MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-251H13
Chromosome	1 (Build37)
Map Location	75,159,670 - 75,291,415
singlet/doublet	doublet
Overlap gene	Zfand2b, Abcb6, Atg9a, D1Ertd161e, Stk16, Tuba4a, A630095N17Rik, Dnajb10, Ptprn, Resp18
Upstream gene	Tns1, Rufy4, Il8rb, Il8ra, Arpc2, Gpbar1, Aamp, Pnkd, Tmbim1, 2410125D13Rik, Gm216, Slc11a1, Ctdsp1, Vil1, Usp37, Rqcd1, Plcd4, Zfp142, Bcs1l, Rnf25, Stk36, Ttll4, Cyp27a1, Prkag3, Wnt6, Wnt10a, LOC100042901, Cdk5r2, Fev, Cryba2, Ccdc108, Ihh, Nhej1, Slc23a3, 1810031K17Rik, BC038286
Downstream gene	Dnpep, Des, Speg, Gmppa, Accn4, D1Bwg1363e, A230078I05Rik, AW822216, Inha, Stk11ip, Slc4a3, LOC100039069, LOC383531
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21961 MGI:104552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 258 ESTs, 2 Proteins

name	Rufy4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435626 MGI:3588214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il8rb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12765 MGI:105303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il8ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227288 MGI:2448715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76709 MGI:1923959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpbar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227289 MGI:2653863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aamp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227290 MGI:107809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnkd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Tmbim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69660 MGI:1916910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410125D13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73709 MGI:1920959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Gm216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241112 MGI:2685062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc11a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18173 MGI:1345275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctdsp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227292 MGI:2654470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22349 MGI:98930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319651 MGI:2442483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rqcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58184 MGI:1928902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18802 MGI:107469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77264 MGI:1924514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcs1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66821 MGI:1914071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57751 MGI:1890215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269209 MGI:1920831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67534 MGI:1914784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp27a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104086 MGI:88594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241113 MGI:1891343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wnt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22420 MGI:98960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22409 MGI:108071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Cdk5r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12570 MGI:1330828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fev (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260298 MGI:2449712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryba2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12958 MGI:104336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241116 MGI:2444274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ihh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16147 MGI:96533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nhej1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75570 MGI:1922820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc23a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22626 MGI:104516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810031K17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69171 MGI:1916421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038286 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227298 MGI:2388278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfand2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68818 MGI:1916068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74104 MGI:1921354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245860 MGI:2138446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D1Ertd161e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52231 MGI:1098746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20872 MGI:1313271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tuba4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22145 MGI:1095410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630095N17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381272 MGI:2686470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56812 MGI:1928739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ptprn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19275 MGI:102765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Resp18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19711 MGI:1098222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnpep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13437 MGI:1278328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Des (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13346 MGI:94885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Speg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11790 MGI:109282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmppa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69080 MGI:1916330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Accn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241118 MGI:2652846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D1Bwg1363e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74241 MGI:106576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A230078I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319998 MGI:2443133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW822216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98733 MGI:2138628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16322 MGI:96569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk11ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71728 MGI:1918978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20536 MGI:109350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC383531 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 11 Proteins pseudo : _no_value

name	Tns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363486 GeneID:21961 MGI:104552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 258 ESTs, 2 Proteins product : tensin 1 transcript_id : XM_619639.3

name	Rufy4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364398 GeneID:435626 MGI:3588214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 4 transcript_id : NM_001034060.2

name	Il8rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299639 GeneID:12765 MGI:105303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 8 receptor, beta transcript_id : NM_009909.3

name	Il8ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665720 GeneID:227288 MGI:2448715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 8 receptor, alpha transcript_id : NM_178241.4

name	Arpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363071 GeneID:76709 MGI:1923959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 2 transcript_id : NM_029711.1

name	Gpbar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27923942 GeneID:227289 MGI:2653863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled bile acid receptor 1 transcript_id : NM_174985.1

name	Aamp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82524293 GeneID:227290 MGI:107809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angio-associated migratory protein transcript_id : NM_146110.2

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239983 GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_001039509.1

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239987 GeneID:56695 MGI:1930773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_025580.2

name	Tmbim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349627 GeneID:69660 MGI:1916910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane BAX inhibitor motif containing 1 transcript_id : NM_027154.4

name	2410125D13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233932 GeneID:73709 MGI:1920959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2410125D13 gene transcript_id : XM_001480060.1

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239998 GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_019999.2

name	Gm216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803113 GeneID:241112 MGI:2685062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 216, (NCBI) transcript_id : NM_001033345.2

name	Slc11a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7363450 GeneID:18173 MGI:1345275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 transcript_id : NM_013612.1

name	Ctdsp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346508 GeneID:227292 MGI:2654470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 transcript_id : NM_153088.1

name	Vil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678572 GeneID:22349 MGI:98930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : villin 1 transcript_id : NM_009509.1

name	Usp37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367967 GeneID:319651 MGI:2442483
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 37 transcript_id : NM_176972.3

name	Rqcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543606 GeneID:58184 MGI:1928902
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rcd1 (required for cell differentiation) homolog 1 (S. pombe) transcript_id : NM_021383.3

name	Plcd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347157 GeneID:18802 MGI:107469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 4 transcript_id : NM_001081456.1

name	Plcd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347170 GeneID:18802 MGI:107469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 4 transcript_id : NM_148937.2

name	Zfp142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801887 GeneID:77264 MGI:1924514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 142 transcript_id : NM_029888.2

name	Bcs1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344956 GeneID:66821 MGI:1914071
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCS1-like (yeast) transcript_id : NM_025784.3

name	Rnf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946615 GeneID:57751 MGI:1890215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 25 transcript_id : NM_021313.1

name	Stk36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846120 GeneID:269209 MGI:1920831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 36 (fused homolog, Drosophila) transcript_id : NM_175031.3

name	Ttll4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62510078 GeneID:67534 MGI:1914784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 4 transcript_id : NM_001014974.1

name	Cyp27a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367423 GeneID:104086 MGI:88594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 27, subfamily a, polypeptide 1 transcript_id : NM_024264.4

name	Prkag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24371222 GeneID:241113 MGI:1891343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit transcript_id : NM_153744.1

name	Prkag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130072 GeneID:241113 MGI:1891343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit transcript_id : NM_153745.2

name	Wnt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672921 GeneID:22420 MGI:98960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 6 transcript_id : NM_009526.3

name	Wnt10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678586 GeneID:22409 MGI:108071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless related MMTV integration site 10a transcript_id : NM_009518.1

name	LOC100042901 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233897 GeneID:100042901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Nucleolar, serine-rich protein with a role in preribosome assembly or transport; may function as a chaperone of small nucleolar ribonucleoprotein particles (snoRNPs); immunologically and structurally to rat Nopp140 transcript_id : XM_001479026.1

name	Cdk5r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116875853 GeneID:12570 MGI:1330828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 5, regulatory subunit 2 (p39) transcript_id : NM_009872.2

