MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-247L14
Chromosome	1 (Build37)
Map Location	95,514,762 - 95,593,572
singlet/doublet	doublet
Overlap gene	Farp2, Stk25, Bok
Upstream gene	Olfr12, Myeov2, Otos, Gpc1, Ankmy1, Dusp28, LOC100040511, Rnpepl1, Capn10, Gpr35, Aqp12, Kif1a, Agxt, 2310007B03Rik, E030010N08Rik, Sned1, Mterfd2, LOC665966, Pask, Ppp1r7, Tmem16g, Hdlbp, Sept2
Downstream gene	Thap4, Atg4b, Dtymk, Ing5, D2hgdh, Gal3st2, LOC100041596, EG666009, EG619597, Neu4, Pdcd1, LOC666012, LOC666025
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257890 MGI:107863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myeov2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66915 MGI:1914165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 143 ESTs

name	Otos (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260301 MGI:2672814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14733 MGI:1194891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankmy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241158 MGI:3045261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67446 MGI:1914696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rnpepl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108657 MGI:1914170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23830 MGI:1344392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64095 MGI:1929509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208760 MGI:2664636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16560 MGI:108391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agxt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11611 MGI:1329033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310007B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71874 MGI:1919124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E030010N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381284 MGI:3045962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Sned1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208777 MGI:3045960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mterfd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69821 MGI:1918355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins pseudo : _no_value

name	Pask (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269224 MGI:2155936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66385 MGI:1913635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404545 MGI:3052714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdlbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110611 MGI:99256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18000 MGI:97298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Farp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227377 MGI:2385126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59041 MGI:1891699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bok (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51800 MGI:1858494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67026 MGI:1914276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66615 MGI:1913865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtymk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21915 MGI:108396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ing5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66262 MGI:1922816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2hgdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98314 MGI:2138209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381334 MGI:2685834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 83 ESTs, 9 Proteins

name	EG666009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666009 MGI:3648247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins

name	EG619597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619597 MGI:3646771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neu4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241159 MGI:2661364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18566 MGI:104879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC666025 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 130 ESTs, 30 Proteins pseudo : _no_value

name	Olfr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047463 GeneID:257890 MGI:107863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 12 transcript_id : NM_206896.1

name	Myeov2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234223 GeneID:66915 MGI:1914165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 143 ESTs product : myeloma overexpressed 2 transcript_id : XM_888711.3

name	Otos (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896643 GeneID:260301 MGI:2672814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otospiralin transcript_id : NM_153114.2

name	Gpc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802707 GeneID:14733 MGI:1194891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 1 transcript_id : NM_016696.2

name	Ankmy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356868 GeneID:241158 MGI:3045261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and MYND domain containing 1 transcript_id : NM_172850.2

name	Dusp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75750527 GeneID:67446 MGI:1914696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 28 transcript_id : NM_175118.3

name	LOC100040511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234195 GeneID:100040511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040511 transcript_id : XM_001474840.1

name	Rnpepl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340969 GeneID:108657 MGI:1914170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginyl aminopeptidase (aminopeptidase B)-like 1 transcript_id : NM_181405.2

name	Capn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87080822 GeneID:23830 MGI:1344392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 10 transcript_id : NM_011796.2

name	Gpr35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356082 GeneID:64095 MGI:1929509
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 35 transcript_id : NM_022320.3

name	Aqp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29243943 GeneID:208760 MGI:2664636
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 12 transcript_id : NM_177587.1

name	Kif1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801924 GeneID:16560 MGI:108391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1A transcript_id : NM_008440.2

name	Agxt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038129 GeneID:11611 MGI:1329033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanine-glyoxylate aminotransferase transcript_id : NM_016702.2

name	2310007B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803386 GeneID:71874 MGI:1919124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310007B03 gene transcript_id : NM_172411.3

name	E030010N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234197 GeneID:381284 MGI:3045962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA E030010N08 gene transcript_id : XM_001474855.1

name	Sned1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254324 GeneID:208777 MGI:3045960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi, nidogen and EGF-like domains 1 transcript_id : NM_172463.3

name	Mterfd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852399 GeneID:69821 MGI:1918355
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MTERF domain containing 2 transcript_id : NM_178051.3

name	Pask (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18497291 GeneID:269224 MGI:2155936
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PAS domain containing serine/threonine kinase transcript_id : NM_080850.1

name	Ppp1r7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892536 GeneID:66385 MGI:1913635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 7 transcript_id : NM_023200.2

name	Tmem16g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309608 GeneID:404545 MGI:3052714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16g transcript_id : NM_207031.1

name	Hdlbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801781 GeneID:110611 MGI:99256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high density lipoprotein (HDL) binding protein transcript_id : NM_133808.3

name	Sept2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754815 GeneID:18000 MGI:97298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 2 transcript_id : NM_010891.1

name	Farp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704021 GeneID:227377 MGI:2385126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM, RhoGEF and pleckstrin domain protein 2 transcript_id : NM_145519.1

name	Stk25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337276 GeneID:59041 MGI:1891699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 25 (yeast) transcript_id : NM_021537.3

name	Bok (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131154 GeneID:51800 MGI:1858494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl-2-related ovarian killer protein transcript_id : NM_016778.2

