MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-217C16
Chromosome	1 (Build37)
Map Location	59,666,689 - 59,788,842
singlet/doublet	doublet
Overlap gene	Gm973, Sumo1, LOC100042476, Nol5
Upstream gene	EG667397, Als2cr12, Cflar, LOC100042431, Casp8, EG667419, Trak2, Als2cr2, 4930408G06Rik, EG667447, Als2cr11, Als2cr4, Mpp4, Als2, Als2cr7, Fzd7
Downstream gene	B430105G09Rik, LOC100043007, Bmpr2, Als2cr13, LOC100042496, Ica1l, Wdr12, Carf, Nbeal1, Cyp20a1, Abi2, Raph1, LOC100043027, LOC100042533, Eif4a-ps4
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG667397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667397 MGI:3646346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Als2cr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108812 MGI:1918359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cflar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12633 MGI:1336166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Casp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12370 MGI:1261423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG667419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667419 MGI:3647857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Trak2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70827 MGI:1918077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227154 MGI:2144047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930408G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68179 MGI:1915429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein

name	EG667447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667447 MGI:3644495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Als2cr11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73463 MGI:1920713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381259 MGI:2138365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mpp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227157 MGI:2386681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74018 MGI:1921268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271697 MGI:3583944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 10 Proteins

name	Fzd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14369 MGI:108570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm973 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381260 MGI:2685819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22218 MGI:1197010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Nol5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55989 MGI:1933184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B430105G09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320907 MGI:2445016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs

name	LOC100043007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Bmpr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12168 MGI:1095407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72750 MGI:1920000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs

name	Ica1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70375 MGI:1917625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57750 MGI:1927241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Carf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241066 MGI:2182269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nbeal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269198 MGI:2444343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 58 ESTs, 1 Protein

name	Cyp20a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77951 MGI:1925201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329165 MGI:106913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Raph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77300 MGI:1924550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 153 ESTs, 2 Proteins

name	LOC100043027 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 177 ESTs, 3 Proteins

name	LOC100042533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins

name	Eif4a-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13674 MGI:1195958
definition	note : eukaryotic translation initiation factor 4A, pseudogene 4 pseudo : _no_value

name	Als2cr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129876 GeneID:108812 MGI:1918359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 (human) transcript_id : NM_175370.3

name	Cflar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131887384 GeneID:12633 MGI:1336166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CASP8 and FADD-like apoptosis regulator transcript_id : NM_207653.3

name	Cflar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131889125 GeneID:12633 MGI:1336166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CASP8 and FADD-like apoptosis regulator transcript_id : NM_009805.4

name	Casp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626095 GeneID:12370 MGI:1261423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 8 transcript_id : NM_009812.2

name	Casp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056577 GeneID:12370 MGI:1261423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 8 transcript_id : NM_001080126.1

name	Trak2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254202 GeneID:70827 MGI:1918077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein, kinesin binding 2 transcript_id : NM_172406.2

name	Als2cr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239985 GeneID:227154 MGI:2144047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 (human) transcript_id : NM_172656.5

name	4930408G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233852 GeneID:68179 MGI:1915429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein product : RIKEN cDNA 4930408G06 gene transcript_id : XM_619629.4

name	EG667447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233856 GeneID:667447 MGI:3644495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG667447 transcript_id : XM_990603.2

name	Als2cr11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382477 GeneID:73463 MGI:1920713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (human) transcript_id : NM_175200.3

name	Als2cr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716016 GeneID:381259 MGI:2138365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 transcript_id : NM_001033449.1

name	Als2cr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801956 GeneID:381259 MGI:2138365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 transcript_id : NM_001037812.2

name	Mpp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802601 GeneID:227157 MGI:2386681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) transcript_id : NM_145143.2

name	Als2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366376 GeneID:74018 MGI:1921268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) homolog (human) transcript_id : NM_028717.3

name	Als2cr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363445 GeneID:271697 MGI:3583944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 10 Proteins product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7 transcript_id : XM_990659.1

name	Fzd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254636 GeneID:14369 MGI:108570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frizzled homolog 7 (Drosophila) transcript_id : NM_008057.2

name	Gm973 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244084 GeneID:381260 MGI:2685819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 973, (NCBI) transcript_id : NM_001013771.2