name	Fev (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346544 GeneID:260298 MGI:2449712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FEV (ETS oncogene family) transcript_id : NM_153111.1

name	Cryba2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892777 GeneID:12958 MGI:104336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta A2 transcript_id : NM_021541.2

name	Ccdc108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87162475 GeneID:241116 MGI:2444274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 108 transcript_id : NM_001039495.1

name	Ihh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981670 GeneID:16147 MGI:96533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Indian hedgehog transcript_id : NM_010544.2

name	Nhej1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244080 GeneID:75570 MGI:1922820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nonhomologous end-joining factor 1 transcript_id : NM_029342.3

name	Slc23a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244078 GeneID:22626 MGI:104516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 23 (nucleobase transporters), member 3 transcript_id : NM_194333.3

name	1810031K17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345619 GeneID:69171 MGI:1916421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810031K17 gene transcript_id : NM_026977.2

name	BC038286 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248547 GeneID:227298 MGI:2388278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038286 transcript_id : NM_170755.2

name	Zfand2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370159 GeneID:68818 MGI:1916068
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, AN1 type domain 2B transcript_id : NM_026846.2

name	Abcb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980774 GeneID:74104 MGI:1921354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family B (MDR/TAP), member 6 transcript_id : NM_023732.2

name	Atg9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86990445 GeneID:245860 MGI:2138446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 9A (yeast) transcript_id : NM_001003917.2

name	D1Ertd161e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110556648 GeneID:52231 MGI:1098746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 1, ERATO Doi 161, expressed transcript_id : NM_026187.4

name	Stk16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387156 GeneID:20872 MGI:1313271
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 16 transcript_id : NM_011494.3

name	Tuba4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387233 GeneID:22145 MGI:1095410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 4A transcript_id : NM_009447.3

name	A630095N17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234112 GeneID:381272 MGI:2686470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630095N17 gene transcript_id : XM_001472088.1

name	Dnajb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388493 GeneID:56812 MGI:1928739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 10 transcript_id : NM_178055.3

name	Dnajb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9937995 GeneID:56812 MGI:1928739
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 10 transcript_id : NM_020266.1

name	Ptprn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089338 GeneID:19275 MGI:102765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, N transcript_id : NM_008985.2

name	Resp18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677716 GeneID:19711 MGI:1098222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulated endocrine-specific protein 18 transcript_id : NM_009049.1

name	Dnpep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378273 GeneID:13437 MGI:1278328
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartyl aminopeptidase transcript_id : NM_016878.3

name	Des (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563249 GeneID:13346 MGI:94885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : desmin transcript_id : NM_010043.1

name	Speg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225354 GeneID:11790 MGI:109282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPEG complex locus transcript_id : NM_007463.3

name	Gmppa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130918 GeneID:69080 MGI:1916330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GDP-mannose pyrophosphorylase A transcript_id : NM_133708.2

name	Accn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130710 GeneID:241118 MGI:2652846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amiloride-sensitive cation channel 4, pituitary transcript_id : NM_183022.2

name	D1Bwg1363e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48526513 GeneID:74241 MGI:106576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 1, Brigham & Women's Genetics 1363 expressed transcript_id : NM_001001566.1

name	D1Bwg1363e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48525358 GeneID:74241 MGI:106576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 1, Brigham & Women's Genetics 1363 expressed transcript_id : NM_001001565.1

name	A230078I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386564 GeneID:319998 MGI:2443133
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230078I05 gene transcript_id : NM_177056.3

name	AW822216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802473 GeneID:98733 MGI:2138628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW822216 transcript_id : NM_178884.3

name	Inha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130058 GeneID:16322 MGI:96569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibin alpha transcript_id : NM_010564.4

name	Stk11ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254180 GeneID:71728 MGI:1918978
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 11 interacting protein transcript_id : NM_027886.2

name	Slc4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378544 GeneID:20536 MGI:109350
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 3 transcript_id : NM_009208.2

name	Tns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363487 GeneID:21961 MGI:104552
definition	codon_start : 1 product : tensin 1 protein_id : XP_619639.3

name	Rufy4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702191 CCDS:CCDS15039.1 GeneID:435626 MGI:3588214
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RUN and FYVE domain containing 4 protein_id : NP_001029232.1

name	Il8rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753456 CCDS:CCDS15040.1 GeneID:12765 MGI:105303
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004950 - chemokine receptor activity [Evidence TAS] [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004918 - interleukin-8 receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006935 - chemotaxis [Evidence TAS]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : IL-8 receptor alpha chain; interleukin-8 receptor type B; chemokine (C-X-C) receptor 2 product : interleukin 8 receptor beta protein_id : NP_034039.1

name	Il8ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142679 CCDS:CCDS15041.1 GeneID:227288 MGI:2448715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004918 - interleukin-8 receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CXC chemokine receptor 1-like product : interleukin 8 receptor, alpha protein_id : NP_839972.1

name	Arpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363072 GeneID:76709 MGI:1923959
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030833 - regulation of actin filament polymerization [Evidence IEA] codon_start : 1 note : actin related protein 2/3 complex, subunit 2 (34 kDa) product : actin related protein 2/3 complex, subunit 2 protein_id : NP_083987.1

name	Gpbar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923943 CCDS:CCDS15042.1 GeneID:227289 MGI:2653863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor TGR5; membrane bile acid receptor product : G protein-coupled bile acid receptor 1 protein_id : NP_778150.1

name	Aamp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82524294 CCDS:CCDS15043.1 GeneID:227290 MGI:107809
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : angio-associated migratory protein protein_id : NP_666222.2

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239984 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 3 protein_id : NP_001034598.1

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239988 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 2 protein_id : NP_079856.2

name	Tmbim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980814 CCDS:CCDS15044.1 GeneID:69660 MGI:1916910
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : transmembrane BAX inhibitor motif containing 1 protein_id : NP_081430.2

name	2410125D13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233933 GeneID:73709 MGI:1920959
definition	codon_start : 1 product : hypothetical protein LOC73709 protein_id : XP_001480110.1

