MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-252L09
Chromosome	1 (Build37)
Map Location	73,394,397 - 73,529,472
singlet/doublet	doublet
Overlap gene	Pinc, LOC672208
Upstream gene	Xrcc5, March4, Smarcal1, Ankar, Rpl37a, Igfbp2, Igfbp5, LOC672187, LOC100042860, Tnp1, 1700027A15Rik
Downstream gene	LOC100043291, Tns1, Rufy4, Il8rb, Il8ra, Arpc2, Gpbar1, Aamp, Pnkd, Tmbim1, 2410125D13Rik, Gm216, Slc11a1, Ctdsp1, Vil1, Usp37
Link	Open Mouse BAC browser

Click to get alignment info.

name	Xrcc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22596 MGI:104517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381270 MGI:2683550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54380 MGI:1859183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319695 MGI:2442559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl37a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19981 MGI:98068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16008 MGI:96437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16011 MGI:96440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100042860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tnp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21958 MGI:98784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69449 MGI:1916699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs

name	Pinc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:723792 MGI:3623820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Tns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21961 MGI:104552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 258 ESTs, 2 Proteins

name	Rufy4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435626 MGI:3588214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il8rb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12765 MGI:105303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il8ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227288 MGI:2448715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76709 MGI:1923959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpbar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227289 MGI:2653863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aamp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227290 MGI:107809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnkd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Tmbim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69660 MGI:1916910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410125D13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73709 MGI:1920959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Gm216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241112 MGI:2685062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc11a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18173 MGI:1345275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctdsp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227292 MGI:2654470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22349 MGI:98930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319651 MGI:2442483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xrcc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753976 GeneID:22596 MGI:104517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-ray repair complementing defective repair in Chinese hamster cells 5 transcript_id : NM_009533.1

name	March4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865912 GeneID:381270 MGI:2683550
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 4 transcript_id : NM_001045533.1

name	Smarcal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055347 GeneID:54380 MGI:1859183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Swi/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 transcript_id : NM_018817.1

name	Ankar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387175 GeneID:319695 MGI:2442559
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin and armadillo repeat containing transcript_id : NM_176980.3

name	Rpl37a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384175 GeneID:19981 MGI:98068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L37a transcript_id : NM_009084.3

name	Igfbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982259 GeneID:16008 MGI:96437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 2 transcript_id : NM_008342.2

name	Igfbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909321 GeneID:16011 MGI:96440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 5 transcript_id : NM_010518.2

name	LOC100042860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233890 GeneID:100042860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042860 transcript_id : XM_001478941.1

name	Tnp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678394 GeneID:21958 MGI:98784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transition protein 1 transcript_id : NM_009407.1

name	1700027A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363484 GeneID:69449 MGI:1916699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs product : RIKEN cDNA 1700027A15 gene transcript_id : XM_993673.1

name	LOC100043291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233930 GeneID:100043291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043291 transcript_id : XM_001480012.1

name	Tns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363486 GeneID:21961 MGI:104552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 258 ESTs, 2 Proteins product : tensin 1 transcript_id : XM_619639.3

name	Rufy4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364398 GeneID:435626 MGI:3588214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 4 transcript_id : NM_001034060.2

name	Il8rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299639 GeneID:12765 MGI:105303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 8 receptor, beta transcript_id : NM_009909.3

name	Il8ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665720 GeneID:227288 MGI:2448715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 8 receptor, alpha transcript_id : NM_178241.4

name	Arpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363071 GeneID:76709 MGI:1923959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 2 transcript_id : NM_029711.1

name	Gpbar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27923942 GeneID:227289 MGI:2653863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled bile acid receptor 1 transcript_id : NM_174985.1

name	Aamp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82524293 GeneID:227290 MGI:107809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angio-associated migratory protein transcript_id : NM_146110.2

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239983 GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_001039509.1

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239987 GeneID:56695 MGI:1930773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_025580.2

name	Tmbim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349627 GeneID:69660 MGI:1916910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane BAX inhibitor motif containing 1 transcript_id : NM_027154.4

name	2410125D13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233932 GeneID:73709 MGI:1920959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2410125D13 gene transcript_id : XM_001480060.1