name	Sumo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244086 GeneID:22218 MGI:1197010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMT3 suppressor of mif two 3 homolog 1 (yeast) transcript_id : NM_009460.2

name	Nol5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407049 GeneID:55989 MGI:1933184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 5 transcript_id : NM_018868.2

name	B430105G09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233858 GeneID:320907 MGI:2445016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs product : RIKEN cDNA B430105G09 gene transcript_id : XM_900601.3

name	LOC100043007 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233899 GeneID:100043007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical protein LOC100043007 transcript_id : XM_001479403.1

name	Bmpr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801679 GeneID:12168 MGI:1095407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenic protein receptor, type II (serine/threonine kinase) transcript_id : NM_007561.2

name	Als2cr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368733 GeneID:72750 MGI:1920000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 (human) transcript_id : NM_001037725.2

name	Als2cr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556210 GeneID:72750 MGI:1920000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 (human) transcript_id : NM_001003946.1

name	LOC100042496 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233860 GeneID:100042496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs product : hypothetical protein LOC100042496 transcript_id : XM_001478319.1

name	Ica1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51036621 GeneID:70375 MGI:1917625
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : islet cell autoantigen 1-like transcript_id : NM_027407.2

name	Wdr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328472 GeneID:57750 MGI:1927241
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 12 transcript_id : NM_021312.4

name	Carf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382361 GeneID:241066 MGI:2182269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium response factor transcript_id : NM_139150.2

name	Nbeal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233901 GeneID:269198 MGI:2444343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 58 ESTs, 1 Protein product : neurobeachin like 1 transcript_id : XM_990954.2

name	Cyp20a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367182 GeneID:77951 MGI:1925201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 20, subfamily A, polypeptide 1 transcript_id : NM_030013.2

name	Abi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37693504 GeneID:329165 MGI:106913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 2 transcript_id : NM_198127.1

name	Raph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233903 GeneID:77300 MGI:1924550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 153 ESTs, 2 Proteins product : Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 transcript_id : XM_001479477.1

name	LOC100043027 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233905 GeneID:100043027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 177 ESTs, 3 Proteins product : similar to SEC61 gamma transcript_id : XM_001479482.1

name	LOC100042533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233862 GeneID:100042533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins product : similar to Limb expression 1 homolog (chicken) transcript_id : XM_001478387.1

name	Als2cr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425074 GeneID:108812 MGI:1918359
definition	codon_start : 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 protein_id : NP_780579.1

name	Cflar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559393 CCDS:CCDS14978.1 GeneID:12633 MGI:1336166
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0043154 - negative regulation of caspase activity [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : CASP8 and FADD-like apoptosis regulator isoform 1 protein_id : NP_997536.1

name	Cflar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198303 GeneID:12633 MGI:1336166
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0043154 - negative regulation of caspase activity [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : CASP8 and FADD-like apoptosis regulator isoform 2 protein_id : NP_033935.2

name	Casp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056578 GeneID:12370 MGI:1261423
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030690 - Noc1p-Noc2p complex [Evidence IMP]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IDA] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence IMP]; GO:0001841 - neural tube formation [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : Fas-linked ICE-like protease product : caspase 8 protein_id : NP_001073595.1

name	Casp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859520 CCDS:CCDS14979.1 GeneID:12370 MGI:1261423
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030690 - Noc1p-Noc2p complex [Evidence IMP]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IDA] [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence IMP]; GO:0001841 - neural tube formation [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : Fas-linked ICE-like protease product : caspase 8 protein_id : NP_033942.1

name	Trak2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254203 CCDS:CCDS14980.1 GeneID:70827 MGI:1918077
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 product : trafficking protein, kinesin binding 2 protein_id : NP_765994.2

name	Als2cr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239986 CCDS:CCDS14981.1 GeneID:227154 MGI:2144047
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0000902 - cell morphogenesis [Evidence IDA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence TAS]; GO:0007254 - JNK cascade [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : polyploidy associated protein kinase product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 protein_id : NP_766244.4

name	4930408G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233853 GeneID:68179 MGI:1915429
definition	codon_start : 1 product : hypothetical protein LOC68179 protein_id : XP_619629.4

name	EG667447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233857 GeneID:667447 MGI:3644495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995697.2