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910442 CCDS:CCDS15045.1 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 1 protein_id : NP_064383.1

name	Gm216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701842 CCDS:CCDS15046.1 GeneID:241112 MGI:2685062
definition	codon_start : 1 product : hypothetical protein LOC241112 protein_id : NP_001028517.1

name	Slc11a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7363451 CCDS:CCDS15047.1 GeneID:18173 MGI:1345275
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : natural resistance-associated macrophage protein 1; host resistance locus Bcg/Ity/Lsh product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 protein_id : NP_038640.1

name	Ctdsp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346509 CCDS:CCDS15048.1 GeneID:227292 MGI:2654470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] codon_start : 1 note : nuclear LIM interactor-interacting factor 3; NLI-interacting factor 3; golli-interacting protein product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 protein_id : NP_694728.1

name	Vil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678573 CCDS:CCDS15049.1 GeneID:22349 MGI:98930
definition	GO_component : GO:0005903 - brush border [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : villin 1 protein_id : NP_033535.1

name	Usp37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892803 CCDS:CCDS15050.1 GeneID:319651 MGI:2442483
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 37 protein_id : NP_795946.1

name	Rqcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946722 GeneID:58184 MGI:1928902
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA] codon_start : 1 product : rcd1 (required for cell differentiation) homolog 1 protein_id : NP_067358.1

name	Plcd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347171 GeneID:18802 MGI:107469
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0004629 - phospholipase C activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence IMP]; GO:0030384 - phosphoinositide metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : phospholipase C, delta 4 isoform 2 protein_id : NP_683739.2

name	Plcd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347158 GeneID:18802 MGI:107469
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0004629 - phospholipase C activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence IMP]; GO:0030384 - phosphoinositide metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : phospholipase C, delta 4 isoform 1 protein_id : NP_001074925.1

name	Zfp142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626083 GeneID:77264 MGI:1924514
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 142 protein_id : NP_084164.1

name	Bcs1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313544 CCDS:CCDS15051.1 GeneID:66821 MGI:1914071
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : BCS1-like protein_id : NP_080060.1

name	Rnf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946616 CCDS:CCDS15052.1 GeneID:57751 MGI:1890215
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation function : associated with ubiquitin conjugating enzyme note : RING finger protein AO7 product : ring finger protein 25 protein_id : NP_067288.1

name	Stk36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846121 GeneID:269209 MGI:1920831
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009791 - post-embryonic development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0051090 - regulation of transcription factor activity [Evidence ISS] codon_start : 1 product : serine/threonine kinase 36 protein_id : NP_778196.2

name	Ttll4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62510079 CCDS:CCDS15053.1 GeneID:67534 MGI:1914784
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : polyglutamylase product : tubulin tyrosine ligase-like family, member 4 protein_id : NP_001014974.1

name	Cyp27a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30578401 CCDS:CCDS15054.1 GeneID:104086 MGI:88594
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0047749 - cholestanetriol 26-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, 27; cholesterol 27 hydroxylase; cytochrome P450, 27a1 product : cytochrome P450, family 27, subfamily a, polypeptide 1 protein_id : NP_077226.2

name	Prkag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371223 CCDS:CCDS15055.1 GeneID:241113 MGI:1891343
definition	GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0015758 - glucose transport [Evidence IMP]; GO:0005978 - glycogen biosynthesis [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : long isoform is encoded by transcript variant 1; AMP-activated protein kinase gamma 3; AMP-activated protein kinase gamma subunit product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit long isoform protein_id : NP_714966.1

name	Prkag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371227 GeneID:241113 MGI:1891343
definition	GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0015758 - glucose transport [Evidence IMP]; GO:0005978 - glycogen biosynthesis [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : short isoform is encoded by transcript variant 2; AMP-activated protein kinase gamma 3; AMP-activated protein kinase gamma subunit product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit short isoform protein_id : NP_714967.1

name	Wnt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328158 CCDS:CCDS15056.1 GeneID:22420 MGI:98960
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless-related MMTV integration site 6 protein_id : NP_033552.2

name	Wnt10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678587 CCDS:CCDS15057.1 GeneID:22409 MGI:108071
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless related MMTV integration site 10a protein_id : NP_033544.1

name	LOC100042901 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233898 GeneID:100042901
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479076.1

name	Cdk5r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116875854 GeneID:12570 MGI:1330828
definition	GO_component : GO:0016533 - cyclin-dependent protein kinase 5 activator complex [Evidence IEA] GO_function : GO:0016534 - cyclin-dependent protein kinase 5 activator activity [Evidence TAS]; GO:0008092 - cytoskeletal protein binding [Evidence TAS] codon_start : 1 product : cyclin-dependent kinase 5, regulatory subunit 2 protein_id : NP_034002.2

name	Fev (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346545 CCDS:CCDS15058.1 GeneID:260298 MGI:2449712
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : ETS-domain transcription factor Pet-1; FEV (fifth Ewing variant) product : FEV (ETS oncogene family) protein_id : NP_694751.1

name	Cryba2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946978 CCDS:CCDS15059.1 GeneID:12958 MGI:104336
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0005212 - structural constituent of eye lens [Evidence TAS] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 note : betaA2-crystallin; lens structural protein product : crystallin, beta A2 protein_id : NP_067516.1

name	Ccdc108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87162476 CCDS:CCDS15060.1 GeneID:241116 MGI:2444274
definition	codon_start : 1 product : hypothetical protein LOC241116 protein_id : NP_001034584.1

name	Ihh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149643 CCDS:CCDS15061.1 GeneID:16147 MGI:96533
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0048469 - cell maturation [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0016539 - intein-mediated protein splicing [Evidence IEA]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0001649 - osteoblast differentiation [Evidence IMP]; GO:0007389 - pattern specification [Evidence IEA]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : Indian hedgehog protein_id : NP_034674.1

name	Nhej1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244081 GeneID:75570 MGI:1922820
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : nonhomologous end-joining factor 1 protein_id : NP_083618.2

name	Slc23a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244079 CCDS:CCDS15062.1 GeneID:22626 MGI:104516
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : yolk sac permease-like molecule 1 product : solute carrier family 23 (nucleobase transporters), member 3 protein_id : NP_919314.2

name	1810031K17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789185 CCDS:CCDS15063.1 GeneID:69171 MGI:1916421
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69171 protein_id : NP_081253.1

name	BC038286 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248548 GeneID:227298 MGI:2388278
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC227298 protein_id : NP_739561.2

name	Zfand2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312112 CCDS:CCDS15064.1 GeneID:68818 MGI:1916068
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger, AN1 type domain 2B protein_id : NP_081122.1

name	Abcb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17647117 CCDS:CCDS15065.1 GeneID:74104 MGI:1921354
definition	GO_component : GO:0005740 - mitochondrial envelope [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA] GO_process : GO:0006810 - transport [Evidence ISS] [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family B (MDR/TAP), member 6 protein_id : NP_076221.1

name	Atg9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86990446 GeneID:245860 MGI:2138446
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0000045 - autophagic vacuole formation [Evidence ISS]; GO:0006914 - autophagy [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : APG9 autophagy 9-like 1; autophagy protein 9 product : autophagy-related 9-like 1 protein_id : NP_001003917.2

name	D1Ertd161e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110556649 GeneID:52231 MGI:1098746
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ankyrin repeat and zinc finger domain containing protein protein_id : NP_080463.3

name	Stk16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543784 CCDS:CCDS15067.1 GeneID:20872 MGI:1313271
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : kinase related to cerevisiae and thaliana; Embryo-Derived Protein Kinase product : serine/threonine kinase 16 protein_id : NP_035624.2

name	Tuba4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678467 GeneID:22145 MGI:1095410
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, alpha 4 protein_id : NP_033473.1

