MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-238I04
Chromosome	1 (Build37)
Map Location	35,447,848 - 35,448,851
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100040938, Ccdc115, Imp4, Ptpn18, Tesp1, Cfc1, Tesp2, 9430069J07Rik, AA619741, Arhgef4, BC043098, Plekhb2, LOC666261
Downstream gene	LOC100041544, LOC666283, LOC100041091, EG666290, Hs6st1, Ugcgl1, LOC100041123, Lincr, Arid5a, 4632411B12Rik, 4930533C12Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ccdc115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69668 MGI:1916918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Imp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27993 MGI:106572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19253 MGI:108410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tesp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21755 MGI:1270856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cfc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12627 MGI:109448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tesp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21756 MGI:1270857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430069J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211383 MGI:3026939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA619741 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241051 MGI:3035322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins

name	Arhgef4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226970 MGI:2442507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC043098 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214469 MGI:2448487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226971 MGI:2385825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC666283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041091 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666290 MGI:3645026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Hs6st1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50785 MGI:1354958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugcgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320011 MGI:2443162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Lincr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214854 MGI:2429944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214855 MGI:2443039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632411B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226976 MGI:1918055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930533C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211430 MGI:3616091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC100040938 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233787 GeneID:100040938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100040938 transcript_id : XM_001475521.1

name	Ccdc115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037168 GeneID:69668 MGI:1916918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 115 transcript_id : NM_027159.1

name	Imp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340630 GeneID:27993 MGI:106572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) transcript_id : NM_178601.2

name	Ptpn18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199760 GeneID:19253 MGI:108410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 18 transcript_id : NM_011206.2

name	Tesp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130424 GeneID:21755 MGI:1270856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testicular serine protease 1 transcript_id : NM_009355.2

name	Cfc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366288 GeneID:12627 MGI:109448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cripto, FRL-1, cryptic family 1 transcript_id : NM_007685.2

name	Tesp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734837 GeneID:21756 MGI:1270857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testicular serine protease 2 transcript_id : NM_009356.2

name	9430069J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523375 GeneID:211383 MGI:3026939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430069J07 gene transcript_id : NM_213727.1

name	AA619741 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363281 GeneID:241051 MGI:3035322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins product : expressed sequence AA619741 transcript_id : XM_915584.2

name	Arhgef4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699447 GeneID:226970 MGI:2442507
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 4 transcript_id : NM_183019.2

name	BC043098 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239369 GeneID:214469 MGI:2448487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC043098 transcript_id : NM_174997.1

name	Plekhb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637809 GeneID:226971 MGI:2385825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family B (evectins) member 2 transcript_id : NM_145516.2

name	LOC100041544 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233804 GeneID:100041544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041544 transcript_id : XM_001476287.1

name	LOC100041091 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233793 GeneID:100041091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041091 transcript_id : XM_001475790.1

name	EG666290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363283 GeneID:666290 MGI:3645026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG666290 transcript_id : XM_982794.1

name	Hs6st1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657187 GeneID:50785 MGI:1354958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 1 transcript_id : NM_015818.1

name	Ugcgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45387932 GeneID:320011 MGI:2443162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-glucose ceramide glucosyltransferase-like 1 transcript_id : NM_198899.1

name	Lincr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130116 GeneID:214854 MGI:2429944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lung-inducible neuralized-related C3HC4 RING domain protein transcript_id : NM_153408.2

name	Arid5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803361 GeneID:214855 MGI:2443039
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 5A (Mrf1 like) transcript_id : NM_145996.3

name	4632411B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803445 GeneID:226976 MGI:1918055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632411B12 gene transcript_id : NM_172652.2

name	LOC100040938 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233788 GeneID:100040938
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475571.1

name	Ccdc115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037169 CCDS:CCDS14866.1 GeneID:69668 MGI:1916918
definition	GO_component : GO:0005764 - lysosome [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil domain containing 115 protein_id : NP_081435.1