name	Thap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750224 GeneID:67026 MGI:1914276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing 4 transcript_id : NM_025920.3

name	Atg4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801870 GeneID:66615 MGI:1913865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 4B (yeast) transcript_id : NM_174874.2

name	Dtymk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963516 GeneID:21915 MGI:108396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxythymidylate kinase transcript_id : NM_023136.1

name	Ing5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037408 GeneID:66262 MGI:1922816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of growth family, member 5 transcript_id : NM_025454.2

name	D2hgdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341040 GeneID:98314 MGI:2138209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D-2-hydroxyglutarate dehydrogenase transcript_id : NM_178882.2

name	Gal3st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387728 GeneID:381334 MGI:2685834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 2 transcript_id : NM_199366.3

name	LOC100041596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234225 GeneID:100041596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 8 Proteins product : similar to galactose 3-O-sulfotransferase-2, transcript variant 2 transcript_id : XM_001477538.1

name	LOC100041596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234227 GeneID:100041596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 10 ESTs, 8 Proteins product : similar to galactose 3-O-sulfotransferase-2, transcript variant 1 transcript_id : XM_001477518.1

name	EG666009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234204 GeneID:666009 MGI:3648247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : predicted gene, EG666009 transcript_id : XM_980899.2

name	EG619597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350327 GeneID:619597 MGI:3646771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG619597 transcript_id : NM_001039219.2

name	Neu4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271519 GeneID:241159 MGI:2661364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialidase 4 transcript_id : NM_173772.3

name	Pdcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679238 GeneID:18566 MGI:104879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death 1 transcript_id : NM_008798.1

name	Olfr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047464 CCDS:CCDS15174.1 GeneID:257890 MGI:107863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81134096-81133095 product : olfactory receptor 12 protein_id : NP_996779.1

name	Myeov2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82881000 GeneID:66915 MGI:1914165
definition	codon_start : 1 product : hypothetical protein LOC66915 protein_id : XP_893804.1

name	Otos (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346551 GeneID:260301 MGI:2672814
definition	GO_process : GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 note : organ of Corti 10 kDa protein product : otospiralin protein_id : NP_694754.1

name	Gpc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710028 CCDS:CCDS15177.1 GeneID:14733 MGI:1194891
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : glypican 1 protein_id : NP_057905.1

name	Ankmy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370284 CCDS:CCDS15178.1 GeneID:241158 MGI:3045261
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat and MYND domain containing 1 protein_id : NP_766438.1

name	Dusp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29171320 CCDS:CCDS15179.1 GeneID:67446 MGI:1914696
definition	GO_function : GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 28 protein_id : NP_780327.1

name	LOC100040511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234196 GeneID:100040511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474890.1

name	Rnpepl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088904 CCDS:CCDS15180.1 GeneID:108657 MGI:1914170
definition	GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0004179 - membrane alanyl aminopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arginyl aminopeptidase (aminopeptidase B)-like 1 protein_id : NP_852070.1

name	Capn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87080823 CCDS:CCDS15181.1 GeneID:23830 MGI:1344392
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004198 - calpain activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : calpain 8 product : calpain 10 protein_id : NP_035926.2

name	Gpr35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560294 CCDS:CCDS15182.1 GeneID:64095 MGI:1929509
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G-protein coupled receptor; internal gene name of KIRIN laboratory:M20 product : G protein-coupled receptor 35 protein_id : NP_071715.2

name	Aqp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243944 CCDS:CCDS15183.1 GeneID:208760 MGI:2664636
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : aquaporin 12 protein_id : NP_808255.1

name	Kif1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680558 GeneID:16560 MGI:108391
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : kinesin heavy chain member 1A; N-3 kinesin product : kinesin family member 1A protein_id : NP_032466.1

name	Agxt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111038130 CCDS:CCDS15184.1 GeneID:11611 MGI:1329033
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008453 - alanine-glyoxylate transaminase activity [Evidence IEA]; GO:0004760 - serine-pyruvate transaminase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : alanine-glyoxylate aminotransferase 1 product : alanine-glyoxylate aminotransferase protein_id : NP_057911.2

name	2310007B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59709443 CCDS:CCDS15185.1 GeneID:71874 MGI:1919124
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC71874 protein_id : NP_765999.2

name	E030010N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234198 GeneID:381284 MGI:3045962
definition	codon_start : 1 product : similar to ciliary rootlet coiled-coil, rootletin protein_id : XP_001474905.1

name	Sned1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254325 GeneID:208777 MGI:3045960
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation function : extracellular matrix component note : secreted protein SST3 product : secreted nidogen domain protein protein_id : NP_766051.3

name	Mterfd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017341 GeneID:69821 MGI:1918355
definition	codon_start : 1 product : MTERF domain containing 2 protein_id : NP_835152.1

name	Pask (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18497292 CCDS:CCDS15186.1 GeneID:269224 MGI:2155936
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : putative sensor protein note : paskin product : PAS domain containing serine/threonine kinase protein_id : NP_543126.1

name	Ppp1r7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963569 CCDS:CCDS15187.1 GeneID:66385 MGI:1913635
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : protein phosphatase-1 regulatory subunit 7 protein_id : NP_075689.1