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239998 GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_019999.2

name	Gm216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803113 GeneID:241112 MGI:2685062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 216, (NCBI) transcript_id : NM_001033345.2

name	Slc11a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7363450 GeneID:18173 MGI:1345275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 transcript_id : NM_013612.1

name	Ctdsp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346508 GeneID:227292 MGI:2654470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 transcript_id : NM_153088.1

name	Vil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678572 GeneID:22349 MGI:98930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : villin 1 transcript_id : NM_009509.1

name	Usp37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367967 GeneID:319651 MGI:2442483
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 37 transcript_id : NM_176972.3

name	Xrcc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753977 GeneID:22596 MGI:104517
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005958 - DNA-dependent protein kinase complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004003 - ATP-dependent DNA helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006303 - double-strand break repair via nonhomologous end joining [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : Ku p80; Ku autoantigen product : X-ray repair complementing defective repair in Chinese hamster cells 5 protein_id : NP_033559.1

name	March4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865913 CCDS:CCDS15034.1 GeneID:381270 MGI:2683550
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : membrane-associated ring finger (C3HC4) 4 protein_id : NP_001038998.1

name	Smarcal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055348 GeneID:54380 MGI:1859183
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IDA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Swi/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 protein_id : NP_061287.1

name	Ankar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892815 CCDS:CCDS15035.1 GeneID:319695 MGI:2442559
definition	codon_start : 1 exception : mismatches in translation product : ankyrin and armadillo repeat containing protein_id : NP_795954.1

name	Rpl37a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677785 GeneID:19981 MGI:98068
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L37a protein_id : NP_033110.1

name	Igfbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982260 CCDS:CCDS15036.1 GeneID:16008 MGI:96437
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 product : insulin-like growth factor binding protein 2 protein_id : NP_032368.2

name	Igfbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909322 CCDS:CCDS15037.1 GeneID:16011 MGI:96440
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016942 - insulin-like growth factor binding protein complex [Evidence IC] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IPI] [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 product : insulin-like growth factor binding protein 5 protein_id : NP_034648.2

name	LOC100042860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233891 GeneID:100042860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478991.1

name	Tnp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678395 GeneID:21958 MGI:98784
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0001673 - male germ cell nucleus [Evidence TAS]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence ISS]; GO:0006342 - chromatin silencing [Evidence ISS]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0035042 - fertilization, exchange of chromosomal proteins [Evidence ISS]; GO:0006337 - nucleosome disassembly [Evidence ISS]; GO:0019953 - sexual reproduction [Evidence ISS]; GO:0000012 - single strand break repair [Evidence ISS]; GO:0030317 - sperm motility [Evidence ISS]; GO:0007290 - spermatid nuclear elongation [Evidence ISS]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 product : transition protein 1 protein_id : NP_033433.1

name	1700027A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363485 GeneID:69449 MGI:1916699
definition	codon_start : 1 product : hypothetical protein LOC69449 protein_id : XP_998767.1

name	LOC100043291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233931 GeneID:100043291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480062.1

name	Tns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363487 GeneID:21961 MGI:104552
definition	codon_start : 1 product : tensin 1 protein_id : XP_619639.3

name	Rufy4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702191 CCDS:CCDS15039.1 GeneID:435626 MGI:3588214
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RUN and FYVE domain containing 4 protein_id : NP_001029232.1

name	Il8rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753456 CCDS:CCDS15040.1 GeneID:12765 MGI:105303
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004950 - chemokine receptor activity [Evidence TAS] [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004918 - interleukin-8 receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006935 - chemotaxis [Evidence TAS]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : IL-8 receptor alpha chain; interleukin-8 receptor type B; chemokine (C-X-C) receptor 2 product : interleukin 8 receptor beta protein_id : NP_034039.1

name	Il8ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142679 CCDS:CCDS15041.1 GeneID:227288 MGI:2448715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004918 - interleukin-8 receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CXC chemokine receptor 1-like product : interleukin 8 receptor, alpha protein_id : NP_839972.1

name	Arpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363072 GeneID:76709 MGI:1923959
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030833 - regulation of actin filament polymerization [Evidence IEA] codon_start : 1 note : actin related protein 2/3 complex, subunit 2 (34 kDa) product : actin related protein 2/3 complex, subunit 2 protein_id : NP_083987.1

name	Gpbar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923943 CCDS:CCDS15042.1 GeneID:227289 MGI:2653863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor TGR5; membrane bile acid receptor product : G protein-coupled bile acid receptor 1 protein_id : NP_778150.1

name	Aamp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82524294 CCDS:CCDS15043.1 GeneID:227290 MGI:107809
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : angio-associated migratory protein protein_id : NP_666222.2