name	Imp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519917 GeneID:27993 MGI:106572
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence ISS]; GO:0030519 - snoRNP binding [Evidence ISS] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence TAS] codon_start : 1 exception : mismatches in translation product : U3 snoRNP protein 4 homolog protein_id : NP_848716.1

name	Ptpn18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199761 CCDS:CCDS14867.1 GeneID:19253 MGI:108410
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004726 - non-membrane spanning protein tyrosine phosphatase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase, non-receptor type 18 protein_id : NP_035336.2

name	Tesp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678293 CCDS:CCDS14868.1 GeneID:21755 MGI:1270856
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : testicular serine protease 1 protein_id : NP_033381.1

name	Cfc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671742 CCDS:CCDS14869.1 GeneID:12627 MGI:109448
definition	GO_process : GO:0007275 - development [Evidence IEA]; GO:0007369 - gastrulation [Evidence IEA] codon_start : 1 product : cripto, FRL-1, cryptic family 1 protein_id : NP_031711.1

name	Tesp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734838 CCDS:CCDS14870.1 GeneID:21756 MGI:1270857
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : testicular serine protease 2 protein_id : NP_033382.2

name	9430069J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523376 CCDS:CCDS14871.1 GeneID:211383 MGI:3026939
definition	codon_start : 1 product : hypothetical protein LOC211383 protein_id : NP_998892.1

name	AA619741 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363282 GeneID:241051 MGI:3035322
definition	codon_start : 1 product : hypothetical protein protein_id : XP_920677.2

name	Arhgef4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699448 CCDS:CCDS14872.1 GeneID:226970 MGI:2442507
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : APC-stimulated guanine nucleotide exchange factor product : Rho guanine nucleotide exchange factor 4 protein_id : NP_898840.2

name	BC043098 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239370 CCDS:CCDS14873.1 GeneID:214469 MGI:2448487
definition	codon_start : 1 product : hypothetical protein LOC214469 protein_id : NP_778162.1

name	Plekhb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704016 CCDS:CCDS14874.1 GeneID:226971 MGI:2385825
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : evectin-2; pleckstrin homology domain-containing product : pleckstrin homology domain containing, family B (evectins) member 2 protein_id : NP_663491.1

name	LOC100041544 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233805 GeneID:100041544
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476337.1

name	LOC100041091 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233794 GeneID:100041091
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475840.1

name	EG666290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363284 GeneID:666290 MGI:3645026
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987888.1

name	Hs6st1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657188 GeneID:50785 MGI:1354958
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : heparan sulfate 6-O-sulfotransferase 1 protein_id : NP_056633.1

name	Ugcgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45387933 GeneID:320011 MGI:2443162
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS]; GO:0005793 - ER-Golgi intermediate compartment [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0003980 - UDP-glucose:glycoprotein glucosyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence ISS] GO_process : GO:0051084 - posttranslational protein folding [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP-glucose ceramide glucosyltransferase-like 1 protein_id : NP_942602.1

name	Lincr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510281 CCDS:CCDS14875.1 GeneID:214854 MGI:2429944
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lung inducible neuralized-related C3HC4 RING finger product : lung-inducible neuralized-related C3HC4 RING domain protein protein_id : NP_700457.1

name	Arid5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542476 CCDS:CCDS14876.1 GeneID:214855 MGI:2443039
definition	codon_start : 1 product : modulator recognition factor I protein_id : NP_666108.2

name	4632411B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369930 CCDS:CCDS14877.1 GeneID:226976 MGI:1918055
definition	codon_start : 1 product : hypothetical protein LOC226976 protein_id : NP_766240.1

name	LOC666261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666261
definition	number : 1 pseudo : _no_value

name	LOC666261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666261
definition	number : 2 pseudo : _no_value

name	LOC666261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666261
definition	number : 3 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 1 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 2 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 3 pseudo : _no_value

name	LOC666283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666283
definition	number : 4 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 1 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 2 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 3 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 4 pseudo : _no_value