name	Tmem16g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309609 CCDS:CCDS15188.1 GeneID:404545 MGI:3052714
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] codon_start : 1 note : new gene expressed in prostate; prostate cancer associated protein 5 product : transmembrane protein 16g protein_id : NP_996914.1

name	Hdlbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527028 CCDS:CCDS15189.1 GeneID:110611 MGI:99256
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vigilin product : high density lipoprotein binding protein protein_id : NP_598569.1

name	Sept2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754816 CCDS:CCDS15190.1 GeneID:18000 MGI:97298
definition	GO_component : GO:0005826 - contractile ring [Evidence NAS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence NAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence NAS] codon_start : 1 function : cytoskeletal component interacting with actin-based structures note : neural precursor cell expressed, developmentally down-regulated gene 5 product : septin 2 protein_id : NP_035021.1

name	Farp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704022 CCDS:CCDS15191.1 GeneID:227377 MGI:2385126
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016322 - neuron remodeling [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : FERM, RhoGEF and pleckstrin domain protein 2 protein_id : NP_663494.1

name	Stk25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89337277 CCDS:CCDS15192.1 GeneID:59041 MGI:1891699
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Ste20-like kinase; serine/threonine kinase 25 (Ste20, yeast homolog); Yeast Sps1/Ste20-related kinase 1 product : serine/threonine kinase 25 protein_id : NP_067512.3

name	Bok (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949082 CCDS:CCDS15193.1 GeneID:51800 MGI:1858494
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : apoptosis activator product : Bcl-2-related ovarian killer protein-like protein_id : NP_058058.1

name	Thap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750225 CCDS:CCDS15194.1 GeneID:67026 MGI:1914276
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : THAP domain containing 4 protein_id : NP_080196.3

name	Atg4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883848 CCDS:CCDS15195.1 GeneID:66615 MGI:1913865
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0005875 - microtubule associated complex [Evidence ISS] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence ISS]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0000045 - autophagic vacuole formation [Evidence ISS]; GO:0006914 - autophagy [Evidence ISS]; GO:0006612 - protein targeting to membrane [Evidence ISS]; GO:0006623 - protein targeting to vacuole [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : cysteine protease involved in autophagy APG4-B; autophagy-related 4B-like; AUT-like 1, cysteine endopeptidase; APG4 (ATG4) autophagy-related homolog B product : autophagin 1 protein_id : NP_777363.1

name	Dtymk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963517 GeneID:21915 MGI:108396
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004798 - thymidylate kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006233 - dTDP biosynthesis [Evidence IEA]; GO:0006235 - dTTP biosynthesis [Evidence IEA]; GO:0009165 - nucleotide biosynthesis [Evidence IEA] codon_start : 1 note : thymidylate kinase product : deoxythymidylate kinase protein_id : NP_075625.1

name	Ing5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313552 GeneID:66262 MGI:1922816
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : inhibitor of growth family, member 5 protein_id : NP_079730.1

name	D2hgdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725722 CCDS:CCDS15196.1 GeneID:98314 MGI:2138209
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : D-2-hydroxyglutarate dehydrogenase protein_id : NP_849213.1

name	Gal3st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861156 CCDS:CCDS15197.1 GeneID:381334 MGI:2685834
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoprotein beta-Gal 3-sulfotransferase-like; galactose 3-O-sulfotransferase 2 product : galactose-3-O-sulfotransferase 2 protein_id : NP_955398.2

name	LOC100041596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234226 GeneID:100041596
definition	codon_start : 1 product : similar to galactose 3-O-sulfotransferase-2 isoform 2 protein_id : XP_001477588.1

name	LOC100041596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234228 GeneID:100041596
definition	codon_start : 1 product : similar to galactose 3-O-sulfotransferase-2 isoform 1 protein_id : XP_001477568.1

name	EG666009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234205 GeneID:666009 MGI:3648247
definition	codon_start : 1 product : similar to D2hgdh protein protein_id : XP_985993.2

name	EG619597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986609 GeneID:619597 MGI:3646771
definition	codon_start : 1 product : hypothetical protein LOC619597 protein_id : NP_001034308.1

name	Neu4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424629 CCDS:CCDS15199.1 GeneID:241159 MGI:2661364
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0019866 - organelle inner membrane [Evidence ISS] GO_function : GO:0004308 - exo-alpha-sialidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : sialidase 4 protein_id : NP_776133.1

name	Pdcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679239 CCDS:CCDS15200.1 GeneID:18566 MGI:104879
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : programmed cell death 1 protein_id : NP_032824.1