name	Als2cr11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424816 CCDS:CCDS14982.1 GeneID:73463 MGI:1920713
definition	codon_start : 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 protein_id : NP_780409.1

name	Als2cr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716017 CCDS:CCDS14983.1 GeneID:381259 MGI:2138365
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 isoform 1 protein_id : NP_001028621.1

name	Als2cr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715982 CCDS:CCDS14984.1 GeneID:381259 MGI:2138365
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 isoform 2 protein_id : NP_001032901.1

name	Mpp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553099 GeneID:227157 MGI:2386681
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : discs large homolog 6; membrane palmitoylated protein 4 product : membrane protein, palmitoylated 4 protein_id : NP_660125.1

name	Als2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505210 GeneID:74018 MGI:1921268
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005769 - early endosome [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS]; GO:0042598 - vesicular fraction [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence ISS]; GO:0005097 - Rab GTPase activator activity [Evidence ISS]; GO:0017137 - Rab GTPase binding [Evidence ISS]; GO:0030675 - Rac GTPase activator activity [Evidence ISS]; GO:0048365 - Rac GTPase binding [Evidence ISS]; GO:0005087 - Ran guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007032 - endosome organization and biogenesis [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP] codon_start : 1 exception : mismatches in translation product : alsin protein_id : NP_082993.1

name	Als2cr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363446 GeneID:271697 MGI:3583944
definition	codon_start : 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7 protein_id : XP_995753.1

name	Fzd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254637 CCDS:CCDS14985.1 GeneID:14369 MGI:108570
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004926 - non-G-protein coupled 7TM receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : frizzled 7 protein_id : NP_032083.2

name	Gm973 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244085 GeneID:381260 MGI:2685819
definition	codon_start : 1 product : hypothetical protein LOC381260 protein_id : NP_001013793.2

name	Sumo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678489 GeneID:22218 MGI:1197010
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0016605 - PML body [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019949 - SUMO conjugating enzyme activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin-like 1; SUMO-1 related peptidase product : SMT3 suppressor of mif two 3 homolog 1 protein_id : NP_033486.1

name	Nol5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407050 GeneID:55989 MGI:1933184
definition	GO_component : GO:0005730 - nucleolus [Evidence IC] GO_function : GO:0030519 - snoRNP binding [Evidence ISS] codon_start : 1 note : SIK similar protein product : nucleolar protein 5 protein_id : NP_061356.2

name	LOC100043007 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233900 GeneID:100043007
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479453.1

name	B430105G09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363449 GeneID:320907 MGI:2445016
definition	codon_start : 1 product : hypothetical protein LOC320907 protein_id : XP_905694.2

name	Bmpr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680804 GeneID:12168 MGI:1095407
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IEA] codon_start : 1 product : bone morphogenic protein receptor, type II (serine/threonine kinase) protein_id : NP_031587.1

name	Als2cr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582792 CCDS:CCDS14986.1 GeneID:72750 MGI:1920000
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 isoform a protein_id : NP_001032814.1

name	Als2cr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556211 GeneID:72750 MGI:1920000
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13 isoform b protein_id : NP_001003946.1

name	LOC100042496 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233861 GeneID:100042496
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478369.1

name	Ica1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036622 CCDS:CCDS14987.1 GeneID:70375 MGI:1917625
definition	codon_start : 1 exception : mismatches in translation note : amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15 product : Ica69-related protein protein_id : NP_081683.2

name	Wdr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946614 CCDS:CCDS14988.1 GeneID:57750 MGI:1927241
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007219 - Notch signaling pathway [Evidence IPI] codon_start : 1 note : nuclear protein Ytm1 product : WD repeat domain 12 protein_id : NP_067287.1

name	Carf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982847 CCDS:CCDS14989.1 GeneID:241066 MGI:2182269
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : calcium-response factor CaRF product : calcium response factor protein_id : NP_631889.1

name	Nbeal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233902 GeneID:269198 MGI:2444343
definition	codon_start : 1 product : neurobeachin like 1 protein_id : XP_996048.2

name	Cyp20a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74271886 CCDS:CCDS14990.1 GeneID:77951 MGI:1925201
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, 20a1; cytochrome P450 monooxygenase product : cytochrome P450, family 20, subfamily A, polypeptide 1 protein_id : NP_084289.1