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 1

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 2

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 3

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 4

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 5

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 6

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 7

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 8

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 9

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 10

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 11

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 12

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 13

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 14

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 15

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 16

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 17

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 18

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 19

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 20

name	(CDS detail)
type	STS
link
xref	UniSTS:142284
definition	standard_name : RH125719

name	(CDS detail)
type	STS
link
xref	UniSTS:161723
definition	standard_name : RH124901

name	(CDS detail)
type	STS
link
xref	UniSTS:167274
definition	standard_name : C86466

name	(CDS detail)
type	STS
link
xref	UniSTS:178368
definition	standard_name : AI427118

name	(CDS detail)
type	STS
link
xref	UniSTS:144301
definition	standard_name : Ptpn18

name	(CDS detail)
type	STS
link
xref	UniSTS:163245
definition	standard_name : U52523

name	(CDS detail)
type	STS
link
xref	UniSTS:178369
definition	standard_name : AV265756

name	(CDS detail)
type	STS
link
xref	UniSTS:234102
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234376
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234104
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234106
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128931
definition	standard_name : D1Mit72

name	(CDS detail)
type	STS
link
xref	UniSTS:492533
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234105
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210061
definition	standard_name : RH136066

name	(CDS detail)
type	STS
link
xref	UniSTS:158783
definition	standard_name : AU018239

name	(CDS detail)
type	STS
link
xref	UniSTS:128454
definition	standard_name : D1Mit121

name	(CDS detail)
type	STS
link
xref	UniSTS:128587
definition	standard_name : D1Mit243

name	(CDS detail)
type	STS
link
xref	UniSTS:122520
definition	standard_name : d9rat157

name	(CDS detail)
type	STS
link
xref	UniSTS:128930
definition	standard_name : D1Mit71

name	(CDS detail)
type	STS
link
xref	UniSTS:131148
definition	standard_name : D7Mit252.1

name	(CDS detail)
type	STS
link
xref	UniSTS:131147
definition	standard_name : MT2785

name	(CDS detail)
type	STS
link
xref	UniSTS:125327
definition	standard_name : MHAa78e6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:122839
definition	standard_name : 05.MMHAP9FLB2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128893
definition	standard_name : D1Mit527

name	(CDS detail)
type	STS
link
xref	UniSTS:128775
definition	standard_name : D1Mit412

name	(CDS detail)
type	STS
link
xref	UniSTS:142242
definition	standard_name : D1Mit465

name	(CDS detail)
type	STS
link
xref	UniSTS:128510
definition	standard_name : D1Mit170.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128509
definition	standard_name : MT262

name	(CDS detail)
type	STS
link
xref	UniSTS:128628
definition	standard_name : D1Mit278

name	(CDS detail)
type	STS
link
xref	UniSTS:234108
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:463453
definition	standard_name : Hs6st1

name	(CDS detail)
type	STS
link
xref	UniSTS:463454
definition	standard_name : Hs6st1

name	(CDS detail)
type	STS
link
xref	UniSTS:234109
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165069
definition	standard_name : AI414429

name	(CDS detail)
type	STS
link
xref	UniSTS:164110
definition	standard_name : AI448372

name	(CDS detail)
type	STS
link
xref	UniSTS:161805
definition	standard_name : RH124983

name	(CDS detail)
type	STS
link
xref	UniSTS:225338
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207145
definition	standard_name : RH127223

name	(CDS detail)
type	STS
link
xref	UniSTS:158785
definition	standard_name : AI431067

name	(CDS detail)
type	STS
link
xref	UniSTS:248487
definition	standard_name : BF413022

name	(CDS detail)
type	STS
link
xref	UniSTS:178376
definition	standard_name : AI647574