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 1 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 2 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 3 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 4 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 5 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 6 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:491961
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125100
definition	standard_name : MHAa27a6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:498343
definition	standard_name : Gpc1

name	(CDS detail)
type	STS
link
xref	UniSTS:498431
definition	standard_name : Gpc1

name	(CDS detail)
type	STS
link
xref	UniSTS:466038
definition	standard_name : Gpc1

name	(CDS detail)
type	STS
link
xref	UniSTS:207191
definition	standard_name : AW555635

name	(CDS detail)
type	STS
link
xref	UniSTS:123433
definition	standard_name : 19.MMHAP66FLG1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158835
definition	standard_name : AI462976

name	(CDS detail)
type	STS
link
xref	UniSTS:128731
definition	standard_name : D1Mit371.1

name	(CDS detail)
type	STS
link
xref	UniSTS:491841
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178437
definition	standard_name : AV005521

name	(CDS detail)
type	STS
link
xref	UniSTS:165091
definition	standard_name : AI894167

name	(CDS detail)
type	STS
link
xref	UniSTS:158834
definition	standard_name : AI430010

name	(CDS detail)
type	STS
link
xref	UniSTS:178441
definition	standard_name : AW049679

name	(CDS detail)
type	STS
link
xref	UniSTS:128820
definition	standard_name : D1Mit45

name	(CDS detail)
type	STS
link
xref	UniSTS:124822
definition	standard_name : D29951

name	(CDS detail)
type	STS
link
xref	UniSTS:163258
definition	standard_name : D29951

name	(CDS detail)
type	STS
link
xref	UniSTS:224090
definition	standard_name : Agxt

name	(CDS detail)
type	STS
link
xref	UniSTS:124732
definition	standard_name : D17849

name	(CDS detail)
type	STS
link
xref	UniSTS:94223
definition	standard_name : G42365

name	(CDS detail)
type	STS
link
xref	UniSTS:163078
definition	standard_name : RH126370

name	(CDS detail)
type	STS
link
xref	UniSTS:123372
definition	standard_name : 18.MMHAP23FLF3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:209949
definition	standard_name : RH135953

name	(CDS detail)
type	STS
link
xref	UniSTS:178438
definition	standard_name : AI642697

name	(CDS detail)
type	STS
link
xref	UniSTS:271769
definition	standard_name : PMC193927P1

name	(CDS detail)
type	STS
link
xref	UniSTS:124152
definition	standard_name : 35.MMHAP65FRD11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158833
definition	standard_name : AI118566

name	(CDS detail)
type	STS
link
xref	UniSTS:243391
definition	standard_name : AI009079

name	(CDS detail)
type	STS
link
xref	UniSTS:158832
definition	standard_name : AA960365

name	(CDS detail)
type	STS
link
xref	UniSTS:167260
definition	standard_name : D1Ertd101e

name	(CDS detail)
type	STS
link
xref	UniSTS:185447
definition	standard_name : BB136667

name	(CDS detail)
type	STS
link
xref	UniSTS:122757
definition	standard_name : 03.MMHAP94FRA9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128901
definition	standard_name : D1Mit534

name	(CDS detail)
type	STS
link
xref	UniSTS:234178
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128920
definition	standard_name : D1Mit60

name	(CDS detail)
type	STS
link
xref	UniSTS:210452
definition	standard_name : RH136467

name	(CDS detail)
type	STS
link
xref	UniSTS:207193
definition	standard_name : C86992

name	(CDS detail)
type	STS
link
xref	UniSTS:158836
definition	standard_name : C86992

name	(CDS detail)
type	STS
link
xref	UniSTS:178442
definition	standard_name : AI042849

name	(CDS detail)
type	STS
link
xref	UniSTS:47827
definition	standard_name : D1S2869

name	(CDS detail)
type	STS
link
xref	UniSTS:165092
definition	standard_name : AI847676

name	(CDS detail)
type	STS
link
xref	UniSTS:210437
definition	standard_name : RH136451

name	(CDS detail)
type	STS
link
xref	UniSTS:248145
definition	standard_name : AA924144

name	(CDS detail)
type	STS
link
xref	UniSTS:207192
definition	standard_name : BB130418

name	(CDS detail)
type	STS
link
xref	UniSTS:234179
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165093
definition	standard_name : AW048066

name	(CDS detail)
type	STS
link
xref	UniSTS:163134
definition	standard_name : RH126426

name	(CDS detail)
type	STS
link
xref	UniSTS:158837
definition	standard_name : AU044245

name	(CDS detail)
type	STS
link
xref	UniSTS:209965
definition	standard_name : RH135969

name	(CDS detail)
type	STS
link
xref	UniSTS:165090
definition	standard_name : AI325464

name	(CDS detail)
type	STS
link
xref	UniSTS:165090
definition	standard_name : AI325464

name	(CDS detail)
type	STS
link
xref	UniSTS:163259
definition	standard_name : X67914

name	(CDS detail)
type	STS
link
xref	UniSTS:128856
definition	standard_name : D1Mit489

name	LOC665966 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234199 GeneID:665966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : similar to hCG1641837 pseudo : _no_value transcript_id : XR_031959.1

name	LOC666025 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234229 GeneID:666025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 130 ESTs, 30 Proteins product : similar to magnesium dependent protein phosphatase beta-1 pseudo : _no_value transcript_id : XR_033301.1