name	Abi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37693505 CCDS:CCDS14991.1 GeneID:329165 MGI:106913
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0016477 - cell migration [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0007611 - learning and/or memory [Evidence IMP] codon_start : 1 product : abl-interactor 2 protein_id : NP_937760.1

name	Raph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233904 GeneID:77300 MGI:1924550
definition	codon_start : 1 product : Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 protein_id : XP_001479527.1

name	LOC100043027 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233906 GeneID:100043027
definition	codon_start : 1 product : similar to SEC61 gamma protein_id : XP_001479532.1

name	LOC100042533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233863 GeneID:100042533
definition	codon_start : 1 product : similar to Limb expression 1 homolog (chicken) protein_id : XP_001478437.1

name	Eif4a-ps4 (CDS detail)
type	promoter
link	vega ensembl
xref
definition	note : RNA polymerase III promoter element A pseudo : _no_value

name	Eif4a-ps4 (CDS detail)
type	promoter
link	vega ensembl
xref
definition	note : RNA polymerase III promoter element B pseudo : _no_value

name	Eif4a-ps4 (CDS detail)
type	TATA_signal
link	vega ensembl
xref
definition	note : TATA-box

name	EG667397 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667397
definition	number : 2 pseudo : _no_value

name	EG667397 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667397
definition	number : 1 pseudo : _no_value

name	LOC100042431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042431
definition	number : 1 pseudo : _no_value

name	LOC100042431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042431
definition	number : 2 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 14 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 13 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 12 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 11 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 10 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 9 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 8 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 7 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 6 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 5 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 4 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 3 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 2 pseudo : _no_value

name	EG667419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667419
definition	number : 1 pseudo : _no_value

name	LOC100042476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042476
definition	number : 1 pseudo : _no_value

name	LOC100042476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042476
definition	number : 2 pseudo : _no_value

name	LOC100042476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042476
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:158798
definition	standard_name : AF067834

name	(CDS detail)
type	STS
link
xref	UniSTS:128933
definition	standard_name : D1Mit75

name	(CDS detail)
type	STS
link
xref	UniSTS:178400
definition	standard_name : AI646576

name	(CDS detail)
type	STS
link
xref	UniSTS:207162
definition	standard_name : AU021929

name	(CDS detail)
type	STS
link
xref	UniSTS:128778
definition	standard_name : D1Mit414

name	(CDS detail)
type	STS
link
xref	UniSTS:141238
definition	standard_name : Casp8

name	(CDS detail)
type	STS
link
xref	UniSTS:498225
definition	standard_name : Casp8

name	(CDS detail)
type	STS
link
xref	UniSTS:158798
definition	standard_name : AF067834

name	(CDS detail)
type	STS
link
xref	UniSTS:128933
definition	standard_name : D1Mit75

name	(CDS detail)
type	STS
link
xref	UniSTS:158794
definition	standard_name : AI480836

name	(CDS detail)
type	STS
link
xref	UniSTS:178398
definition	standard_name : AW046271

name	(CDS detail)
type	STS
link
xref	UniSTS:234134
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:222101
definition	standard_name : RH140019

name	(CDS detail)
type	STS
link
xref	UniSTS:234136
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:160067
definition	standard_name : AA792893

name	(CDS detail)
type	STS
link
xref	UniSTS:164114
definition	standard_name : AI853305

name	(CDS detail)
type	STS
link
xref	UniSTS:128500
definition	standard_name : D1Mit161

name	(CDS detail)
type	STS
link
xref	UniSTS:234135
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128629
definition	standard_name : D1Mit279

name	(CDS detail)
type	STS
link
xref	UniSTS:124685
definition	standard_name : 48.MMHAP34FRH12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123060
definition	standard_name : 10.MMHAP9FRD7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128657
definition	standard_name : D1Mit302

name	(CDS detail)
type	STS
link
xref	UniSTS:273019
definition	standard_name : PMC316619P2

name	(CDS detail)
type	STS
link
xref	UniSTS:498742
definition	standard_name : Fzd7

name	(CDS detail)
type	STS
link
xref	UniSTS:178397
definition	standard_name : AW554518

name	(CDS detail)
type	STS
link
xref	UniSTS:234137
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122762
definition	standard_name : 04.MHAa63a4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:43024
definition	standard_name : D17S756