clone name	MSMg01-265O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-161O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529D09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-176L19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-143J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-238I04.b	B6Ng01-238I04.g
ACC	GA049185	GA049186
length	906	1,009
definition	B6Ng01-238I04.b	B6Ng01-238I04.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcacatacatgagtatatcagaactgtacctattcaaactaccaca ttgttgtttgtttgcttgcttttgtgagacagagtcacctgtagtctaga ctggactcaaacttaaatatggccatgaacttctttctaatccttttgcc tctaactcctgagttctgggaacacaggcatacattaccatatccagttt tatgcagtgttggggaagatatccagatatttgtgcttgatatttgtgat ggcttaagtgagaaatgtcccttccattagattgggtatttgacactttg ttcccagttggtgactctgtttggggagcattaggagggatgaggttggc attccacagtcaaaaattctgacccagtattgctccggtctaaatgaact gcagggacaaaaatggagatgagaccgagggaaaggaggtccagtgacca gctcaactgggatccatctcaaggggatgctccaaggcctgacactatta ctgatgctatggtgtgcttacagacaggagccaagtatagctgtcctctg agaggcccaacaagcagatgactgaggcacatgcagataccacacagata cctaactattgggttaaagtcaggggacccctgtggttgaattagggaaa ggctgaaagaagctgaggagtagggtgaccccataggaagatcagcagtc tgaactaacctgaaacccctgagatcactcagacactgagccaccagcca ggaagaatatactagctggtcagaggcccctgacacatatacagcagagg actgtctggtctggcctcagtgggagaagatgcacctaacccttgagaga ctttgaggctcagtggagtgggggagaccctgatggaggttggaggtggg gatgtt	gaattcatgtgtactcgttacaacagacccagagatggcagagaggaaag agcacacacttaagggagaaagttaagcaaaggtgggggtctctcctgca gtctattggtcacctggccctcagggggctctggggtgtgaggtgcccta gggagccatcgggctgaaggccaagcttctgtcagtctttagttagctgt gagcttccccaggagatggcctaaggcccccagcttctattaacctaggg aggttctctggaggacaggggaactgtgagccattagctgctaagcactc aaataagatgggggttaaaaggattctgcagaaacccacagcatctccct aggcagacattattagtatgccacggccatctccacagcaggtcccaatt atgtttgttcagtgccttccaactcactctggaccttgccttgggctcat cgtagaatgtcatttacctgggctttccaagtgacacggcactgtatgct cagaaatccttcagtgcttcttagagcctaggcttctatagttactcatt gcctttgaatgccttcagattaccacccaggcatgcaattgctttcctat taagcctggaacctccctccagttatagattgtggcaataagtggaaatc tattaacctgtagcctttagccctatgctagaggctttagagatgcatca gaaggcccaatcctgtgcaggtgtcaagagtaacaatagaaaccaataag agcacacactttgaagtactttctgtttgctcaggacctctctcactctc catttggccagtaggccattttaggcaggcaagtatagaaataaccttag caacttgacacgctactttgatcagtagcccatcctttctctaaactgcc agaaacttatcagcaacttgggatccctctggcatctcacatatacccta ccttcagaccatggaaatggagttcctttccttagaccctttaaatgatt attccattt
quality values	Open. Hide. 47 31 11 20 58 25 16 40 35 62 62 47 35 54 62 46 62 62 42 47 56 47 25 21 56 62 62 62 62 62 62 62 39 42 34 28 32 32 16 21 51 51 62 59 59 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 51 59 59 51 32 42 40 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 54 62 59 62 62 59 59 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 49 54 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 43 44 62 62 62 62 51 62 62 62 62 62 47 38 62 62 62 62 43 35 62 62 62 48 62 62 62 47 52 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 54 54 58 58 58 58 58 58 52 54 52 54 58 54 58 58 58 54 52 58 36 37 58 54 58 54 54 52 47 46 54 54 52 43 52 48 53 58 58 58 39 54 38 45 34 58 37 42 58 58 41 58 54 58 54 50 54 43 58 58 52 58 58 58 22 42 52 49 52 54 58 58 58 58 54 54 50 50 48 54 39 51 41 51 53 42 49 51 50 58 58 54 53 58 54 49 35 54 58 58 47 50 53 58 53 58 58 47 50 52 53 41 58 58 58 42 25 58 58 58 52 58 49 49 51 46 49 50 50 51 42 42 33 37 49 48 58 58 48 50 58 46 58 54 58 41 58 32 58 51 40 54 58 51 58 10 48 54 15 37 16 9 34 50 36 51 41 15 8 23 33 25 53 49 40 58 51 51 31 37 50 34 42 42 51 40 37 41 39 53 50 51 41 37 41 39 