MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-223H07
Chromosome	1 (Build37)
Map Location	134,284,740 - 134,285,833
singlet/doublet	singlet
Overlap gene	Tmcc2
Upstream gene	Srgap2, LOC100042821, 2700049P18Rik, Avpr1b, LOC667238, Ctse, 5430435G22Rik, Slc26a9, 4732466D17Rik, Slc41a1, Rab7l1, Nucks1, Slc45a3, Elk4, Mfsd4, Pctk3, LOC100042221, Lemd1, EG638532, Klhdc8a, Nuak2
Downstream gene	Ripk5, Rbbp5, Tmem81, Cntn2, Nfasc, Lrrn2, Mdm4, LOC638636, Pik3c2b, Ppp1r15b, Plekha6, Golt1a, Kiss1, LOC100038824, Ren1, Etnk2, Sox13
Link	Open Mouse BAC browser

Click to get alignment info.

name	Srgap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14270 MGI:109605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042821 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	2700049P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108900 MGI:1919669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avpr1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26361 MGI:1347010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 15 Proteins pseudo : _no_value

name	Ctse (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13034 MGI:107361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430435G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226421 MGI:2442295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320718 MGI:2444594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732466D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212933 MGI:2442939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc41a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98396 MGI:2444823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab7l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226422 MGI:2385107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nucks1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98415 MGI:1934811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc45a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212980 MGI:1922082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13714 MGI:102853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213006 MGI:2442786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pctk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18557 MGI:97518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lemd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213409 MGI:1922403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG638532 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638532 MGI:3646637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Klhdc8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213417 MGI:2442630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nuak2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74137 MGI:1921387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68875 MGI:1916125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ripk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213452 MGI:1925064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbbp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213464 MGI:1918367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74626 MGI:1921876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21367 MGI:104518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfasc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269116 MGI:104753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16980 MGI:106037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17248 MGI:107934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 733 ESTs, 7 Proteins pseudo : _no_value

name	Pik3c2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240752 MGI:2685045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	Ppp1r15b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108954 MGI:2444211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekha6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240753 MGI:2388662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golt1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68338 MGI:1915588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kiss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280287 MGI:2663985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ren1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19701 MGI:97898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etnk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214253 MGI:2443760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20668 MGI:98361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srgap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486599 GeneID:14270 MGI:109605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLIT-ROBO Rho GTPase activating protein 2 transcript_id : NM_001081011.1

name	2700049P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341750 GeneID:108900 MGI:1919669
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700049P18 gene transcript_id : NM_175382.2

name	Avpr1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61675709 GeneID:26361 MGI:1347010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin receptor 1B transcript_id : NM_011924.2

name	Ctse (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982440 GeneID:13034 MGI:107361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin E transcript_id : NM_007799.2

name	5430435G22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031992 GeneID:226421 MGI:2442295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430435G22 gene transcript_id : NM_145509.2

name	Slc26a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802673 GeneID:320718 MGI:2444594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 9 transcript_id : NM_177243.3

name	4732466D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375855 GeneID:212933 MGI:2442939
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732466D17 gene transcript_id : NM_178079.2

name	Slc41a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67514554 GeneID:98396 MGI:2444823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 1 transcript_id : NM_173865.2

name	Rab7l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450114 GeneID:226422 MGI:2385107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB7, member RAS oncogene family-like 1 transcript_id : NM_144875.1

name	Nucks1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341542 GeneID:98415 MGI:1934811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear casein kinase and cyclin-dependent kinase substrate 1 transcript_id : NM_175294.2

name	Slc45a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122420 GeneID:212980 MGI:1922082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 45, member 3 transcript_id : NM_145977.1

name	Elk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679632 GeneID:13714 MGI:102853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELK4, member of ETS oncogene family transcript_id : NM_007923.1

name	Mfsd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369923 GeneID:213006 MGI:2442786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 4 transcript_id : NM_172510.2

name	Pctk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679232 GeneID:18557 MGI:97518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PCTAIRE-motif protein kinase 3 transcript_id : NM_008795.1

name	LOC100042221 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234255 GeneID:100042221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001477751.1

name	Lemd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311552 GeneID:213409 MGI:1922403
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LEM domain containing 1 transcript_id : NM_001033250.3

name	EG638532 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363947 GeneID:638532 MGI:3646637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG638532 transcript_id : XM_914588.2

name	Klhdc8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363055 GeneID:213417 MGI:2442630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 8A transcript_id : NM_144810.3

name	Nuak2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891701 GeneID:74137 MGI:1921387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NUAK family, SNF1-like kinase, 2 transcript_id : NM_028778.3

name	Tmcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341188 GeneID:68875 MGI:1916125
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and coiled-coil domains 2 transcript_id : NM_178874.2

name	Ripk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301222 GeneID:213452 MGI:1925064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor interacting protein kinase 5 transcript_id : NM_172516.4

name	Rbbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369713 GeneID:213464 MGI:1918367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoblastoma binding protein 5 transcript_id : NM_172517.1