name	(CDS detail)
type	STS
link
xref	UniSTS:123545
definition	standard_name : 21.MMHAP94FLG3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178396
definition	standard_name : AW546137

name	(CDS detail)
type	STS
link
xref	UniSTS:185437
definition	standard_name : BB189135

name	(CDS detail)
type	STS
link
xref	UniSTS:128562
definition	standard_name : D1Mit22

name	(CDS detail)
type	STS
link
xref	UniSTS:234138
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234140
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234141
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142281
definition	standard_name : D1Wsu158e

name	(CDS detail)
type	STS
link
xref	UniSTS:161556
definition	standard_name : RH124734

name	(CDS detail)
type	STS
link
xref	UniSTS:237290
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164119
definition	standard_name : AI662228

name	(CDS detail)
type	STS
link
xref	UniSTS:125418
definition	standard_name : MHAa87c2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234142
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164118
definition	standard_name : AI839867

name	(CDS detail)
type	STS
link
xref	UniSTS:207163
definition	standard_name : BB284779

name	(CDS detail)
type	STS
link
xref	UniSTS:221148
definition	standard_name : RH139062

name	(CDS detail)
type	STS
link
xref	UniSTS:128844
definition	standard_name : D1Mit479

name	(CDS detail)
type	STS
link
xref	UniSTS:128460
definition	standard_name : D1Mit126

clone name	MSMg01-409G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-208L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-363A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-217C16.b	B6Ng01-217C16.g
ACC	GA033650	GA033651
length	425	875
definition	B6Ng01-217C16.b	B6Ng01-217C16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(59,788,412 - 59,788,842)	(59,666,689 - 59,667,562)
sequence	aaagtaaaatcaggggcctcgagagatggctcagcaggaaagagcactgg ctgctcttccagagaccctgagcccagttcccagcacctaaatggcagct cacaaatgtaactcctgtttcaggggagttacactgactccctcacacat gtagtacaaaacaatgtacatgaaattaaaataaatagattttataaata aataaacaaataaataaaaattaaaaattagttgatcatgggtacatatc tttgatcccataggatgcagaggcagctggatctcttgagttgaggccag cctgatctacagagtatgttccaggaaagccagagctacacagagaaacc tttttcttgaaaaagcaaaacaaaacaaaacaagaaaaaaaagtctctaa agaagaagaaggaggaggaggagga	gaattcttctaacatgaggctctgtcacctccatgctcaaagctgagtga cactagccaggaaaatgtaccctgatcttcagattgtccctgttgtaaat cacagatccagaatgcgaaccctggcaggctccagcgtcttagccaagtg cagcgggggctttaggcaccacagaacatggcccaagctaagccatgact gagtcagtcaaaacagatttcctgtctcatgacgccagggccggctccgg ccgagtcctcggaggttagccagacattctcaatgcaatgaaatgccact gcagaaagtcaccggaggcctgtgcctgtctcaatgacaaatgctaattt ttagaaaggctttccggtcttggaaggcaagaagaaggaaattccaagga agtgcttttagctgtttaaagaacaattctcccctttggtcttaatggtc atgttgtttttcctactttaaattcagtagtgacctgcacggtttattat aaggagtgagccagatactagggatacatctcagtgttataacactttct aggatgtgtgaggccctgggttcagtcaccagtattacatggattgcata tatatacacacacacacacacattagtacattttttaaaaaaagtatgag tgatctagtgagaggacttagaattcttttgcaagtttccacaagataag gttcaccagcaacctccaaatctgggcagactggggaaacagtcccaaag cccaaggaaaggataaaaggtcaattctagttacttcctagatcagtggt tctgaaacgttagtgcacttcagaagcacctacacgttttggtttggttt ggtttggtttggtttggatttggtt
quality values	Open. Hide. 15 62 62 54 62 54 62 62 40 47 41 38 62 54 49 47 62 62 62 62 62 54 62 54 62 37 29 39 32 24 39 38 26 18 28 28 45 49 44 62 62 59 62 62 62 62 59 62 62 62 49 62 62 62 62 62 62 62 62 59 49 62 62 62 59 59 62 62 62 59 59 62 62 62 62 59 46 59 62 62 62 56 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 31 22 22	Open. Hide. 62 47 56 41 62 62 62 62 62 47 42 31 32 24 21 21 21 21 28 21 34 34 38 46 51 62 59 59 62 62 62 59 47 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 59 59 62 59 59 49 56 48 33 48 54 59 54 54 54 56 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 37 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 47 62 62 62 62 58 58 54 45 58 58 58 58 58 58 58 58 58 58 58 54 54 54 58 58 54 58 45 58 58 58 58 58 58 54 58 54 48 52 58 54 54 54 58 58 58 58 58 45 41 58 54 54 58 58 58 58 54 54 49 58 58 58 54 58 54 58 58 49 58 58 58 58 58 52 54 44 38 58 42 58 48 58 51 58 58 42 49 40 58 51 58 58 58 58 58 58 52 47 58 58 58 42 45 58 50 58 48 49 50 50 52 53 50 58 58 58 45 41 58 58 53 52 53 53 54 41 58 53 58 51 58 50 58 52 58 58 58 58 58 58 58 51 58 58 58 52 58 58 50 48 44 50 58 50 58 58 58 49 58 39 39 58 58 58 54 58 58 40 50 40 41 49 58 31 51 58 38 28 52 47 49 50 54 58 50 39 50 41 51 39 32 52 53 42 40 54 35 17 25 39 37 54 54 49 52 42 31 39 52 49 54 45 39 53 42 49 25 54 40 51 32 42 52 16 54 27 51 45 42 40 51 30 37 37 21 38 33 53 52 39 37 30 54 53 40 39 38 46 54 54 32 40 29 37 24 26 53 54 54 46 40 46 27 35 31 36 29 34 53 51 27 46 40 32 29 47 52 31 32 25 33 28 49 47 23 31 31 26 37 53 52 33 32 33 20 41 33 36 43 43 51 30 43 31 33 31 26 31 35 45 35 35 21 37 24 32 33 35 31 31 36 45 51 30 33 42 39 32 42 51 31 32 31 37 43 36 33 32 31 25 31 31 12 31 31 33 10 46 36 20 36 20 22 42 30 31 36 34 42 36 32 48 48 26 46 10 8 47 21 41 36 26 46 19 36 41 27 46 30 34 30 23 41 29 32 30 18 33 46 22 30 6 38 38 17 16 11 5 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_59788412_59788842
seq2: B6Ng01-217C16.b_43_473 (reverse)