41 33 33 46 46 21 50 10 17 50 50 41 45 45 53 29 42 52 31 39 38 49 34 34 28 40 18 30 37 40 53 42 26 46 35 32 37 49 35 24 44 50 31 28 46 47 35 21 38 31 33 19 40 21 41 35 37 18 28 52 32 51 31 32 33 30 53 10 35 25 40 38 16 22 31 31 21 19 31 17 52 37 40 28 41 32 39 45 52 18 51 18 28 20 21 32 32 32 31 34 32 40 30 31 32 32 47 29 22 41 36 21 21 24 28 46 19 47 12 29 31 27 34 32 33 31 27 29 30 42 31 30 34 51 45 31 45 30 38 12 51 21 42 14 11 51 23 28 34 10 24 23 32 19 16 11 32 45 26 31 16 18 31 51 46 46 12 28 13 25 12 32 7 25 32 25 15 24 29 24 15 11 16 33 22 17 21 6 6 12 10 16 9 9 7 11 9 6 6	Open. Hide. 62 47 51 44 59 59 44 59 62 62 62 24 19 34 23 23 13 28 43 43 51 35 32 62 43 51 62 62 62 62 59 49 59 59 49 46 62 62 62 59 51 62 46 33 54 62 62 62 54 56 62 62 59 59 62 62 54 38 49 51 46 45 40 48 34 24 18 7 18 13 13 62 62 62 62 62 62 59 59 59 56 59 62 56 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 59 56 59 59 62 56 59 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 54 59 59 59 59 62 59 62 59 62 62 62 59 59 62 59 62 59 62 62 62 62 56 62 62 59 49 51 50 43 51 51 50 59 62 56 62 54 62 56 50 62 56 56 56 54 56 59 62 62 62 62 34 24 23 13 13 24 62 18 24 13 23 13 19 62 62 62 62 62 62 62 62 59 59 62 56 54 56 56 59 59 56 46 59 59 54 54 56 62 62 62 62 56 59 59 59 62 59 59 59 62 59 59 49 62 62 54 62 59 59 62 59 59 62 62 62 62 62 59 62 62 59 59 62 62 62 59 59 59 54 56 59 59 59 62 62 62 59 59 62 59 62 62 62 62 59 59 51 56 59 43 56 62 62 62 62 62 59 62 59 62 59 56 59 59 59 59 59 62 59 62 50 51 59 56 56 59 51 59 59 62 62 62 62 62 59 56 56 54 56 59 59 62 59 59 62 62 59 56 51 38 23 56 50 56 59 56 56 59 62 59 40 59 59 59 62 59 59 59 59 59 62 59 43 30 34 23 50 41 59 62 59 59 62 59 59 59 59 62 62 62 59 59 54 62 59 59 59 62 59 62 59 62 59 62 18 24 17 11 18 18 13 39 13 18 17 23 59 62 59 62 59 59 62 59 54 43 62 59 62 59 59 45 59 62 56 59 59 59 59 59 59 29 46 59 59 51 56 59 59 46 59 62 59 62 59 56 56 44 59 59 59 59 62 56 62 59 62 62 51 59 59 43 39 44 18 44 27 20 32 9 19 16 51 56 44 56 56 56 62 51 51 44 56 56 51 51 44 44 35 51 51 56 47 43 56 51 56 42 51 42 42 38 39 62 47 37 39 62 62 47 56 43 14 47 47 54 62 56 62 62 47 26 14 9 9 30 27 47 31 56 50 31 56 32 62 41 47 62 43 62 42 47 62 39 41 42 39 52 46 43 34 50 52 43 52 62 62 52 47 42 52 28 38 42 46 41 43 45 31 27 54 50 62 47 47 54 22 16 34 17 21 26 54 39 48 54 52 52 50 50 52 49 42 35 35 25 11 21 28 38 54 50 41 54 33 52 48 41 51 35 46 46 31 42 26 52 47 29 11 52 37 52 40 37 46 28 33 39 27 47 42 26 22 13 33 33 52 33 54 42 35 32 37 42 41 49 41 40 47 24 30 21 35 41 29 58 50 40 19 18 8 13 15 27 47 40 40 45 40 50 50 46 25 43 48 50 51 41 39 24 33 35 26 42 32 50 50 50 37 36 39 53 38 43 29 39 53 37 40 37 46 22 35 39 32 31 13 39 32 28 15 20 25 9 19 8 26 16 6 31 29 50 29 26 18 16 49 49 18 9 22 32 28 10 11 14 28 32 50 16 50 30 39 40 21 32 28 29 23 32 29 37 49 40 23 21 22 13 39 35 46 31 35 19 37 16 32 23 21 32 42 53 39 33 38 22 13 14 19 13 23 33 52 33 52 39 53 51 29 26 53 30 17 13 22 32 26 17 14 25 37 42 36 15 7 17 33 40 32 30 33 22 29 32 32 11 12 11 12 30 11 9 15 17 28 11 14 14 15 31 32 22 34 32 30 29 21 9 19 16 21 16 21 10 12 21 29 18 12 51 12 30 28 22 18 24 10 10 18 9 30 30 26 31 30 17 28 28 16 18 27 8 13 19 32 33 31 33 33 21 30 25 7 6 10 27 46 30 25 37 27 27 20 15 32 18 6 13 6 6 14 31 17 42 24 9 19 31 14 36 18 24 38 38 28 14 7 28 18 11 11 15 23 9 8 17 21 15 14 11 41 29 9 26 19 44 29 12 31 9 7 29 32 18 12 8 21 7 13 6 7 5 6 10 21 31 32 38 9 30 11 10 31 14 18 8 5 17 9 25 14 11 18 25 13 38 21 9 10 6 11 10 26 21 28 25 13 25 12 22 11 4 9 5 5 4 5 25 30 23 34 26 10 39 13 8 21 9 7 5 7 7 5 15 12 27 27 32 29