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239984 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 3 protein_id : NP_001034598.1

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239988 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 2 protein_id : NP_079856.2

name	Tmbim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980814 CCDS:CCDS15044.1 GeneID:69660 MGI:1916910
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : transmembrane BAX inhibitor motif containing 1 protein_id : NP_081430.2

name	2410125D13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233933 GeneID:73709 MGI:1920959
definition	codon_start : 1 product : hypothetical protein LOC73709 protein_id : XP_001480110.1

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910442 CCDS:CCDS15045.1 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 1 protein_id : NP_064383.1

name	Gm216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701842 CCDS:CCDS15046.1 GeneID:241112 MGI:2685062
definition	codon_start : 1 product : hypothetical protein LOC241112 protein_id : NP_001028517.1

name	Slc11a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7363451 CCDS:CCDS15047.1 GeneID:18173 MGI:1345275
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : natural resistance-associated macrophage protein 1; host resistance locus Bcg/Ity/Lsh product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 protein_id : NP_038640.1

name	Ctdsp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346509 CCDS:CCDS15048.1 GeneID:227292 MGI:2654470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] codon_start : 1 note : nuclear LIM interactor-interacting factor 3; NLI-interacting factor 3; golli-interacting protein product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 protein_id : NP_694728.1

name	Vil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678573 CCDS:CCDS15049.1 GeneID:22349 MGI:98930
definition	GO_component : GO:0005903 - brush border [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : villin 1 protein_id : NP_033535.1

name	Usp37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892803 CCDS:CCDS15050.1 GeneID:319651 MGI:2442483
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 37 protein_id : NP_795946.1

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 5 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 4 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 3 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 2 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 1 pseudo : _no_value

name	LOC672208 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672208
definition	number : 1 pseudo : _no_value

name	LOC672208 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672208
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:160916
definition	standard_name : RH118241

name	(CDS detail)
type	STS
link
xref	UniSTS:178411
definition	standard_name : AI314015

name	(CDS detail)
type	STS
link
xref	UniSTS:178199
definition	standard_name : G66995

name	(CDS detail)
type	STS
link
xref	UniSTS:178412
definition	standard_name : AI851716

name	(CDS detail)
type	STS
link
xref	UniSTS:130229
definition	standard_name : D5Mit109

name	(CDS detail)
type	STS
link
xref	UniSTS:241021
definition	standard_name : D4Mon68

name	(CDS detail)
type	STS
link
xref	UniSTS:471313
definition	standard_name : Igfbp2

name	(CDS detail)
type	STS
link
xref	UniSTS:178409
definition	standard_name : AI255832

name	(CDS detail)
type	STS
link
xref	UniSTS:158806
definition	standard_name : L05439

name	(CDS detail)
type	STS
link
xref	UniSTS:210076
definition	standard_name : RH136081

name	(CDS detail)
type	STS
link
xref	UniSTS:178410
definition	standard_name : AW208790

name	(CDS detail)
type	STS
link
xref	UniSTS:273484
definition	standard_name : PMC85624P4

name	(CDS detail)
type	STS
link
xref	UniSTS:224179
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143490
definition	standard_name : Igfbp5

name	(CDS detail)
type	STS
link
xref	UniSTS:240381
definition	standard_name : D9Wox32

name	(CDS detail)
type	STS
link
xref	UniSTS:128634
definition	standard_name : D1Mit281

name	(CDS detail)
type	STS
link
xref	UniSTS:224656
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:225117
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128741
definition	standard_name : D1Mit380

name	(CDS detail)
type	STS
link
xref	UniSTS:271682
definition	standard_name : PMC18293P1