seq1  TCCTCCTCCTCCTCCTTCTTCTTCTTTAGAGACTTTTTTTTCTTGTTTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCTCCTCCTCCTTCTTCTTCTTTAGAGACTTTTTTTTCTTGTTTTG  50

seq1  TTTTGTTTTGCTTTTTCAAGAAAAAGGTTTCTCTGTGTAGCTCTGGCTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGTTTTGCTTTTTCAAGAAAAAGGTTTCTCTGTGTAGCTCTGGCTTT  100

seq1  CCTGGAACATACTCTGTAGATCAGGCTGGCCTCAACTCAAGAGATCCAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAACATACTCTGTAGATCAGGCTGGCCTCAACTCAAGAGATCCAGC  150

seq1  TGCCTCTGCATCCTATGGGATCAAAGATATGTACCCATGATCAACTAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTCTGCATCCTATGGGATCAAAGATATGTACCCATGATCAACTAATT  200

seq1  TTTAATTTTTATTTATTTGTTTATTTATTTATAAAATCTATTTATTTTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATTTTTATTTATTTGTTTATTTATTTATAAAATCTATTTATTTTAA  250

seq1  TTTCATGTACATTGTTTTGTACTACATGTGTGAGGGAGTCAGTGTAACTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATGTACATTGTTTTGTACTACATGTGTGAGGGAGTCAGTGTAACTC  300

seq1  CCCTGAAACAGGAGTTACATTTGTGAGCTGCCATTTAGGTGCTGGGAACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGAAACAGGAGTTACATTTGTGAGCTGCCATTTAGGTGCTGGGAACT  350

seq1  GGGCTCAGGGTCTCTGGAAGAGCAGCCAGTGCTCTTTCCTGCTGAGCCAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTCAGGGTCTCTGGAAGAGCAGCCAGTGCTCTTTCCTGCTGAGCCAT  400

seq1  CTCTCGAGGCCCCTGATTTTACTTTGAATTC  431
      |||||||||||||||||||||||||||||||
seq2  CTCTCGAGGCCCCTGATTTTACTTTGAATTC  431