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_35447848_35448851
seq2: B6Ng01-238I04.g_71_1079

seq1  GAATTCATGTGTACTCGTTACAACAGACCCAGAGATGGCAGAGAGGAAAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGTGTACTCGTTACAACAGACCCAGAGATGGCAGAGAGGAAAG  50

seq1  AGCACACACTTAAGGGAGAAAGTTAAGCAAAGGTGGGGGTCTCTCCTGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACACACTTAAGGGAGAAAGTTAAGCAAAGGTGGGGGTCTCTCCTGCA  100

seq1  GTCTATTGGTCACCTGGCCCTCAGGGGGCTCTGGGGTGTGAGGTGCCCTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTATTGGTCACCTGGCCCTCAGGGGGCTCTGGGGTGTGAGGTGCCCTA  150

seq1  GGGAGCCATCGGGCTGAAGGCCAAGCTTCTGTCAGTCTTTAGTTAGCTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGCCATCGGGCTGAAGGCCAAGCTTCTGTCAGTCTTTAGTTAGCTGT  200

seq1  GAGCTTCCCCAGGAGATGGCCTAAGGCCCCCAGCTTCTATTAACCTAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTTCCCCAGGAGATGGCCTAAGGCCCCCAGCTTCTATTAACCTAGGG  250

