196
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGTCAGAAATTGGTCGGTGGGGGTTATGGGGAGACAGACAAGGAGTA  193

seq1  GTTTTTATTTTGGGTGTGCTACACTTAAAATATCC-AAAAAGCTTTTCCA  245
      ||||||||||||||||||||||||| ||||||||| ||||||||||||||
seq2  GTTTTTATTTTGGGTGTGCTACACTAAAAATATCCAAAAAAGCTTTTCCA  243

seq1  G-AGCACTTTAACTTGAGCTCCTCTTCTACCACTGTGTCTCTGGGTCCCC  294
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCACTTTAACTTGAGCTCCTCTTCTACCACTGTGTCTCTGGGTCCCC  293

seq1  AACTCTGCTCTAATTGGTAAGTCAGCTCTCCTGCCAGTAGTTCATATACT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCTGCTCTAATTGGTAAGTCAGCTCTCCTGCCAGTAGTTCATATACT  343

seq1  GTTATCCATGTGTTGAATTTTAAAATTAGTCCAAGTGCCCTAGAGCCTCG  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATCCATGTGTTGAATTTTAAAATTAGTCCAAGTGCCCTAGAGCCTCG  393

seq1  GGGGAATTTTCTTGGAATCCATTTGAATGCAGTAGTAAATCAGGAAAAAT  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAATTTTCTTGGAATCCATTTGAATGCAGTAGTAAATCAGGAAAAAT  443

seq1  TAATGTCTTAATAATGGTGTTATTATACTTAACGATTTATTCCAAAAATT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGTCTTAATAATGGTGTTATTATACTTAACGATTTATTCCAAAAATT  493

seq1  TAAAATTCCTATGATGAAGGCTTGATAATTTTCTCCATAAATTTTCCATA  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATTCCTATGATGAAGGCTTGATAATTTTCTCCATAAATTTTCCATA  543

seq1  CACATTTTGTCAGGTGAAACATTTGAATTTTATTTAAAACTTTAATCTTC  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATTTTGTCAGGTGAAACATTTGAATTTTATTTAAAACTTTAATCTTC  593

seq1  TAGAAAGTATTGATTTTTATCATGTGTATCATAAGAAGTTGAGGATCAGT  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAAGTATTGATTTTTATCATGTGTATCATAAGAAGTTGAGGATCAGT  643

seq1  GAACTCTGGTTAATTAACAAGTTTGTGGGGGATGGGATCCACTTTCTTCA  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCTGGTTAATTAACAAGTTTGTGGGGGATGGGATCCACTTTCTTCA  693

seq1  CTACACTTGTACTTTTTTAATATAGTATTTTTATTAGTTCTCTGAGAACT  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACACTTGTACTTTTTTAATATAGTATTTTTATTAGTTCTCTGAGAACT  743

seq1  TCATGCGATATAATCCGATCCTTTTCACGTCCTATTTTGTGCCCCTAACT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCGATATAATCCGATCCTTTTCACGTCCTATTTTGTGCCCCTAACT  793

seq1  CCACCTGGTTCCACCTTCTTATAATCAAAAAGAAAGTGTTCTACATCTGT  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCTGGTTCCACCTTCTTATAATCAAAAAGAAAGTGTTCTACATCTGT  843

seq1  TTGTTTTGTGGGTGAGGAGAGCACACATATGGCGGTGCCCTGTGAGGCCA  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTGTGGGTGAGGAGAGCACACATATGGCGGTGCCCTGTGAGGCCA  893

seq1  GAGGACAACTTGCCCCAGAAGTCAAATGCATGTCACCAGGTTTGACATCA  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGACAACTTGCCCCAGAAGTCAAATGCATGTCACCAGGTTTGACATCA  943

seq1  AGTGTCTTGTCCTGCAGAGACACCTGGCTGCTCCTACCTTTGAAATCCGT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTCTTGTCCTGCAGAGACACCTGGCTGCTCCTACCTTTGAAATCCGT  993

seq1  TTGTCTTAAAGACAGCCTCACACATAGCCTATGCTGGCTGCTCTTCCTCC  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCTTAAAGACAGCCTCACACATAGCCTATGCTGGCTGCTCTTCCTCC  1043

seq1  TAAGTGCTAGATCCTAAGTATGGAATTC  1072
      ||||||||||||||||||||||||||||
seq2  TAAGTGCTAGATCCTAAGTATGGAATTC  1071

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information