seq1: chr1_59666689_59667562
seq2: B6Ng01-217C16.g_65_939

seq1  GAATTCTTCTAACATGAGGCTCTGTCACCTCCATGCTCAAAGCTGAGTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCTAACATGAGGCTCTGTCACCTCCATGCTCAAAGCTGAGTGA  50

seq1  CACTAGCCAGGAAAATGTACCCTGATCTTCAGATTGTCCCTGTTGTAAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTAGCCAGGAAAATGTACCCTGATCTTCAGATTGTCCCTGTTGTAAAT  100

seq1  CACAGATCCAGAATGCGAACCCTGGCAGGCTCCAGCGTCTTAGCCAAGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGATCCAGAATGCGAACCCTGGCAGGCTCCAGCGTCTTAGCCAAGTG  150

seq1  CAGCGGGGGCTTTAGGCACCACAGAACATGGCCCAAGCTAAGCCATGACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCGGGGGCTTTAGGCACCACAGAACATGGCCCAAGCTAAGCCATGACT  200

seq1  GAGTCAGTCAAAACAGATTTCCTGTCTCATGACGCCAGGGCCGGCTCCGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCAGTCAAAACAGATTTCCTGTCTCATGACGCCAGGGCCGGCTCCGG  250

seq1  CCGAGTCCTCGGAGGTTAGCCAGACATTCTCAATGCAATGAAATGCCACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGAGTCCTCGGAGGTTAGCCAGACATTCTCAATGCAATGAAATGCCACT  300

seq1  GCAGAAAGTCACCGGAGGCCTGTGCCTGTCTCAATGACAAATGCTAATTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAAAGTCACCGGAGGCCTGTGCCTGTCTCAATGACAAATGCTAATTT  350

seq1  TTAGAAAGGCTTTCCGGTCTTGGAAGGCAAGAAGAAGGAAATTCCAAGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAAAGGCTTTCCGGTCTTGGAAGGCAAGAAGAAGGAAATTCCAAGGA  400

seq1  AGTGCTTTTAGCTGTTTAAAGAACAATTCTCCCCTTTGGTCTTAATGGTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTTTTAGCTGTTTAAAGAACAATTCTCCCCTTTGGTCTTAATGGTC  450

seq1  ATGTTGTTTTTCCTACTTTAAATTCAGTAGTGACCTGCACGGTTTATTAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTGTTTTTCCTACTTTAAATTCAGTAGTGACCTGCACGGTTTATTAT  500

seq1  AAGGAGTGAGCCAGATACTAGGGATACATCTCAGTGTTATAACACTTTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGTGAGCCAGATACTAGGGATACATCTCAGTGTTATAACACTTTCT  550

seq1  AGGATGTGTGAGGCCCTGGGTTCAGTCACCAGTATTACATGGATTGCATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGTGTGAGGCCCTGGGTTCAGTCACCAGTATTACATGGATTGCATA  600

seq1  TATATACACACACACACACACATTAGTACATTTTTTAAAAAAAGTATGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATACACACACACACACACATTAGTACATTTTTTAAAAAAAGTATGAG  650

seq1  TGATCTAGTGAGAGGACTTAGAATTCTTTTGCAAGTTTCCACAAGATAAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATCTAGTGAGAGGACTTAGAATTCTTTTGCAAGTTTCCACAAGATAAG  700

seq1  GTTCACCAGCAACCTCCAAATCTGGGCAGACTGGGGAAACAGTCCCAAAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCACCAGCAACCTCCAAATCTGGGCAGACTGGGGAAACAGTCCCAAAG  750

seq1  CCCAAGGAAAGGATAAAAGGTCAATTCTAGTTACTTCCTAGATCAGTGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGGAAAGGATAAAAGGTCAATTCTAGTTACTTCCTAGATCAGTGGT  800

seq1  TCTGAAACGTTAGTGCACTTCAGAAGCACCTACACGTTTTGGTTTGGTTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAAACGTTAGTGCACTTCAGAAGCACCTACACGTTTTGGTTTGGTTT  850

seq1  GGTTTGGTTTGGTTTGG-TTTGGTT  874
      ||||||||||||||||| |||||||
seq2  GGTTTGGTTTGGTTTGGATTTGGTT  875

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information