name	Tmem81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361444 GeneID:74626 MGI:1921876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 81 transcript_id : NM_029025.2

name	Cntn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248523 GeneID:21367 MGI:104518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : contactin 2 transcript_id : NM_177129.5

name	Nfasc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130561 GeneID:269116 MGI:104753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurofascin transcript_id : NM_182716.3

name	Lrrn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922709 GeneID:16980 MGI:106037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat protein 2, neuronal transcript_id : NM_010732.2

name	Mdm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802331 GeneID:17248 MGI:107934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformed mouse 3T3 cell double minute 4 transcript_id : NM_008575.3

name	Pik3c2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234310 GeneID:240752 MGI:2685045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : phosphoinositide-3-kinase, class 2, beta polypeptide transcript_id : XM_001479658.1

name	Ppp1r15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802693 GeneID:108954 MGI:2444211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 15b transcript_id : NM_133819.2

name	Plekha6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33636692 GeneID:240753 MGI:2388662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family A member 6 transcript_id : NM_182930.1

name	Golt1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388699 GeneID:68338 MGI:1915588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi transport 1 homolog A (S. cerevisiae) transcript_id : NM_026680.4

name	Kiss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226214 GeneID:280287 MGI:2663985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KiSS-1 metastasis-suppressor transcript_id : NM_178260.3

name	LOC100038824 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234179 GeneID:100038824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038824 transcript_id : XM_001471774.1

name	Ren1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886403 GeneID:19701 MGI:97898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : renin 1 structural transcript_id : NM_031192.2

name	Etnk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387127 GeneID:214253 MGI:2443760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ethanolamine kinase 2 transcript_id : NM_175443.3

name	Sox13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226240 GeneID:20668 MGI:98361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 13 transcript_id : NM_011439.2

name	Srgap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486600 GeneID:14270 MGI:109605
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : formin binding protein 2 product : SLIT-ROBO Rho GTPase activating protein 2 protein_id : NP_001074480.1

name	2700049P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425090 CCDS:CCDS15270.1 GeneID:108900 MGI:1919669
definition	codon_start : 1 product : hypothetical protein LOC108900 protein_id : NP_780591.1

name	Avpr1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753152 GeneID:26361 MGI:1347010
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : V3/V1b pituitary vasopressin receptor; arginine vasopressin type 1b receptor product : arginine vasopressin receptor 1B protein_id : NP_036054.1

name	Ctse (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681081 CCDS:CCDS15271.1 GeneID:13034 MGI:107361
definition	GO_component : GO:0005768 - endosome [Evidence IDA]; GO:0019028 - viral capsid [Evidence IEA]; GO:0019031 - viral envelope [Evidence IEA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0004193 - cathepsin E activity [Evidence IEA] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008130 - neutrophil collagenase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cathepsin E preproprotein protein_id : NP_031825.1

name	5430435G22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704002 CCDS:CCDS15272.1 GeneID:226421 MGI:2442295
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC226421 protein_id : NP_663484.1

name	Slc26a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893301 CCDS:CCDS15273.1 GeneID:320718 MGI:2444594
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SLC26A9 anion transporter/exchanger; anion transporter/exchanger-9 product : solute carrier family 26, member 9 protein_id : NP_796217.1

name	4732466D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374119 CCDS:CCDS15274.1 GeneID:212933 MGI:2442939
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC212933 protein_id : NP_835180.1

name	Slc41a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238870 CCDS:CCDS15275.1 GeneID:98396 MGI:2444823
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 product : solute carrier family 41, member 1 protein_id : NP_776290.1

name	Rab7l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450115 CCDS:CCDS15276.1 GeneID:226422 MGI:2385107
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAB7, member RAS oncogene family-like 1 protein_id : NP_659124.1

name	Nucks1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424964 GeneID:98415 MGI:1934811
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : nuclear, casein kinase and cyclin-dependent kinase substrate protein_id : NP_780503.1

name	Slc45a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122421 CCDS:CCDS15278.1 GeneID:212980 MGI:1922082
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : prostate cancer associated protein 6 protein_id : NP_666089.1

name	Elk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679633 GeneID:13714 MGI:102853
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ELK4, member of ETS oncogene family protein_id : NP_031949.1

name	Mfsd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369708 CCDS:CCDS15280.1 GeneID:213006 MGI:2442786
definition	codon_start : 1 product : major facilitator superfamily domain containing 4 protein_id : NP_766098.1

name	Pctk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679233 CCDS:CCDS15281.1 GeneID:18557 MGI:97518
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] citation : [PUBMED 1437147] codon_start : 1 product : PCTAIRE-motif protein kinase 3 protein_id : NP_032821.1

name	LOC100042221 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234256 GeneID:100042221
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477801.1

name	Lemd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680919 GeneID:213409 MGI:1922403
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005635 - nuclear envelope [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : LEM domain containing 1 protein_id : NP_001028422.2

name	EG638532 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363948 GeneID:638532 MGI:3646637
definition	codon_start : 1 product : hypothetical protein protein_id : XP_919681.2