name	A630095N17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234113 GeneID:381272 MGI:2686470
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472138.1

name	Dnajb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017349 GeneID:56812 MGI:1928739
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; heat shock protein, DNAJ-like 1 product : DnaJ (Hsp40) homolog, subfamily B, member 10 isoform 2 protein_id : NP_835156.1

name	Dnajb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937996 CCDS:CCDS15068.1 GeneID:56812 MGI:1928739
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; heat shock protein, DNAJ-like 1 product : DnaJ (Hsp40) homolog, subfamily B, member 10 isoform 1 protein_id : NP_064662.1

name	Ptprn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089339 GeneID:19275 MGI:102765
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence TAS] codon_start : 1 note : protein tyrosine phosphatase, receptor-type, N product : protein tyrosine phosphatase, receptor type, N protein_id : NP_033011.2

name	Resp18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677717 CCDS:CCDS15069.1 GeneID:19711 MGI:1098222
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : regulated endocrine-specific protein 18 protein_id : NP_033075.1

name	Dnpep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560449 CCDS:CCDS15070.1 GeneID:13437 MGI:1278328
definition	GO_component : GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0004250 - aminopeptidase I activity [Evidence IEA]; GO:0042576 - aspartyl aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : aspartyl aminopeptidase protein_id : NP_058574.2

name	Des (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563250 CCDS:CCDS15071.1 GeneID:13346 MGI:94885
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IDA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005882 - intermediate filament [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA]; GO:0045202 - synapse [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007517 - muscle development [Evidence TAS] codon_start : 1 product : desmin protein_id : NP_034173.1

name	Speg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225355 GeneID:11790 MGI:109282
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : aortic preferentially expressed gene 1 protein_id : NP_031489.3

name	Gmppa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526884 CCDS:CCDS15072.1 GeneID:69080 MGI:1916330
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA] codon_start : 1 product : GDP-mannose pyrophosphorylase A protein_id : NP_598469.1

name	Accn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942102 CCDS:CCDS15073.1 GeneID:241118 MGI:2652846
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acid-sensing ion channel; acid-sensing ion channel 4 product : amiloride-sensitive cation channel 4, pituitary protein_id : NP_898843.1

name	D1Bwg1363e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48526514 CCDS:CCDS15074.1 GeneID:74241 MGI:106576
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047238 - glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0050510 - N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : chondroitin polymerizing factor isoform a protein_id : NP_001001566.1

name	D1Bwg1363e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48525359 CCDS:CCDS15075.1 GeneID:74241 MGI:106576
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047238 - glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0050510 - N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : chondroitin polymerizing factor isoform b protein_id : NP_001001565.1

name	A230078I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892951 CCDS:CCDS15076.1 GeneID:319998 MGI:2443133
definition	codon_start : 1 product : hypothetical protein LOC319998 protein_id : NP_796030.1

name	AW822216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725726 CCDS:CCDS15077.1 GeneID:98733 MGI:2138628
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC98733 protein_id : NP_849215.1

name	Inha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254367 CCDS:CCDS15078.1 GeneID:16322 MGI:96569
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] [Evidence IEA] GO_function : GO:0017106 - activin inhibitor activity [Evidence ISS]; GO:0005125 - cytokine activity [Evidence ISS]; GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0005179 - hormone activity [Evidence ISS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007050 - cell cycle arrest [Evidence ISS]; GO:0030154 - cell differentiation [Evidence ISS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0007267 - cell-cell signaling [Evidence ISS]; GO:0030218 - erythrocyte differentiation [Evidence ISS]; GO:0042541 - hemoglobin biosynthesis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0045578 - negative regulation of B cell differentiation [Evidence ISS]; GO:0046882 - negative regulation of follicle-stimulating hormone secretion [Evidence ISS]; GO:0045077 - negative regulation of interferon-gamma biosynthesis [Evidence ISS]; GO:0045650 - negative regulation of macrophage differentiation [Evidence ISS]; GO:0042326 - negative regulation of phosphorylation [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0001541 - ovarian follicle development [Evidence ISS]; GO:0046881 - positive regulation of follicle-stimulating hormone secretion [Evidence ISS] codon_start : 1 product : inhibin alpha protein_id : NP_034694.3

name	Stk11ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254181 CCDS:CCDS15079.1 GeneID:71728 MGI:1918978
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine/threonine kinase 11 interacting protein protein_id : NP_082162.2

name	Slc4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678023 CCDS:CCDS15080.1 GeneID:20536 MGI:109350
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015380 - anion exchanger activity [Evidence IEA]; GO:0015297 - antiporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0005452 - inorganic anion exchanger activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : anion exchanger 3 cardiac isoform product : solute carrier family 4 (anion exchanger), member 3 protein_id : NP_033234.1

name	LOC100039069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039069
definition	number : 1 pseudo : _no_value

name	LOC100039069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039069
definition	number : 2 pseudo : _no_value

name	LOC100039069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039069
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:272638
definition	standard_name : PMC310709P2

name	(CDS detail)
type	STS
link
xref	UniSTS:141355
definition	standard_name : Cmkar2

name	(CDS detail)
type	STS
link
xref	UniSTS:158811
definition	standard_name : D17630

name	(CDS detail)
type	STS
link
xref	UniSTS:124880
definition	standard_name : L23637

name	(CDS detail)
type	STS
link
xref	UniSTS:221307
definition	standard_name : RH139221

name	(CDS detail)
type	STS
link
xref	UniSTS:142238
definition	standard_name : D1Mcg165

name	(CDS detail)
type	STS
link
xref	UniSTS:492747
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:140993
definition	standard_name : Aamp-rs

name	(CDS detail)
type	STS
link
xref	UniSTS:158810
definition	standard_name : AU040907

name	(CDS detail)
type	STS
link
xref	UniSTS:161969
definition	standard_name : RH125147

name	(CDS detail)
type	STS
link
xref	UniSTS:181078
definition	standard_name : AI854243

name	(CDS detail)
type	STS
link
xref	UniSTS:211936
definition	standard_name : RH128628

name	(CDS detail)
type	STS
link
xref	UniSTS:163166
definition	standard_name : RH126458

name	(CDS detail)
type	STS
link
xref	UniSTS:160553
definition	standard_name : AA960455

name	(CDS detail)
type	STS
link
xref	UniSTS:185438
definition	standard_name : AU024746

name	(CDS detail)
type	STS
link
xref	UniSTS:167272
definition	standard_name : RH127186

name	(CDS detail)
type	STS
link
xref	UniSTS:160917
definition	standard_name : RH118242

name	(CDS detail)
type	STS
link
xref	UniSTS:142239
definition	standard_name : D1Mcg4

name	(CDS detail)
type	STS
link
xref	UniSTS:144409
definition	standard_name : Slc11a1

name	(CDS detail)
type	STS
link
xref	UniSTS:116253
definition	standard_name : D1Mit24