clone name	MSMg01-412H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308L8
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-104J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-376B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496C24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-247L14.b	B6Ng01-247L14.g
ACC	GA055985	GA055986
length	1,117	1,086
definition	B6Ng01-247L14.b	B6Ng01-247L14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(95,514,762 - 95,515,861)	(95,592,475 - 95,593,572)
sequence	gaattcttccagtataatccctgctcagtgaaatctgatctggttttcct ccaccaggaaatgccaccttagtcatgaaccagatccaatcctgtgagac ttctggtaataaactaattccagcactggtgcctgccctgcttccccagc tcaccctagtaacaggctggagaaggcatgtttctgattatcctcaagac ccagggagtggagcagatgcccaaaccagacctgtcccctgattcaaagg acaggactccagggtgggtaggaagagcttccccaaggaggcagctaact taactttctcctttacagcactcggctagaaaaggaaaagtggatgcagg acctgaatgcagcaatccaagcagccaagactatcggtgactcaccccca gtgctgctgggaggcccggtgtatactcgtacccctagtgagttttgact caagacaccccaagagatgccctctgtagctctgaaagctttcctaaaaa ttgttttcctgaccttggccagcctaccaggtcccatgagtttccttccc cacacaagaaaaactagtggccatgcctaggtagaagagttcttgggctg tcctagcaccatgattttgtctggctgttgattgggtaccaagagcctat ttcccagatcctggaggagcctcatgggtgagtggtaccagctgctaact ttcctcaggatcttctgatgaagtctctctggaagaatcagaagatggtc gaggaaaccggggctccctggaggggaacagccagcaccgggccaataca acaatgcatgtgtgctggtaccgtaatacaagtgtgtccagagcagacca cagtgcagctgttgaggtatggctgtcatgagcatacatgtgggccaccc actcacctccactccccacccccacccctcgtgtgctggcttactggggg agggagcccagtcagacagctttcctcctctccctcatctacttaagctc tctgggactttcaaccaaatgtttattctgttatctcataaggacagttc aaaaaacaggaggcagcagtttcatctacgattggggatttggcctaaac agcctcaagggacactg	gaattccatttgaacagtctccaaatgaacctggccttccctatattttg aatatctctattgctacgtcattccctagactaacacagagctctctact gttaggacaggccgactggagaaccaaaatcagaaccctaccctcaagtg tcaccagacaaagctttcatatctctaaagtttctaaaatgggctgccag acatcctcaagtggctcagcctacagcaaagggctcattgcctctttgac ctccacagggatgtgaaccccatataactacagggcttccctcagtttga cacagcacaccccaacacacacagcctggcagggggcaagctgctaggct aggtcaagtcaaaaagaaacacagacagactgggcatagtcagccagcac atacctccagtgctacagggctggctgggtctcccaaacactcccattgc ctgacttagacatcaggaaaggctggcttttgggagcctagtgaatgtat aaggagaagatacaggcctgagtgaatgtggaccgtttgatgtaggcatg accgtgtcaaggagccaatgcctcagacccataggcaggtaaagccctcc tttggtctgaatggctattggcaggatgggcatgtatgagcatttatgaa tgattgaccagtgcatacaaaaaactagcgactgcagcttcctcctcaag atgattacagcctgagactgtacctatagacatctactaaggctagctac ccccccccctccatgctatacataataactgtgctgaggttccaggttgc tgcagggccgtcagagtgggcacatcccacctaaccgcaactgttataca catttttgtttcatttttgtttttttccatacagggtttctctatcgccc tggctgtcctggaaactcactctgtagaccagacttggcctcaaactcag aatccaacttgcctctgcttcccaagtgctggataaaggcgtgcgcacca cgtctgctgcactgttctaccatgtgactggtggcgtcttcttatcctca cggtcttagagactgattcctaagctattcagacac
quality values	Open. Hide. 49 29 22 26 58 58 58 58 62 31 18 62 47 47 49 62 62 47 62 62 62 62 62 62 62 47 39 62 62 62 44 51 27 28 56 35 33 28 44 56 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 51 54 62 62 62 62 62 62 62 62 49 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 58 54 58 58 58 58 54 58 49 58 58 54 54 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 54 54 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 54 54 58 53 58 58 58 58 58 54 48 58 58 58 49 58 58 53 58 50 58 51 52 54 58 58 49 58 58 58 58 51 48 47 51 53 50 54 52 47 47 49 58 45 45 58 58 58 58 58 58 53 58 58 58 50 58 58 58 58 