name	Klhdc8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450177 GeneID:213417 MGI:2442630
definition	codon_start : 1 product : kelch domain containing 8A protein_id : NP_659059.1

name	Nuak2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229182 CCDS:CCDS15283.1 GeneID:74137 MGI:1921387
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0042149 - cellular response to glucose starvation [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS] codon_start : 1 note : SNF1/AMP-activated protein kinase product : NUAK family, SNF1-like kinase, 2 protein_id : NP_083054.1

name	Tmcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725710 CCDS:CCDS15284.1 GeneID:68875 MGI:1916125
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane and coiled-coil domains 2 protein_id : NP_849205.1

name	Ripk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556610 CCDS:CCDS15285.1 GeneID:213452 MGI:1925064
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : dusty protein kinase product : receptor interacting protein kinase 5 protein_id : NP_766104.2

name	Rbbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369714 CCDS:CCDS15286.1 GeneID:213464 MGI:1918367
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 exception : mismatches in translation product : retinoblastoma binding protein 5 protein_id : NP_766105.1

name	Tmem81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312826 CCDS:CCDS15287.1 GeneID:74626 MGI:1921876
definition	codon_start : 1 product : hypothetical protein LOC74626 protein_id : NP_083301.1

name	Cntn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607084 CCDS:CCDS15288.1 GeneID:21367 MGI:104518
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0001764 - neuron migration [Evidence IMP] codon_start : 1 note : axonin; transiently-expressed axonal glycoprotein product : contactin 2 protein_id : NP_796103.2

name	Nfasc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:35215309 GeneID:269116 MGI:104753
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence IMP] codon_start : 1 product : neurofascin protein_id : NP_874385.1

name	Lrrn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47777289 CCDS:CCDS15289.1 GeneID:16980 MGI:106037
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat protein 2, neuronal protein_id : NP_034862.1

name	Mdm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543245 CCDS:CCDS15290.1 GeneID:17248 MGI:107934
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045023 - G0 to G1 transition [Evidence ISS]; GO:0042177 - negative regulation of protein catabolism [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP] codon_start : 1 product : transformed mouse 3T3 cell double minute 4 protein_id : NP_032601.2

name	Pik3c2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234311 GeneID:240752 MGI:2685045
definition	codon_start : 1 product : phosphoinositide-3-kinase, class 2, beta polypeptide protein_id : XP_001479708.1

name	Ppp1r15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27597067 CCDS:CCDS15291.1 GeneID:108954 MGI:2444211
definition	GO_component : GO:0000164 - protein phosphatase type 1 complex [Evidence IDA] GO_function : GO:0004722 - protein serine/threonine phosphatase activity [Evidence IDA]; GO:0045182 - translation regulator activity [Evidence IC] GO_process : GO:0006983 - ER overload response [Evidence IDA] [Evidence IMP]; GO:0006446 - regulation of translational initiation [Evidence IC]; GO:0042542 - response to hydrogen peroxide [Evidence IMP]; GO:0006979 - response to oxidative stress [Evidence IMP] [Evidence IDA]; GO:0006950 - response to stress [Evidence IMP] codon_start : 1 product : protein phosphatase 1, regulatory subunit 15B protein_id : NP_598580.1

name	Plekha6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33636693 CCDS:CCDS15292.1 GeneID:240753 MGI:2388662
definition	codon_start : 1 note : phosphoinositol 3-phosphate-binding protein-3 product : pleckstrin homology domain containing, family A member 6 protein_id : NP_891846.1

name	Golt1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311983 GeneID:68338 MGI:1915588
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi transport 1 homolog A protein_id : NP_080956.1

name	Kiss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226215 GeneID:280287 MGI:2663985
definition	GO_function : GO:0001664 - G-protein-coupled receptor binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030336 - negative regulation of cell migration [Evidence IPI]; GO:0008285 - negative regulation of cell proliferation [Evidence IPI] codon_start : 1 note : metastin; 0610012C01Rik product : KiSS-1 metastasis-suppressor protein_id : NP_839991.2

name	LOC100038824 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234180 GeneID:100038824
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471824.1

name	Ren1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13676837 CCDS:CCDS15295.1 GeneID:19701 MGI:97898
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004195 - renin activity [Evidence IEA] GO_process : GO:0002003 - angiotensin maturation [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0042756 - drinking behavior [Evidence IMP]; GO:0008065 - establishment of blood-nerve barrier [Evidence IMP]; GO:0009755 - hormone-mediated signaling [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0002016 - renin-angiotensin regulation of body fluid levels [Evidence IMP] codon_start : 1 note : aspartyl-protease product : renin 1 structural protein_id : NP_112469.1

name	Etnk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425172 CCDS:CCDS15296.1 GeneID:214253 MGI:2443760
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 product : putative ethanolamine kinase protein_id : NP_780652.1

name	Sox13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226241 GeneID:20668 MGI:98361
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : SRY-box 13 protein_id : NP_035569.2

name	LOC100042821 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042821
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:207205
definition	standard_name : BB210543