seq1  AGGTTCTCTGGAGGACAGGGGAACTGTGAGCCATTAGCTGCTAAGCACTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTCTCTGGAGGACAGGGGAACTGTGAGCCATTAGCTGCTAAGCACTC  300

seq1  AAATAAGATGGGGGTTAAAAGGATTCTGCAGAAACCCACAGCATCTCCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGATGGGGGTTAAAAGGATTCTGCAGAAACCCACAGCATCTCCCT  350

seq1  AGGCAGACATTATTAGTATGCCACGGCCATCTCCACAGCAGGTCCCAATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGACATTATTAGTATGCCACGGCCATCTCCACAGCAGGTCCCAATT  400

seq1  ATGTTTGTTCAGTGCCTTCCAACTCACTCTGGACCTTGCCTTGGGCTCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTTGTTCAGTGCCTTCCAACTCACTCTGGACCTTGCCTTGGGCTCAT  450

seq1  CGTAGAATGTCATTTACCTGGGCTTTCCAAGTGACACGGCACTGTATGCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTAGAATGTCATTTACCTGGGCTTTCCAAGTGACACGGCACTGTATGCT  500

seq1  CAGAAATCCTTCAGTGCTTCTTAGAGCCTAGGCTTCTATAGTTACTCATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAATCCTTCAGTGCTTCTTAGAGCCTAGGCTTCTATAGTTACTCATT  550

seq1  GCCTTTGAATGCCTTCAGATTACCACCCAGGCATGCAATTGCTTTCCTAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTTGAATGCCTTCAGATTACCACCCAGGCATGCAATTGCTTTCCTAT  600

seq1  TAAGCCTGGAACCTCCCTCCAG-TATAGATTGTGGCAATAAGTGGAAATC  649
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  TAAGCCTGGAACCTCCCTCCAGTTATAGATTGTGGCAATAAGTGGAAATC  650

seq1  CATTAACCTGTAGCCTTTAGCCCTATGCTAGAGGCTTTAGAGATGCATCA  699
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTAACCTGTAGCCTTTAGCCCTATGCTAGAGGCTTTAGAGATGCATCA  700

seq1  GAAGGCCCAATCCTGTGCAGGTGTCAAGAGTAACAATAGAAACCAATAAG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGCCCAATCCTGTGCAGGTGTCAAGAGTAACAATAGAAACCAATAAG  750

seq1  AGCACACACTTTGAAGTACTTTCTGTTTGCTCAGGACCTCTCTCACTCTC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACACACTTTGAAGTACTTTCTGTTTGCTCAGGACCTCTCTCACTCTC  800

seq1  CATTTTGTCAAGTAGGCCATTTTAGGCAGGCAAGTATAGAAATAACC-TA  848
      || |||| | ||||||||||||||||||||||||||||||||||||| ||
seq2  CA-TTTGGCCAGTAGGCCATTTTAGGCAGGCAAGTATAGAAATAACCTTA  849

seq1  GCAACTTGACACGCTACTTTGATCAGTAAGCCCATCCTTTTCCTAAACTG  898
      ||||||||||||||||||||||||||| ||||||||||||  ||||||||
seq2  GCAACTTGACACGCTACTTTGATCAGT-AGCCCATCCTTTCTCTAAACTG  898

seq1  CCAGAAACCTATCAGCAACCTGGGATCCCTCCTGCATCTCACATATACCC  948
      |||||||| |||||||||| |||||||||||  |||||||||||||||||
seq2  CCAGAAACTTATCAGCAACTTGGGATCCCTCTGGCATCTCACATATACCC  948

seq1  -AACTTCAGACCATGGAAAT-GAGTTCCTTCCCTTAGACCCTTT-AATGA  995
       | ||||||||||||||||| ||||||||| ||||||||||||| |||||
seq2  TACCTTCAGACCATGGAAATGGAGTTCCTTTCCTTAGACCCTTTAAATGA  998

seq1  T--ATCCATTT  1004
      |   |||||||
seq2  TTATTCCATTT  1009

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information