58 41 39 58 58 58 58 48 40 37 50 46 51 43 58 46 48 44 51 54 53 58 49 50 49 50 50 41 58 52 50 54 58 58 50 39 30 58 58 21 54 44 49 50 39 50 58 58 58 51 58 51 30 50 51 54 40 39 39 50 50 50 51 53 54 50 49 38 44 44 54 51 39 40 50 51 52 49 9 49 44 35 41 49 51 51 52 51 47 32 45 54 54 39 51 39 47 49 54 37 28 38 54 51 39 26 49 41 45 45 32 37 54 31 29 39 30 42 46 32 51 32 37 23 53 44 51 34 34 51 52 51 39 35 34 42 32 46 31 25 34 47 31 14 49 32 40 47 47 32 42 42 39 46 33 31 32 42 38 47 25 52 46 32 41 23 34 53 32 33 42 35 41 33 32 45 34 43 32 30 41 51 41 32 41 33 31 46 46 26 33 32 40 40 26 26 43 45 29 23 28 27 29 40 51 30 30 31 26 51 31 33 33 13 30 43 22 33 18 35 31 31 31 31 32 38 31 32 24 33 38 43 30 46 29 35 24 32 31 28 30 25 31 24 32 29 30 26 26 36 31 28 12 25 31 37 23 26 17 29 31 32 43 48 29 19 32 29 26 36 18 19 25 37 31 24 26 17 36 23 27 24 32 39 26 41 41 19 20 29 22 28 13 22 20 37 38 33 26 35 32 21 31 35 23 31 31 37 38 31 14 15 7 14 18 23 37 36 41 38 21 11 8 48 14 38 21 20 21 16 11 10 14 29 21 18 33 13 7 7 9 6 43 21 12 17 11 12 11 11 8 4 11 40 30 17 20 31 32 24 19 20 32 34 37 23 29 24 29 31 25 30 19 25 13 29 13 28 18 13 40 16 16 13 14 8 21 17 47 13 11 23 10 47 8 14 14 7 3 3 6 14 15 15 9 5 9 21 23 19 12 9 3 4 25 27 19 17 7 10 14 11 40 38 34 23 5 5 6 7 7 12 6 15 17 20 8 8 5 6 4 23 11 15 7 22 12 8 10 22 7 22 4 7 10 25 28 13 5 9 24 25 5 4 9 3 1 6 10 11 6 6 6 11 2 2 17 5 10 9 30 7 13 4 3 4 5 6	Open. Hide. 62 47 34 47 62 62 41 32 62 42 42 31 24 28 28 19 28 28 45 49 49 59 44 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 56 54 56 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 51 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 52 48 33 62 62 62 62 62 62 62 62 62 49 33 62 62 62 62 62 62 62 62 62 62 54 62 54 54 58 58 58 54 41 58 58 58 54 58 58 58 58 58 54 30 43 58 58 58 58 58 52 58 58 58 42 28 52 41 40 54 54 58 54 41 48 54 58 34 58 42 41 38 48 54 54 40 58 54 54 48 58 50 58 58 58 49 46 44 54 54 48 41 54 58 54 58 58 51 53 58 54 58 34 48 58 45 33 51 50 42 49 58 48 50 53 41 58 34 31 51 49 47 47 48 53 58 53 50 47 58 58 27 50 48 50 58 54 52 51 41 58 44 38 49 37 24 58 58 39 26 33 41 53 52 58 49 50 51 40 52 39 53 58 58 58 52 52 53 51 37 58 52 47 50 53 54 52 40 33 50 51 52 42 51 39 38 52 37 37 39 44 42 46 31 42 41 34 51 35 44 39 47 51 54 49 38 39 35 49 38 41 52 42 29 24 44 44 40 54 37 40 36 37 34 45 40 42 42 41 37 39 47 10 26 23 53 39 32 45 42 31 32 52 47 47 51 47 47 40 40 31 34 29 29 29 31 42 45 32 40 31 29 31 25 53 31 30 30 23 32 33 30 46 32 43 45 42 31 35 10 29 18 18 27 51 31 31 33 21 31 30 37 42 31 30 31 26 46 33 31 46 24 31 38 34 32 46 11 31 31 46 46 31 31 31 31 31 30 41 29 25 29 33 32 30 37 30 30 30 31 28 19 31 31 39 22 23 25 32 35 31 35 37 21 38 48 48 46 35 36 29 43 17 29 30 35 48 48 48 28 35 25 48 48 48 48 48 33 12 27 35 31 27 31 24 19 44 28 18 43 20 31 27 32 32 23 22 26 24 19 21 19 18 29 23 16 33 32 20 15 10 5 10 18 18 25 13 22 28 23 17 24 20 8 5 10 8 6 6 25 14 12 30 12 27 6 10 10 25 11 4 6 20 28 24 29 22 12 8 3 4 7 15 3 4 6 15 16 5 14 5 3 3 12 6 10 9 6 11 22 10 14 17 19 15 12 12 4 3 5 8 13 8 3 4 6 8 28 21 12 21 12 12 22 19 6 4 10 5 7 25 13 15 7 4 15 5 10 7 19 20 25 27 9 18 16 6 11 7 6 8 7 4 8 6 11 19 5 9 4 7 12 9 7 8 5 4 7 4 3 3 5 5 9 7 7 3 3 5 8 5 4 3 5 17 1 3 1 1 2 3 2 1 10 7 5 5 25 7 20 20 24 5 20 8 4 9 23 6 5 21 5 12 17 5 6 18 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_95514762_95515861
seq2: B6Ng01-247L14.b_48_1164