name	(CDS detail)
type	STS
link
xref	UniSTS:163261
definition	standard_name : X97399

name	(CDS detail)
type	STS
link
xref	UniSTS:158848
definition	standard_name : AI098026

name	(CDS detail)
type	STS
link
xref	UniSTS:234209
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164127
definition	standard_name : AI573938

name	(CDS detail)
type	STS
link
xref	UniSTS:212946
definition	standard_name : RH129649

name	(CDS detail)
type	STS
link
xref	UniSTS:158850
definition	standard_name : 35.MMHAP31FLD5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178463
definition	standard_name : AI647518

name	(CDS detail)
type	STS
link
xref	UniSTS:6910
definition	standard_name : D1S2379

name	(CDS detail)
type	STS
link
xref	UniSTS:163069
definition	standard_name : RH126361

name	(CDS detail)
type	STS
link
xref	UniSTS:128865
definition	standard_name : D1Mit497

name	(CDS detail)
type	STS
link
xref	UniSTS:158849
definition	standard_name : AU023994

name	(CDS detail)
type	STS
link
xref	UniSTS:185451
definition	standard_name : BB162516

name	(CDS detail)
type	STS
link
xref	UniSTS:165099
definition	standard_name : AI850289

name	(CDS detail)
type	STS
link
xref	UniSTS:161178
definition	standard_name : RH124356

name	(CDS detail)
type	STS
link
xref	UniSTS:163262
definition	standard_name : X69026

name	(CDS detail)
type	STS
link
xref	UniSTS:165100
definition	standard_name : AI428128

name	(CDS detail)
type	STS
link
xref	UniSTS:234389
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:215692
definition	standard_name : RH132409

name	(CDS detail)
type	STS
link
xref	UniSTS:236515
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234215
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:212772
definition	standard_name : RH129466

name	(CDS detail)
type	STS
link
xref	UniSTS:234214
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165101
definition	standard_name : AI465369

name	(CDS detail)
type	STS
link
xref	UniSTS:231669
definition	standard_name : RH142422

name	(CDS detail)
type	STS
link
xref	UniSTS:215897
definition	standard_name : RH132614

name	(CDS detail)
type	STS
link
xref	UniSTS:234213
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234218
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158851
definition	standard_name : MHAa21c6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:143908
definition	standard_name : Ms10j

name	(CDS detail)
type	STS
link
xref	UniSTS:224292
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:231620
definition	standard_name : RH142373

name	(CDS detail)
type	STS
link
xref	UniSTS:207208
definition	standard_name : AU021806

name	(CDS detail)
type	STS
link
xref	UniSTS:210253
definition	standard_name : RH136260

name	(CDS detail)
type	STS
link
xref	UniSTS:161088
definition	standard_name : RH124266

name	(CDS detail)
type	STS
link
xref	UniSTS:162267
definition	standard_name : RH125448

name	(CDS detail)
type	STS
link
xref	UniSTS:209802
definition	standard_name : RH127234

name	(CDS detail)
type	STS
link
xref	UniSTS:226177
definition	standard_name : Mdm4

name	(CDS detail)
type	STS
link
xref	UniSTS:270692
definition	standard_name : PMC133932P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234216
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224555
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164128
definition	standard_name : AI606441

name	(CDS detail)
type	STS
link
xref	UniSTS:234217
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164130
definition	standard_name : AU042621

name	(CDS detail)
type	STS
link
xref	UniSTS:128639
definition	standard_name : D1Mit287

name	(CDS detail)
type	STS
link
xref	UniSTS:128640
definition	standard_name : D1Mit287S

name	(CDS detail)
type	STS
link
xref	UniSTS:248631
definition	standard_name : AA998833

name	(CDS detail)
type	STS
link
xref	UniSTS:142248
definition	standard_name : D1Mit472

name	(CDS detail)
type	STS
link
xref	UniSTS:142085
definition	standard_name : D16Mit18

name	(CDS detail)
type	STS
link
xref	UniSTS:127811
definition	standard_name : D16Mit18

name	(CDS detail)
type	STS
link
xref	UniSTS:142086
definition	standard_name : D1Mit1012

name	(CDS detail)
type	STS
link
xref	UniSTS:128666
definition	standard_name : D1Mit31.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128665
definition	standard_name : D1Mit31

name	(CDS detail)
type	STS
link
xref	UniSTS:144345
definition	standard_name : Ren1

name	(CDS detail)
type	STS
link
xref	UniSTS:128654
definition	standard_name : D1Mit30

name	(CDS detail)
type	STS
link
xref	UniSTS:209961
definition	standard_name : RH135965

name	(CDS detail)
type	STS
link
xref	UniSTS:128671
definition	standard_name : D1Mit312S

name	(CDS detail)
type	STS
link
xref	UniSTS:128670
definition	standard_name : D1Mit312

name	(CDS detail)
type	STS
link
xref	UniSTS:161471
definition	standard_name : RH124649

name	(CDS detail)
type	STS
link
xref	UniSTS:178465
definition	standard_name : AW259412