name	(CDS detail)
type	STS
link
xref	UniSTS:142235
definition	standard_name : D1Mcg101

name	(CDS detail)
type	STS
link
xref	UniSTS:144756
definition	standard_name : Vil

name	(CDS detail)
type	STS
link
xref	UniSTS:128520
definition	standard_name : D1Mit181

name	(CDS detail)
type	STS
link
xref	UniSTS:164120
definition	standard_name : AI593551

name	(CDS detail)
type	STS
link
xref	UniSTS:248396
definition	standard_name : AI045490

name	(CDS detail)
type	STS
link
xref	UniSTS:185439
definition	standard_name : BB154236

name	(CDS detail)
type	STS
link
xref	UniSTS:268654
definition	standard_name : MARC_21861-21862:1027094738:1

name	(CDS detail)
type	STS
link
xref	UniSTS:125250
definition	standard_name : MHAa64b12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234156
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:124425
definition	standard_name : 41.MMHAP75FRF11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158812
definition	standard_name : AI451681

name	(CDS detail)
type	STS
link
xref	UniSTS:462986
definition	standard_name : Cyp27a1

name	(CDS detail)
type	STS
link
xref	UniSTS:256607
definition	standard_name : Cyp27a1

name	(CDS detail)
type	STS
link
xref	UniSTS:471328
definition	standard_name : Wnt6

name	(CDS detail)
type	STS
link
xref	UniSTS:465424
definition	standard_name : Wnt6

name	(CDS detail)
type	STS
link
xref	UniSTS:161656
definition	standard_name : RH124834

name	(CDS detail)
type	STS
link
xref	UniSTS:124997
definition	standard_name : M89800

name	(CDS detail)
type	STS
link
xref	UniSTS:471320
definition	standard_name : Wnt10a

name	(CDS detail)
type	STS
link
xref	UniSTS:163251
definition	standard_name : U61969

name	(CDS detail)
type	STS
link
xref	UniSTS:484839
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:217943
definition	standard_name : RH134664

name	(CDS detail)
type	STS
link
xref	UniSTS:207175
definition	standard_name : AI323361

name	(CDS detail)
type	STS
link
xref	UniSTS:158813
definition	standard_name : U85610

name	(CDS detail)
type	STS
link
xref	UniSTS:143529
definition	standard_name : Ihh

name	(CDS detail)
type	STS
link
xref	UniSTS:143530
definition	standard_name : Ihh

name	(CDS detail)
type	STS
link
xref	UniSTS:128928
definition	standard_name : D1Mit7

name	(CDS detail)
type	STS
link
xref	UniSTS:234154
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128596
definition	standard_name : D1Mit252

name	(CDS detail)
type	STS
link
xref	UniSTS:128597
definition	standard_name : D1Mit252.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128574
definition	standard_name : D1Mit23

name	(CDS detail)
type	STS
link
xref	UniSTS:144812
definition	standard_name : Yspl1

name	(CDS detail)
type	STS
link
xref	UniSTS:207173
definition	standard_name : AI874954

name	(CDS detail)
type	STS
link
xref	UniSTS:158814
definition	standard_name : AU043960

name	(CDS detail)
type	STS
link
xref	UniSTS:234151
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207174
definition	standard_name : RH127040

name	(CDS detail)
type	STS
link
xref	UniSTS:234155
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210415
definition	standard_name : RH136427

name	(CDS detail)
type	STS
link
xref	UniSTS:141487
definition	standard_name : D10Bir8

name	(CDS detail)
type	STS
link
xref	UniSTS:261345
definition	standard_name : AA955828

name	(CDS detail)
type	STS
link
xref	UniSTS:163032
definition	standard_name : RH126324

name	(CDS detail)
type	STS
link
xref	UniSTS:163253
definition	standard_name : AF089869

name	(CDS detail)
type	STS
link
xref	UniSTS:163252
definition	standard_name : X74438

name	(CDS detail)
type	STS
link
xref	UniSTS:277628
definition	standard_name : PTPRN_v432

name	(CDS detail)
type	STS
link
xref	UniSTS:125834
definition	standard_name : X74438

name	(CDS detail)
type	STS
link
xref	UniSTS:269893
definition	standard_name : MARC_8095-8096:996688286:1

name	(CDS detail)
type	STS
link
xref	UniSTS:186036
definition	standard_name : AI851012

name	(CDS detail)
type	STS
link
xref	UniSTS:142240
definition	standard_name : D1Mcg7

name	(CDS detail)
type	STS
link
xref	UniSTS:162489
definition	standard_name : RH125731

name	(CDS detail)
type	STS
link
xref	UniSTS:128921
definition	standard_name : D1Mit61

name	(CDS detail)
type	STS
link
xref	UniSTS:271986
definition	standard_name : PMC209322P1

name	(CDS detail)
type	STS
link
xref	UniSTS:238157
definition	standard_name : Des

name	(CDS detail)
type	STS
link
xref	UniSTS:186401
definition	standard_name : G67372

name	(CDS detail)
type	STS
link
xref	UniSTS:460346
definition	standard_name : stSG632979

name	(CDS detail)
type	STS
link
xref	UniSTS:221134
definition	standard_name : RH139048

name	(CDS detail)
type	STS
link
xref	UniSTS:185440
definition	standard_name : U57098

name	(CDS detail)
type	STS
link
xref	UniSTS:212009
definition	standard_name : RH128701

name	(CDS detail)
type	STS
link
xref	UniSTS:178414
definition	standard_name : AW125581

name	(CDS detail)
type	STS
link
xref	UniSTS:142231
definition	standard_name : D1Bwg1450e

name	(CDS detail)
type	STS
link
xref	UniSTS:125501
definition	standard_name : N28140

name	(CDS detail)
type	STS
link
xref	UniSTS:161881
definition	standard_name : RH125059

name	(CDS detail)
type	STS
link
xref	UniSTS:377965
definition	standard_name : REN53165

name	(CDS detail)
type	STS
link
xref	UniSTS:377966
definition	standard_name : REN53166

name	(CDS detail)
type	STS
link
xref	UniSTS:377967
definition	standard_name : REN53167

name	(CDS detail)
type	STS
link
xref	UniSTS:460409
definition	standard_name : stSG633055

name	(CDS detail)
type	STS
link
xref	UniSTS:287508
definition	standard_name : ECD06448

name	(CDS detail)
type	STS
link
xref	UniSTS:142230
definition	standard_name : D1Bwg1363e

name	(CDS detail)
type	STS
link
xref	UniSTS:161873
definition	standard_name : RH125051

name	(CDS detail)
type	STS
link
xref	UniSTS:158815
definition	standard_name : AI414328

name	(CDS detail)
type	STS
link
xref	UniSTS:32120
definition	standard_name : RH48039

name	(CDS detail)
type	STS
link
xref	UniSTS:378077
definition	standard_name : REN53277

name	(CDS detail)
type	STS
link
xref	UniSTS:207177
definition	standard_name : AW822216