seq1  GAATTCTTCCAGTATAATCCCTGCTCAGTGAAATCTGATCTGGTTTTCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCCAGTATAATCCCTGCTCAGTGAAATCTGATCTGGTTTTCCT  50

seq1  CCACCAGGAAATGCCACCTTAGTCATGAACCAGATCCAATCCTGTGAGAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCAGGAAATGCCACCTTAGTCATGAACCAGATCCAATCCTGTGAGAC  100

seq1  TTCTGGTAATAAACTAATTCCAGCACTGGTGCCTGCCCTGCTTCCCCAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGGTAATAAACTAATTCCAGCACTGGTGCCTGCCCTGCTTCCCCAGC  150

seq1  TCACCCTAGTAACAGGCTGGAGAAGGCATGTTTCTGATTATCCTCAAGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCCTAGTAACAGGCTGGAGAAGGCATGTTTCTGATTATCCTCAAGAC  200

seq1  CCAGGGAGTGGAGCAGATGCCCAAACCAGACCTGTCCCCTGATTCAAAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGGAGTGGAGCAGATGCCCAAACCAGACCTGTCCCCTGATTCAAAGG  250

seq1  ACAGGACTCCAGGGTGGGTAGGAAGAGCTTCCCCAAGGAGGCAGCTAACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGACTCCAGGGTGGGTAGGAAGAGCTTCCCCAAGGAGGCAGCTAACT  300

seq1  TAACTTTCTCCTTTACAGCACTCGGCTAGAAAAGGAAAAGTGGATGCAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTTTCTCCTTTACAGCACTCGGCTAGAAAAGGAAAAGTGGATGCAGG  350

seq1  ACCTGAATGCAGCAATCCAAGCAGCCAAGACTATCGGTGACTCACCCCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGAATGCAGCAATCCAAGCAGCCAAGACTATCGGTGACTCACCCCCA  400

seq1  GTGCTGCTGGGAGGCCCGGTGTATACTCGTACCCCTAGTGAGTTTTGACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGCTGGGAGGCCCGGTGTATACTCGTACCCCTAGTGAGTTTTGACT  450

seq1  CAAGACACCCCAAGAGATGCCCTCTGTAGCTCTGAAAGCTTTCCTAAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGACACCCCAAGAGATGCCCTCTGTAGCTCTGAAAGCTTTCCTAAAAA  500

seq1  TTGTTTTCCTGACCTTGGCCAGCCTACCAGGTCCCATGAGTTTCCTTCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTCCTGACCTTGGCCAGCCTACCAGGTCCCATGAGTTTCCTTCCC  550

seq1  CACACAAGAAAAACTAGTGGCCATGCCTAGGTAGAAGAGTTCTTGGGCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAAGAAAAACTAGTGGCCATGCCTAGGTAGAAGAGTTCTTGGGCTG  600

seq1  TCCTAGCACCATGATTTTGTCTGGCTGTTGATTGGGTACCAAGAGCCTAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTAGCACCATGATTTTGTCTGGCTGTTGATTGGGTACCAAGAGCCTAT  650

seq1  TTCCCAGATCCTGGAGGAGCCTCATGGGTGAGTGGTACCAGCTGCTAACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCAGATCCTGGAGGAGCCTCATGGGTGAGTGGTACCAGCTGCTAACT  700

seq1  TTCCTCAGGATCTTCTGATGAAGTCTCTCTGGAAGAATCAGAAGATGGTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCAGGATCTTCTGATGAAGTCTCTCTGGAAGAATCAGAAGATGGTC  750

seq1  GAGGAAACCGGGGCTCCCTGGAGGGGAACAGCCAGCACCGGGCCAATACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAAACCGGGGCTCCCTGGAGGGGAACAGCCAGCACCGGGCCAATACA  800

seq1  ACAATGCATGTGTGCTGGTACCGTAATACAAGTGTGTCCAGAGCAGACCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATGCATGTGTGCTGGTACCGTAATACAAGTGTGTCCAGAGCAGACCA  850

seq1  CAGTGCAGCTGTTGAGGTATGGCTGTCATGAGCATACATGTGGGCCACCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGCAGCTGTTGAGGTATGGCTGTCATGAGCATACATGTGGGCCACCC  900

seq1  ACTCACCTCCACTCCCCACCCCCACCCCTCGTGTGCTGGC-TACTGGGG-  948
      |||||||||||||||||||||||||||||||||||||||| |||||||| 
seq2  ACTCACCTCCACTCCCCACCCCCACCCCTCGTGTGCTGGCTTACTGGGGG  950

seq1  -AGGAGCCCAGTCAGACAGC-TTCCTCCTCCTCCCTCATCTACTTAAGCT  996
        |||||||||||||||||| |||||||| ||||||||||||||||||||
seq2  AGGGAGCCCAGTCAGACAGCTTTCCTCCT-CTCCCTCATCTACTTAAGCT  999

seq1  CTCT-GGAC-TTCAACCAAATGTT--ATCTGTTATCTCATAAGGACAGT-  1041
      |||| |||| ||||||||||||||   |||||||||||||||||||||| 
seq2  CTCTGGGACTTTCAACCAAATGTTTATTCTGTTATCTCATAAGGACAGTT  1049

seq1  --CAAAACA-GAGGCAGCAG-TTCATCTACGAT--GGGATTTGCCC--AA  1083
         |||||| |||||||||| ||||||||||||  |||||||| ||  ||
seq2  CAAAAAACAGGAGGCAGCAGTTTCATCTACGATTGGGGATTTGGCCTAAA  1099

seq1  CAGCCCCCA-GGACACTG  1100
      ||||| | | ||||||||
seq2  CAGCCTCAAGGGACACTG  1117

seq1: chr1_95592475_95593572
seq2: B6Ng01-247L14.g_70_1155 (reverse)

seq1  GTGTCCTGAATAGCTTTGGATTTGGTCTCCCTAGGGACCGTGAGGGAATA  50
      |||| ||||||||||| ||| |  ||||  |||  ||||||||||  |||
seq2  GTGT-CTGAATAGCTTAGGAATCAGTCT--CTA-AGACCGTGAGG--ATA  44