name	(CDS detail)
type	STS
link
xref	UniSTS:178464
definition	standard_name : AW540933

name	LOC667238 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234304 GeneID:667238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 15 Proteins product : similar to adaptor-related protein complex 1, sigma 3 subunit pseudo : _no_value transcript_id : XR_034191.1

name	LOC638636 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234258 GeneID:638636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 733 ESTs, 7 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_033420.1

clone name	MSMg01-322L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187K22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-223H07.b	B6Ng01-223H07.g
ACC	GA038193	GA038194
length	1,200	1,107
definition	B6Ng01-223H07.b	B6Ng01-223H07.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaataacaagatagaaatagagggggaaaactgaaaagatgctgg caatctcaataagtcaaataaaaaagcacaaagggaaatctgacaagata gctcagggggtaaaggctcttgtcaccaaacttgaggacctgagtcagtc cccacaacccatgtggtgaagggagagagctgaccctgcaagctgtcctc tgacctccagacatatgccgtagtacgcaccccataacataaaatagata atgcagtgtgtatttaaagcacagcggaaagccgaaccagtagagtagtt cgggggaaggtagaataccagggcctggagatcaggcagaggaatcggtg cattcagtcaaggcaataacactttttaaagctatagacagaaaaaatga agatccctggaatgccagcaaagaccaaacccatgaactatgggcatgga gagaggagttccatgttaaaggcacaggaaatacttttcatacaatcatc acagaaaacctcaactctaaggaaagagaggtccacctaggtaaagaaat gtgtcaaagaggtgcaccatggtgtgtttcaagttccaaaaggctgcagc cgcaaacctaaactaaggtaattgccagccaaaccatctgccctaatcta aggagaaagaaagcctcataaggatgaaagccagctgaagaactcaatga ccgtgaagataggggacaccaggaggaatccttcagactaaagagaatga atgggcttcagggggtgaagatagttgagcagtaagtaaagaattgggag aacacctaacaatacaaaatcaaccaaatgacaggaattgatgctcacct tcctgcaataactctgaatattaatggcctcatttttcctaattaaaggc acagaaaacagaataactaaacaacaagatgcatctatttgttgcctcca agaaagaataaaaacaggatatttcgaacaagttgaaagtagaaaaacaa tgcaggtggtgcctagtctattagcttaccaaaaacatatttccattcag actgcttagaagagatttaaggaggacaattccatgctactaaggacagt cattcaagaaggactgcccagtcactcaggaaaaaggacaccatcacatt ggtatattcactaaaattttaaagccgtttctgttcacgacccgatggta	gaattctgttacactttagtgtcagccagccagtctctcctcaacaagca aggactctggatagcagcaaaggatggaatcatgagaccaagtgaatgga gatgtgagcttgagtggttaaaggaatccattttaactatcaggctcccc ttacatactgtctgctgagatctttccccctggaggattcatgcttatct gaagctctggcaaagcctcagaagtgtttacagaagcctcctgtggggcc gggcccattcgcaggttgcttttctgttatagttaccattttaaaatgtt actatgtaactattttccagacccccacccccaccccctaaccacataat cacagattccaagctaccacagaagaaatttacggtgatagagggcttgt ctagtatgctcaagacgctggttatgatctcaggacatccacccctaccc caacctccacacaaaataagccaagaaatgcacatcgtgcagtatgatca tccttgaaggaccagagatagccgaagcccctgacactgctgagcatcac tagccgggcatcattcagatctctagcaaagaccagattctcctctttct ctcctgctatggaggtgctttagacagagctttccatgccttcgctcctt gctcaacaatcaagatgactgtctccattgacacacaatcagtccccatg cctggagctgtcacaagaaaatagaagtgggactaagggactgaaagttc ctatctccaagttcaaaatgaagcaaaagcaagccagagctcctgaacag catcaactaaacacaggcacgggaaaggcattccagattaaaaagcaaac gcatttccctcttggtatcattgtcaaattcagaacaaggtcagccccca cccagttccagagacaatgatgaaaatttttccactaaactgttcagcca tgggaaactgttccagcactggtaaacaaggtttaggccatcactccaat atccccttggttccttcctcagataagttaagttgacatgtcacattttg gttaggcccctgagtcacatccgggataagagtctctgaccggcatgtaa acatgtt