name	(CDS detail)
type	STS
link
xref	UniSTS:378213
definition	standard_name : REN53413

name	(CDS detail)
type	STS
link
xref	UniSTS:298224
definition	standard_name : ECD17211

name	(CDS detail)
type	STS
link
xref	UniSTS:128466
definition	standard_name : D1Mit131

name	(CDS detail)
type	STS
link
xref	UniSTS:142241
definition	standard_name : D1Mcg8

name	(CDS detail)
type	STS
link
xref	UniSTS:143587
definition	standard_name : Inha

name	(CDS detail)
type	STS
link
xref	UniSTS:178415
definition	standard_name : AW555078

name	(CDS detail)
type	STS
link
xref	UniSTS:207229
definition	standard_name : C87829

name	(CDS detail)
type	STS
link
xref	UniSTS:185441
definition	standard_name : BB131189

name	(CDS detail)
type	STS
link
xref	UniSTS:234150
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:116254
definition	standard_name : D1Mit46

name	(CDS detail)
type	STS
link
xref	UniSTS:125297
definition	standard_name : MHAa70h12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:302807
definition	standard_name : ECD21815

name	(CDS detail)
type	STS
link
xref	UniSTS:378971
definition	standard_name : REN54171

name	(CDS detail)
type	STS
link
xref	UniSTS:207172
definition	standard_name : C86447

name	(CDS detail)
type	STS
link
xref	UniSTS:128689
definition	standard_name : D1Mit331

name	(CDS detail)
type	STS
link
xref	UniSTS:128637
definition	standard_name : D1Mit284

name	(CDS detail)
type	STS
link
xref	UniSTS:228347
definition	standard_name : D9Rat170

name	LOC383531 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234114 GeneID:383531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 11 Proteins product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_030615.1

clone name	MSMg01-491F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-251H13.b	B6Ng01-251H13.g
ACC	GA058725	GA058726
length	800	1,098
definition	B6Ng01-251H13.b	B6Ng01-251H13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(75,159,670 - 75,160,469)	(75,290,324 - 75,291,415)
sequence	gaattcacaaacattctacctctccatccatgtgctgggattaaagggtt gtgccaccataaaacaacagcaacattaacaaagccatctactttcaaag actgcctctagttggtcagtgtctacaatcccagctcctcaccaggctga ggcgccacacagggatggggaggaccacaaagttgagatcaatcgggaca atttggagaagaggctccgtgtcaaaataaaaaggaccaggcagtggtgg tgcactcctttaatcccagcatttgggagccagaagcagaggcaggtgga tctctgagttcaaggccagcctgggctacagattgagtttcaagacagcc agggctacacagaaaagcaaaacaaacaaagcaaagcaaaacaagtaaaa ccaaccaaccaaataaaaaagggaaggagatataacttaatatcatagcc ctcaacctgtaaatgcttgttttaatccccaaagcggacaggaaaaagac atcgaaatcaatctggaacttcaaagctatccatcgataagaaagcacac ctgcttggtatgtgatcactaattaaggttttgtctttaaaaagtgaaga gatggctcagcggtcaagagcgttgactgctcttccagaggtcctgagta taattcccagcaaccacatggtggcttaaaccatctgtaatgggatctga tgccctcttctggtgtctaaagacagttacagtgtactcatatgcataaa ataaataaataattctttaaaggaggaggaggaagatgaggaggagggaa	gaattccaggacacaacacagagaaactctgcatgtccagaccaaaacaa aacaaaaaaataaaaacaaaacccacaaacaaaaaaaattcctgagccct ggcaggtaggcagaagagcaggaattgtcaggctggttggcactgctgtt ggtggcacccacttgggtgaggagggtggtactgagccaggcccaggaag actggagcaacgcatctgattctgtcccctgctgccaagcacctggagat gtgaaaagtgtgattgggattttatcagctcccaccacgagaaggaaacc caagtcaagggcacagagctgtctacaaggctggtgtgcagcatggtggg cggccctaactgaagctctggaaaaggaaaggtagtgggtgttgtgtagg ccaaggtttaaaacaggaagacgagtgtgggaactaggagaaatggttga tgatgagggttcagcagggagaataggggggaccccgtgggtcagggcac ttggaaccagaccccaaggccttgggagaagaaggaagaatcactgagtc caaggaagatggggcagggagccctcatccaatacctgcttcatgaaagg cccaggttgcgaactccttgaagggatgggctgttagcgcatcatgggaa gaggcaggagaagagttctaaccactgtcacaccctaccccatccatcct ggtactaaaatttggtcatcaacatatgactttctggagcagggtggatt agcaggatgcagatgggtttatggagggcagctacagaagagagtcctct ctctttctaccggagccactttcagactaacaccggtccctctggcggtt gtccactagtgaggaagggggggtgctctaccggtcatcaggttcatttg cttgcttgggaccatttgtcttagagactcggctttcctcccacagcttc cattcctcactataaatgctgggggctacaagtcttctttacattgttca ttttaagcttccattttcatcttagaagacatcgaattttttttttttta catggcaaaattgcctttaaaataattcaactgggcctgagctgtctg
quality values	Open. Hide. 47 26 35 26 58 41 27 42 43 62 62 38 38 54 62 62 62 62 62 62 62 62 62 62 39 24 62 62 44 44 62 62 56 50 34 32 45 34 38 28 43 46 56 56 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 59 62 62 62 54 49 54 62 62 62 62 59 59 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 51 51 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 56 50 56 59 59 62 56 62 56 54 59 62 56 59 51 59 62 54 59 62 59 62 59 51 59 50 48 50 50 56 59 56 59 62 59 62 62 51 59 43 50 51 49 59 59 59 59 59 54 62 62 62 62 62 62 59 59 59 56 59 59 59 59 54 56 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 59 62 59 59 49 39 51 50 30 28 34 56 59 59 59 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 59 59 62 62 59 59 59 62 62 62 62 62 62 62 49 50 62 59 62 62 62 62 62 62 59 59 62 62 62 62 51 62 62 47 62 62 62 62 54 62 62 62 44 56 36 38 51 51 56 38 50 56 51 56 56 56 56 43 43 50 56 62 56 62 62 62 62 42 62 62 62 62 56 62 56 56 56 56 56 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 54 54 62 62 62 47 56 62 62 56 47 56 56 56 56 62 43 62 62 62 62 27 38 62 62 62 35 62 62 38 43 62 62 52 46 42 33 14 28 23 28 48 42 41 62 42 62 38 52 39 42 52 28 41 37 40 52 33 46 50 50 42 47 34 46 35 58 35 58 41 37 52 29 34 38 22 35 28 50 50 52 31 41 26 29 19 25 19 33 22 18 36 32 46 37 42 52 54 42 39 37 25 25 44 23 33 29 26 34 33 33 37 41 53 54 52 22 52 37 58 47 47 49 33 50 49 50 51 32 37 27 27 11 9 10 33 35 40 13 21 24 9 23 23 50 52 50 50 18 41 53 25 12 17 29 34 40 39 41 26 6 11 6 18 33 32 32 21 37 31 15 27 25 25 17 15 13 16 9 6 6 9 9 23 18 24 17 9 10 12 9 15 13 28 37 21 22 15 14 17 39 31 8 40 29 15 22 22 14 27 29 14 9 19 9 20 24 14 27 17 9 22 27 15 16 19 15 15	Open. Hide. 62 47 51 41 62 62 41 33 62 62 41 26 25 32 14 18 22 22 22 28 17 29 21 33 49 62 59 62 62 49 49 49 62 62 62 62 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 59 56 43 34 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 54 62 56 62 62 62 62 62 62 62 56 62 62 62 56 56 62 62 62 56 62 62 62 54 62 62 62 62 62 54 62 62 62 47 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 54 56 62 62 56 62 62 62 62 62 62 62 47 43 56 56 56 50 54 62 62 62 62 62 62 47 62 56 43 56 56 56 56 62 44 62 47 62 62 56 56 54 56 56 56 56 47 62 47 62 42 62 52 51 62 62 62 54 39 62 54 38 62 62 41 62 62 62 52 62 41 38 52 41 47 52 52 62 41 54 62 62 52 54 54 62 58 58 52 54 35 58 58 58 58 54 54 39 58 43 36 52 48 52 52 52 54 49 58 54 45 39 58 54 58 54 52 54 58 54 54 45 54 52 58 58 58 58 38 44 54 34 47 52 46 54 54 54 54 54 48 42 58 52 48 49 40 52 40 42 42 54 48 33 58 54 54 42 52 52 31 33 52 52 52 58 49 50 51 43 51 50 51 50 50 54 54 58 41 58 54 28 43 29 48 42 39 25 48 49 32 58 58 32 58 22 50 53 53 40 49 46 40 30 25 51 41 46 41 53 42 40 46 32 44 43 50 50 50 58 58 50 40 52 58 50 32 53 37 58 33 58 51 39 32 35 46 51 58 58 49 53 36 30 44 43 31 50 31 39 35 23 25 18 7 14 34 50 47 39 35 50 51 28 29 42 54 49 36 23 50 40 24 49 35 29 50 35 28 15 28 39 32 44 29 6 49 39 26 53 40 37 29 41 39 41 54 44 22 27 52 32 41 49 44 35 24 54 54 37 52 31 38 49 32 51 37 37 52 46 10 49 9 47 24 42 40 35 53 37 29 27 33 31 36 54 31 24 32 28 24 35 24 37 33 9 11 21 21 18 21 37 31 34 37 19 45 27 23 26 33 30 20 14 20 22 42 34 32 40 21 31 34 40 53 33 23 18 10 15 51 33 26 21 40 26 39 35 45 30 32 31 33 30 33 32 22 6 46 46 46 37 45 25 9 23 12 7 27 31 31 19 18 41 27 16 31 31 38 34 31 14 25 31 33 18 28 26 48 31 25 31 31 21 27 14 13 11 8 46 26 31 10 6 7 29 37 7 8 14 26 31 30 31 22 41 28 16 14 35 24 19 27 10 6 41 9 16 15 26 22 23 26 19 26 31 25 21 18 15 29 28 33 38 13 18 31 25 22 32 30 23 20 24 44 41 22 14 35 21 17 23 44 44 41 31 17 30 19 9 22 5 20 11 10 5 12 30 11 37 11 7 6 19 22 26 10 6 13 25 8 11 39 33 14 6 26 21 9 6 24 6 18 25 33 39 39 18 14 18 9 19 14 25 21 4 7 32 8 28 20 20 28 26 7 15 21 16 21 19 47 22 13 24 30 28 29 29 15 5 3 4 6 3 3 9 6 8 21 16 15 14 9 13 23 25 5 22 21 8 24 27 14 3 3 3 21 18 8 4 6 7 16 21 25 18 6 10 21 9 11 5 8 15 8 6 6 6 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_75159670_75160469
seq2: B6Ng01-251H13.b_45_844