seq1  AAGAAAGAACACACACAGTCACATGTGTAGAACAGTTGCAGCCAGGCGTG  100
      |   ||||   ||| |||||||||| ||||||||| ||||| ||| ||||
seq2  A--GAAGACGCCAC-CAGTCACATG-GTAGAACAG-TGCAG-CAGACGTG  88

seq1  GTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATT  150
      || |||||||||||||   ||||||||||||| ||||||||| || |  |
seq2  GT-GCGCACGCCTTTA--TCCAGCACTTGGGAAGCAGAGGCAAGTTGGAT  135

seq1  TCTGAGTTTGAGGCC-AGTCTGGTCTACAGAGTGAG-TTCCAGGACAGCC  198
      ||||||||||||||| |||||||||||||||||||| |||||||||||||
seq2  TCTGAGTTTGAGGCCAAGTCTGGTCTACAGAGTGAGTTTCCAGGACAGCC  185

seq1  AGGGCGATAGAGAAACCCTGTATGGAAAAAAACAAAAATGAAACAAAAAT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCGATAGAGAAACCCTGTATGGAAAAAAACAAAAATGAAACAAAAAT  235

seq1  GTGTATAACAGTTGCGGTTAGGTGGGATGTGCCCACTCTGACGGCCCTGC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTATAACAGTTGCGGTTAGGTGGGATGTGCCCACTCTGACGGCCCTGC  285

seq1  AGCAACCTGGAACCTCAGCACAGTTATTATGTATAGCATGGA-GGGGGGG  347
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AGCAACCTGGAACCTCAGCACAGTTATTATGTATAGCATGGAGGGGGGGG  335

seq1  GGTAGCTAGCCTTAGTAGATGTCTATAGGTACAGTCTCAGGCTGTAATCA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGCTAGCCTTAGTAGATGTCTATAGGTACAGTCTCAGGCTGTAATCA  385

seq1  TCTTGAGGAGGAAGCTGCAGTCGCTAGTTTTTTGTATGCACTGGTCAATC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGAGGAGGAAGCTGCAGTCGCTAGTTTTTTGTATGCACTGGTCAATC  435

seq1  ATTCATAAATGCTCATACATGCCCATCCTGCCAATAGCCATTCAGACCAA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATAAATGCTCATACATGCCCATCCTGCCAATAGCCATTCAGACCAA  485

seq1  AGGAGGGCTTTACCTGCCTATGGGTCTGAGGCATTGGCTCCTTGACACGG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGGGCTTTACCTGCCTATGGGTCTGAGGCATTGGCTCCTTGACACGG  535

seq1  TCATGCCTACATCAAACGGTCCACATTCACTCAGGCCTGTATCTTCTCCT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCCTACATCAAACGGTCCACATTCACTCAGGCCTGTATCTTCTCCT  585

seq1  TATACATTCACTAGGCTCCCAAAAGCCAGCCTTTCCTGATGTCTAAGTCA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATACATTCACTAGGCTCCCAAAAGCCAGCCTTTCCTGATGTCTAAGTCA  635

seq1  GGCAATGGGAGTGTTTGGGAGACCCAGCCAGCCCTGTAGCACTGGAGGTA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATGGGAGTGTTTGGGAGACCCAGCCAGCCCTGTAGCACTGGAGGTA  685

seq1  TGTGCTGGCTGACTATGCCCAGTCTGTCTGTGTTTCTTTTTGACTTGACC  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCTGGCTGACTATGCCCAGTCTGTCTGTGTTTCTTTTTGACTTGACC  735

seq1  TAGCCTAGCAGCTTGCCCCCTGCCAGGCTGTGTGTGTTGGGGTGTGCTGT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCTAGCAGCTTGCCCCCTGCCAGGCTGTGTGTGTTGGGGTGTGCTGT  785

seq1  GTCAAACTGAGGGAAGCCCTGTAGTTATATGGGGTTCACATCCCTGTGGA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAAACTGAGGGAAGCCCTGTAGTTATATGGGGTTCACATCCCTGTGGA  835

seq1  GGTCAAAGAGGCAATGAGCCCTTTGCTGTAGGCTGAGCCACTTGAGGATG  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCAAAGAGGCAATGAGCCCTTTGCTGTAGGCTGAGCCACTTGAGGATG  885

seq1  TCTGGCAGCCCATTTTAGAAACTTTAGAGATATGAAAGCTTTGTCTGGTG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGCAGCCCATTTTAGAAACTTTAGAGATATGAAAGCTTTGTCTGGTG  935

seq1  ACACTTGAGGGTAGGGTTCTGATTTTGGTTCTCCAGTCGGCCTGTCCTAA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTTGAGGGTAGGGTTCTGATTTTGGTTCTCCAGTCGGCCTGTCCTAA  985

seq1  CAGTAGAGAGCTCTGTGTTAGTCTAGGGAATGACGTAGCAATAGAGATAT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAGAGAGCTCTGTGTTAGTCTAGGGAATGACGTAGCAATAGAGATAT  1035

seq1  TCAAAATATAGGGAAGGCCAGGTTCATTTGGAGACTGTTCAAATGGAATT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAATATAGGGAAGGCCAGGTTCATTTGGAGACTGTTCAAATGGAATT  1085

seq1  C  1098
      |
seq2  C  1086

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information