quality values	Open. Hide. 58 29 26 29 52 34 26 33 52 52 47 47 42 41 56 31 47 56 56 62 62 47 47 51 51 62 56 62 62 62 62 54 56 43 45 44 35 34 24 27 28 45 45 46 24 59 59 62 49 54 59 51 59 62 62 59 59 51 56 59 56 62 62 62 62 59 62 62 62 59 59 59 59 56 62 59 62 59 62 59 56 56 48 62 56 59 59 59 62 62 62 62 59 62 56 59 59 59 62 59 54 62 62 62 62 50 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 59 59 62 59 59 62 59 59 59 49 59 59 59 56 59 62 62 62 62 59 62 59 56 62 62 59 59 59 59 59 62 62 59 62 54 62 59 62 62 54 59 62 59 62 62 59 62 59 59 59 62 62 62 62 59 59 59 59 62 62 62 59 62 62 62 62 59 62 59 59 59 62 62 62 59 56 62 62 56 62 59 62 62 59 59 59 56 59 43 59 59 62 51 62 56 62 62 62 59 59 59 59 59 62 59 62 59 56 43 54 59 59 50 62 62 59 62 62 62 62 59 51 59 62 59 62 59 59 62 62 62 59 62 59 56 59 59 59 59 59 59 59 59 62 59 59 59 59 62 50 62 59 59 62 59 56 59 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 59 56 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 56 62 62 56 56 62 62 56 62 56 62 54 62 62 62 56 47 62 62 62 62 62 62 56 56 56 62 62 62 62 56 56 62 56 56 56 51 43 43 56 56 56 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 52 62 52 62 43 52 54 54 58 58 52 52 54 51 52 58 54 52 58 54 54 52 54 52 47 52 58 54 58 52 52 41 48 52 52 52 52 54 52 58 45 58 52 54 54 52 54 54 58 54 58 41 45 54 54 54 52 58 54 52 54 58 58 58 58 58 54 46 54 46 54 41 54 54 58 58 51 51 58 51 58 58 58 58 58 58 58 51 50 51 49 51 51 54 58 53 51 45 42 50 49 49 40 58 40 58 58 58 50 50 53 53 50 50 46 47 41 35 52 51 46 50 50 53 49 50 50 37 41 30 50 50 37 49 51 47 49 51 50 50 51 33 38 39 48 48 50 58 58 58 58 33 58 58 51 50 51 58 51 50 38 50 37 58 49 50 51 50 43 40 44 39 42 47 39 53 52 58 38 54 50 53 35 58 38 31 51 49 43 46 49 53 54 36 50 41 52 49 51 49 30 54 53 40 52 53 38 47 50 51 34 37 51 39 39 40 44 33 29 29 30 42 49 54 44 50 38 31 31 42 54 32 35 44 31 29 32 36 35 27 54 45 45 53 53 28 23 42 32 43 33 54 44 37 51 37 38 53 40 53 37 51 37 54 49 46 37 36 34 34 31 20 54 54 54 51 38 53 33 33 32 31 28 43 45 40 53 52 51 28 45 34 32 45 34 41 31 52 40 45 38 41 47 32 36 46 40 53 47 41 37 51 40 40 31 21 53 40 32 42 31 30 25 31 31 51 28 51 46 46 31 38 25 30 38 14 13 51 30 31 43 37 45 31 23 46 30 23 28 30 35 34 31 42 36 41 30 23 31 46 31 42 36 33 30 31 31 22 25 31 32 25 38 43 43 38 38 43 46 32 22 29 43 32 34 29 32 36 31 41 34 42 17 18 46 46 46 32 34 33 37 30 37 30 27 30 46 32 44 37 18 32 39 30 31 39 46 46 29 16 10 29 29 32 31 29 15 23 16 21 48 31 39 27 18 41 26 20 31 27 32 42 32 22 31 28 17 17 31 48 35 29 21 27 31 30 30 31 25 14 17 19 23 30 29 26 25 19 14 29 38 44 43 38 31 33 15 21 18 28 31 21 27 48 33 34 19 34 20 16 17 33 31 22 5 4 15 37 21 19 18 27 20 25 31 31 36 15 15 7 8 12 32 23 20 24 13 27 32 10 17 22 15 39 33 27 21 21 32 12 10 7 11 28 24 13 12 11 20 5 7 12 12 27 25 11 11 6 9 9 14 32 21 7 10 7 5 15 7 7 5 5 16 16 24 19 9 14 27 15 21 21 8 17 10 8 9 7 5 26 21 4 6 8 12 14 3 4 5 9 23 17 10 9 14 15 11 28 3 7 23 19 7 3 3 3 2 7 16 14 8 5 2 8 10 23 9 8 10 7 5 25 8 22 9 4 6 15 29 24 11 6 4 6 8 9 9 8 7 11 17 17 14 26 15 6 5 5 6 3 4 3 3 9 8 18 5 3 3 4 4 5 4 3 6 16 9 10 5 6 4 6 4 14 22 25 14 13 17 