seq1  GAATTCACAAACATTCTACCTCTCCATCCATGTGCTGGGATTAAAGGGTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAAACATTCTACCTCTCCATCCATGTGCTGGGATTAAAGGGTT  50

seq1  GTGCCACCATAAAACAACAGCAACATTAACAAAGCCATCTACTTTCAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCCACCATAAAACAACAGCAACATTAACAAAGCCATCTACTTTCAAAG  100

seq1  ACTGCCTCTAGTTGGTCAGTGTCTACAATCCCAGCTCCTCACCAGGCTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCCTCTAGTTGGTCAGTGTCTACAATCCCAGCTCCTCACCAGGCTGA  150

seq1  GGCGCCACACAGGGATGGGGAGGACCACAAAGTTGAGATCAATCGGGACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGCCACACAGGGATGGGGAGGACCACAAAGTTGAGATCAATCGGGACA  200

seq1  ATTTGGAGAAGAGGCTCCGTGTCAAAATAAAAAGGACCAGGCAGTGGTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGGAGAAGAGGCTCCGTGTCAAAATAAAAAGGACCAGGCAGTGGTGG  250

seq1  TGCACTCCTTTAATCCCAGCATTTGGGAGCCAGAAGCAGAGGCAGGTGGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACTCCTTTAATCCCAGCATTTGGGAGCCAGAAGCAGAGGCAGGTGGA  300

seq1  TCTCTGAGTTCAAGGCCAGCCTGGGCTACAGATTGAGTTTCAAGACAGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGAGTTCAAGGCCAGCCTGGGCTACAGATTGAGTTTCAAGACAGCC  350

seq1  AGGGCTACACAGAAAAGCAAAACAAACAAAGCAAAGCAAAACAAGTAAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCTACACAGAAAAGCAAAACAAACAAAGCAAAGCAAAACAAGTAAAA  400

seq1  CCAACCAACCAAATAAAAAAGGGAAGGAGATATAACTTAATATCATAGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACCAACCAAATAAAAAAGGGAAGGAGATATAACTTAATATCATAGCC  450

seq1  CTCAACCTGTAAATGCTTGTTTTAATCCCCAAAGCGGACAGGAAAAAGAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAACCTGTAAATGCTTGTTTTAATCCCCAAAGCGGACAGGAAAAAGAC  500

seq1  ATCGAAATCAATCTGGAACTTCAAAGCTATCCATCGATAAGAAAGCACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGAAATCAATCTGGAACTTCAAAGCTATCCATCGATAAGAAAGCACAC  550

seq1  CTGCTTGGTATGTGATCACTAATTAAGGTTTTGTCTTTAAAAAGTGAAGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTTGGTATGTGATCACTAATTAAGGTTTTGTCTTTAAAAAGTGAAGA  600