16 1 11 27 13 8 9 18 7 11 12 17 15 12 9 5 7 8 12 7 12 5 7 25 9 1 4 4 4 1 1 3	Open. Hide. 46 20 22 31 62 56 43 47 56 44 51 56 14 17 18 18 14 12 5 13 14 18 19 19 25 28 46 36 43 59 59 46 59 59 62 62 62 62 62 59 59 59 56 56 59 59 59 59 59 59 62 62 54 54 59 62 62 59 51 46 27 37 34 34 34 50 34 50 45 45 59 59 62 59 59 62 59 54 56 59 62 56 62 62 62 59 59 62 62 59 62 59 59 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 56 46 59 59 62 62 62 62 62 62 62 62 62 59 59 46 54 59 59 62 62 62 62 62 62 62 62 62 62 54 54 43 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 46 54 62 59 59 62 62 62 54 62 62 59 59 62 62 51 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 51 59 59 50 59 59 62 51 59 59 59 62 56 59 62 59 59 59 62 62 62 62 62 62 62 56 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 59 59 59 51 59 59 62 62 62 62 59 59 62 59 51 59 51 56 50 56 59 59 50 59 51 43 46 56 59 59 59 46 59 59 59 62 62 62 62 56 59 56 36 62 59 43 62 59 56 59 59 56 51 59 51 62 56 62 59 50 45 38 56 38 56 62 59 62 62 62 62 62 47 62 56 51 62 62 62 56 56 56 56 56 56 62 62 56 62 62 62 62 62 51 51 44 32 56 51 56 62 62 62 56 62 54 56 62 62 62 54 51 62 56 62 62 62 62 62 62 56 56 51 56 56 56 62 62 54 56 56 43 56 46 56 56 31 38 43 41 38 46 62 62 62 56 62 62 62 54 62 62 62 62 56 56 56 56 47 62 62 62 62 46 52 48 62 62 48 62 62 62 62 62 54 54 62 62 62 52 62 62 52 52 46 38 62 62 54 47 52 52 43 52 41 58 52 50 51 54 58 58 54 54 54 52 52 54 54 58 52 52 52 52 40 54 41 42 54 52 58 58 58 58 54 58 58 58 58 54 52 54 58 54 54 58 52 42 42 58 41 51 54 52 52 46 34 42 34 34 52 46 54 36 52 47 52 54 40 58 58 54 58 58 54 46 36 58 58 58 53 58 53 58 54 49 58 52 58 46 50 58 58 49 41 46 49 58 51 58 58 51 51 50 54 37 26 37 47 42 50 58 54 58 51 29 29 54 58 58 51 51 24 25 9 18 21 25 54 43 43 51 38 51 41 30 49 47 50 58 53 53 47 44 53 47 33 50 54 39 51 54 52 52 50 53 46 24 22 50 41 32 39 41 49 37 32 22 15 37 50 52 39 53 50 58 58 58 32 53 58 41 53 35 40 40 44 32 49 41 52 39 53 37 49 32 39 47 51 51 54 19 29 39 35 49 39 16 34 51 54 54 32 34 43 32 33 10 50 28 22 17 39 39 40 54 30 32 33 31 34 54 32 37 33 53 30 37 23 11 35 42 37 51 52 31 51 54 42 43 39 25 18 31 42 33 42 38 33 36 45 33 31 42 32 32 31 14 47 13 31 53 30 53 29 40 37 33 32 27 26 12 18 34 41 21 46 30 45 35 40 37 34 25 45 20 16 37 31 34 35 32 45 37 32 30 20 10 26 19 22 19 11 9 33 19 18 31 12 25 14 31 35 31 31 31 34 31 46 38 32 28 31 31 38 42 33 15 46 16 26 41 29 31 19 26 7 12 9 28 17 42 32 34 23 31 19 31 27 27 34 16 9 9 29 19 18 18 48 17 11 21 30 12 5 7 38 41 41 30 31 36 37 27 29 32 43 41 22 25 31 31 46 21 31 30 25 12 31 37 25 16 21 16 44 41 18 11 48 48 44 31 21 26 27 25 22 16 41 25 11 32 37 10 10 33 20 37 33 25 20 32 38 48 31 30 48 32 15 13 5 8 10 29 21 11 13 23 23 30 13 16 37 10 24 19 18 11 8 24 16 10 37 48 7 16 6 5 6 11 8 5 16 6 20 18 25 26 13 5 6 15 17 22 39 34 18 10 21 15 13 14 10 17 20 25 17 6 8 27 8 10 9 24 5 20 28 7 11 4 23 27 13 6 7 11 10 7 6 16 10 6 5 7 7 6 13 34 31 17 16 24 6 4 8 9 9 25 40 40 16 8 4 8 8 8 23 7 7 22 28 7 8 10 21 14 2 2 3 7 5 11 8 4 6 4 12 12 4 1 3 6 5 4 10 7 4 4 9 7 27 12 14 21 4 8 11 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_134284740_134285833
seq2: B6Ng01-223H07.g_67_1173

seq1  GAATTCTGTTACACTTTAG-GTCAGCCAGCCAGTCTCTCCTCAACAAGCA  49
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  GAATTCTGTTACACTTTAGTGTCAGCCAGCCAGTCTCTCCTCAACAAGCA  50

seq1  AGGACTCTGGATAGCAGCAAAGGATGGAATCATGAGACCAAGTGAATGGA  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACTCTGGATAGCAGCAAAGGATGGAATCATGAGACCAAGTGAATGGA  100

seq1  GATGTGAGCTTGAGTGGTTAAAGGAATCCATTTTAACTATCAGGCTCCCC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTGAGCTTGAGTGGTTAAAGGAATCCATTTTAACTATCAGGCTCCCC  150

seq1  TTACATACTGTCTGCTGAGATCTTTCCCCCTGGAGGATTCATGCTTATCT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACATACTGTCTGCTGAGATCTTTCCCCCTGGAGGATTCATGCTTATCT  200

seq1  GAAGCTCTGGCAAAGCCTCAGAAGTGTTTACAGAAGCCTCCTGTGGGGCC  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCTCTGGCAAAGCCTCAGAAGTGTTTACAGAAGCCTCCTGTGGGGCC  250

seq1  GGGCCCATTCGCAGGTTGCTTTTCTGTTATAGTTACCATTTTAAAATGTT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCCATTCGCAGGTTGCTTTTCTGTTATAGTTACCATTTTAAAATGTT  300

seq1  ACTATGTAACTATTTTCCAGACCCCCACCCCCACCCCCTAACCACATAAT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATGTAACTATTTTCCAGACCCCCACCCCCACCCCCTAACCACATAAT  350

seq1  CACAGATTCCAAGCTACCACAGAAGAAATTTACGGTGATAGAGGGCTTGT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGATTCCAAGCTACCACAGAAGAAATTTACGGTGATAGAGGGCTTGT  400

seq1  CTAGTATGCTCAAGACGCTGGTTATGATCTCAGGACATCCACCCCTACCC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGTATGCTCAAGACGCTGGTTATGATCTCAGGACATCCACCCCTACCC  450

seq1  CAACCTCCACACAAAATAAGCCAAGAAATGCACATCGTGCAGTATGATCA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCTCCACACAAAATAAGCCAAGAAATGCACATCGTGCAGTATGATCA  500

seq1  TCCTTGAAGGACCAGAGATAGCCGAAGCCCCTGACACTGCTGAGCATCAC  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGAAGGACCAGAGATAGCCGAAGCCCCTGACACTGCTGAGCATCAC  550

seq1  TAGCCGGGCATCATTCAGATCTCTAGCAAAGACCAGATTCTCCTCTTTCT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCGGGCATCATTCAGATCTCTAGCAAAGACCAGATTCTCCTCTTTCT  600

seq1  CTCCTGCTATGGAGGTGCTTTAGACAGAGCTTTCCATGCCTTCGCTCCTT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGCTATGGAGGTGCTTTAGACAGAGCTTTCCATGCCTTCGCTCCTT  650

seq1  GCTCAACAATCAAGATGACTGTCTCCATTGACACACAATCAGTCCCCATG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAACAATCAAGATGACTGTCTCCATTGACACACAATCAGTCCCCATG  700

seq1  CCTGGAGCTGTCACAAGAAAATAGAAGTGGGACTAAGGGACTGAAAGTTC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAGCTGTCACAAGAAAATAGAAGTGGGACTAAGGGACTGAAAGTTC  750

seq1  CTATCTCCAAGTTCAAAATGAAAGCAAAAGCAAGCCAGAGCTCCTGAACA  799
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  CTATCTCCAAGTTCAAAATG-AAGCAAAAGCAAGCCAGAGCTCCTGAACA  799

seq1  GCATCAACTAAACACAGGCACGGGAAAGGCATTCCAGATTAAAAAGCAAA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATCAACTAAACACAGGCACGGGAAAGGCATTCCAGATTAAAAAGCAAA  849

seq1  CGCATTT-CCTCTTGGTATCATTGTCAAATTCAGAACAA-GTCAGCCCCC  897
      ||||||| ||||||||||||||||||||||||||||||| ||||||||||
seq2  CGCATTTCCCTCTTGGTATCATTGTCAAATTCAGAACAAGGTCAGCCCCC  899

seq1  ACCCAGTTCCAGAGACAATGATG-AAATTTTTCCACTAAACTG-TCAGCC  945
      ||||||||||||||||||||||| ||||||||||||||||||| ||||||
seq2  ACCCAGTTCCAGAGACAATGATGAAAATTTTTCCACTAAACTGTTCAGCC  949

seq1  ATGGGAAACTTGTCCAGCACTGGAAAACAA-GTTTA-GCCA-CACTCCAA  992
      ||||||||||  ||||||||||| |||||| ||||| |||| ||||||||
seq2  ATGGGAAACTGTTCCAGCACTGGTAAACAAGGTTTAGGCCATCACTCCAA  999

seq1  TAT-CCCTTGTTCCTTTCTTCAGAAAAGTTAAG-TGACATGTCACATTTT  1040
      ||| |||||| | | ||| ||||| |||||||| ||||||||||||||||
seq2  TATCCCCTTGGTTCCTTCCTCAGATAAGTTAAGTTGACATGTCACATTTT  1049

seq1  GG-TAG--CCCTGAGTCACATCTGGTAGAGAGGTCTCTGTCCTGCA-GTA  1086
      || |||  |||||||||||||| || | |   ||||||| || ||| |||
seq2  GGTTAGGCCCCTGAGTCACATCCGGGATAAGAGTCTCTGACCGGCATGTA  1099

seq1  AACATGTT  1094
      ||||||||
seq2  AACATGTT  1107

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information