seq1  GATGGCTCAGCGGTCAAGAGCGTTGACTGCTCTTCCAGAGGTCCTGAGTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGCTCAGCGGTCAAGAGCGTTGACTGCTCTTCCAGAGGTCCTGAGTA  650

seq1  TAATTCCCAGCAACCACATGGTGGCTTAAACCATCTGTAATGGGATCTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTCCCAGCAACCACATGGTGGCTTAAACCATCTGTAATGGGATCTGA  700

seq1  TGCCCTCTTCTGGTGTCTAAAGACAGTTACAGTGTACTCATATGCATAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCTCTTCTGGTGTCTAAAGACAGTTACAGTGTACTCATATGCATAAA  750

seq1  ATAAATAAATAAATCTTTAAAGGAGGAGGAGGAAGAGGAGGAGGAGGGAA  800
      |||||||||||| ||||||||||||||||||||||| |||||||||||||
seq2  ATAAATAAATAATTCTTTAAAGGAGGAGGAGGAAGATGAGGAGGAGGGAA  800

seq1: chr1_75290324_75291415
seq2: B6Ng01-251H13.g_68_1165 (reverse)

seq1  CAGACAGCTCA-GCCCAGTGAAATTATTTTAAAGGCAATTTTGCCAGTGT  49
      ||||||||||| |||||||  ||||||||||||||||||||||||| |||
seq2  CAGACAGCTCAGGCCCAGTTGAATTATTTTAAAGGCAATTTTGCCA-TGT  49

seq1  TAAAAAAAAAAAAAAATTCGATGTCTCTTAAGATG-AAATGGAAGCTTAA  98
         |||||||||||||||||||||||  ||||||| ||||||||||||||
seq2  ---AAAAAAAAAAAAATTCGATGTCTTCTAAGATGAAAATGGAAGCTTAA  96

seq1  AATGAACAATGT-AAGAGACCTTGTAG-CCCCAGCATTTTATAGTGAGGA  146
      |||||||||||| ||||   ||||||| |||||||| |||||||||||||
seq2  AATGAACAATGTAAAGAAGACTTGTAGCCCCCAGCA-TTTATAGTGAGGA  145

seq1  ATGG-AGCTGTGGGAGG-AAGCCGAGTCTCTAAGAC-AATGGTCCC-AGC  192
      |||| |||||||||||| |||||||||||||||||| ||||||||| |||
seq2  ATGGAAGCTGTGGGAGGAAAGCCGAGTCTCTAAGACAAATGGTCCCAAGC  195

seq1  AAGCAAATGAACCTGATGACC-GTAG-GCA-CCCCCCTTCCTCACTAGTG  239
      ||||||||||||||||||||| |||| ||| |||||||||||||||||||
seq2  AAGCAAATGAACCTGATGACCGGTAGAGCACCCCCCCTTCCTCACTAGTG  245

seq1  GACAACCGCCAGAGGGACCGGTGTTAGTCTGAAAGTGGCTCCGGTAGAAA  289
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAACCGCCAGAGGGACCGGTGTTAGTCTGAAAGTGGCTCCGGTAGAAA  295

seq1  GAGAGAGGACTCTCTTCTGTAGCTGCCCTCCATAAACCCATCTGCATCCT  339
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGGACTCTCTTCTGTAGCTGCCCTCCATAAACCCATCTGCATCCT  345

seq1  GCTAATCCACCCTGCTCCAGAAAGTCATATGTTGATGACCAAATTTTAGT  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAATCCACCCTGCTCCAGAAAGTCATATGTTGATGACCAAATTTTAGT  395

seq1  ACCAGGATGGATGGGGTAGGGTGTGACAGTGGTTAGAACTCTTCTCCTGC  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGGATGGATGGGGTAGGGTGTGACAGTGGTTAGAACTCTTCTCCTGC  445

seq1  CTCTTCCCATGATGCGCTAACAGCCCATCCCTTCAAGGAGTTCGCAACCT  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCCCATGATGCGCTAACAGCCCATCCCTTCAAGGAGTTCGCAACCT  495

seq1  GGGCCTTTCATGAAGCAGGTATTGGATGAGGGCTCCCTGCCCCATCTTCC  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCTTTCATGAAGCAGGTATTGGATGAGGGCTCCCTGCCCCATCTTCC  545

seq1  TTGGACTCAGTGATTCTTCCTTCTTCTCCCAAGGCCTTGGGGTCTGGTTC  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGACTCAGTGATTCTTCCTTCTTCTCCCAAGGCCTTGGGGTCTGGTTC  595

seq1  CAAGTGCCCTGACCCACGGGGTCCCCCCTATTCTCCCTGCTGAACCCTCA  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTGCCCTGACCCACGGGGTCCCCCCTATTCTCCCTGCTGAACCCTCA  645

seq1  TCATCAACCATTTCTCCTAGTTCCCACACTCGTCTTCCTGTTTTAAACCT  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCAACCATTTCTCCTAGTTCCCACACTCGTCTTCCTGTTTTAAACCT  695

seq1  TGGCCTACACAACACCCACTACCTTTCCTTTTCCAGAGCTTCAGTTAGGG  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTACACAACACCCACTACCTTTCCTTTTCCAGAGCTTCAGTTAGGG  745

seq1  CCGCCCACCATGCTGCACACCAGCCTTGTAGACAGCTCTGTGCCCTTGAC  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCCCACCATGCTGCACACCAGCCTTGTAGACAGCTCTGTGCCCTTGAC  795

seq1  TTGGGTTTCCTTCTCGTGGTGGGAGCTGATAAAATCCCAATCACACTTTT  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGTTTCCTTCTCGTGGTGGGAGCTGATAAAATCCCAATCACACTTTT  845

seq1  CACATCTCCAGGTGCTTGGCAGCAGGGGACAGAATCAGATGCGTTGCTCC  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATCTCCAGGTGCTTGGCAGCAGGGGACAGAATCAGATGCGTTGCTCC  895

seq1  AGTCTTCCTGGGCCTGGCTCAGTACCACCCTCCTCACCCAAGTGGGTGCC  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTCCTGGGCCTGGCTCAGTACCACCCTCCTCACCCAAGTGGGTGCC  945

seq1  ACCAACAGCAGTGCCAACCAGCCTGACAATTCCTGCTCTTCTGCCTACCT  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAACAGCAGTGCCAACCAGCCTGACAATTCCTGCTCTTCTGCCTACCT  995

seq1  GCCAGGGCTCAGGAATTTTTTTTGTTTGTGGGTTTTGTTTTTATTTTTTT  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGGCTCAGGAATTTTTTTTGTTTGTGGGTTTTGTTTTTATTTTTTT  1045

seq1  GTTTTGTTTTGGTCTGGACATGCAGAGTTTCTCTGTGTTGTGTCCTGGAA  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTGTTTTGGTCTGGACATGCAGAGTTTCTCTGTGTTGTGTCCTGGAA  1095

seq1  TTC  1092
      |||
seq2  TTC  1098

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information