name	(CDS detail)
type	STS
link
xref	UniSTS:158808
definition	standard_name : X12521

name	(CDS detail)
type	STS
link
xref	UniSTS:158807
definition	standard_name : X12521

name	(CDS detail)
type	STS
link
xref	UniSTS:270992
definition	standard_name : PMC141152P1

name	(CDS detail)
type	STS
link
xref	UniSTS:128635
definition	standard_name : D1Mit282

name	(CDS detail)
type	STS
link
xref	UniSTS:128900
definition	standard_name : D1Mit532

name	(CDS detail)
type	STS
link
xref	UniSTS:128848
definition	standard_name : D1Mit482

name	(CDS detail)
type	STS
link
xref	UniSTS:111358
definition	standard_name : AU046535

name	(CDS detail)
type	STS
link
xref	UniSTS:111358
definition	standard_name : AU046535

name	(CDS detail)
type	STS
link
xref	UniSTS:207171
definition	standard_name : BE200114

name	(CDS detail)
type	STS
link
xref	UniSTS:703
definition	standard_name : STS-Z40715

name	(CDS detail)
type	STS
link
xref	UniSTS:116252
definition	standard_name : D1Mit19

name	(CDS detail)
type	STS
link
xref	UniSTS:128934
definition	standard_name : D1Mit77

name	(CDS detail)
type	STS
link
xref	UniSTS:178413
definition	standard_name : AI648117

name	(CDS detail)
type	STS
link
xref	UniSTS:234149
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128519
definition	standard_name : D1Mit180

name	(CDS detail)
type	STS
link
xref	UniSTS:122836
definition	standard_name : 05.MMHAP84FRB8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:142236
definition	standard_name : D1Mcg105

name	(CDS detail)
type	STS
link
xref	UniSTS:272638
definition	standard_name : PMC310709P2

name	(CDS detail)
type	STS
link
xref	UniSTS:141355
definition	standard_name : Cmkar2

name	(CDS detail)
type	STS
link
xref	UniSTS:158811
definition	standard_name : D17630

name	(CDS detail)
type	STS
link
xref	UniSTS:124880
definition	standard_name : L23637

name	(CDS detail)
type	STS
link
xref	UniSTS:221307
definition	standard_name : RH139221

name	(CDS detail)
type	STS
link
xref	UniSTS:142238
definition	standard_name : D1Mcg165

name	(CDS detail)
type	STS
link
xref	UniSTS:492747
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:140993
definition	standard_name : Aamp-rs

name	(CDS detail)
type	STS
link
xref	UniSTS:158810
definition	standard_name : AU040907

name	(CDS detail)
type	STS
link
xref	UniSTS:161969
definition	standard_name : RH125147

name	(CDS detail)
type	STS
link
xref	UniSTS:181078
definition	standard_name : AI854243

name	(CDS detail)
type	STS
link
xref	UniSTS:211936
definition	standard_name : RH128628

name	(CDS detail)
type	STS
link
xref	UniSTS:163166
definition	standard_name : RH126458

name	(CDS detail)
type	STS
link
xref	UniSTS:160553
definition	standard_name : AA960455

name	(CDS detail)
type	STS
link
xref	UniSTS:185438
definition	standard_name : AU024746

name	(CDS detail)
type	STS
link
xref	UniSTS:167272
definition	standard_name : RH127186

name	(CDS detail)
type	STS
link
xref	UniSTS:160917
definition	standard_name : RH118242

name	(CDS detail)
type	STS
link
xref	UniSTS:142239
definition	standard_name : D1Mcg4

name	(CDS detail)
type	STS
link
xref	UniSTS:144409
definition	standard_name : Slc11a1

name	(CDS detail)
type	STS
link
xref	UniSTS:116253
definition	standard_name : D1Mit24

name	(CDS detail)
type	STS
link
xref	UniSTS:142235
definition	standard_name : D1Mcg101

name	(CDS detail)
type	STS
link
xref	UniSTS:144756
definition	standard_name : Vil

name	(CDS detail)
type	STS
link
xref	UniSTS:128520
definition	standard_name : D1Mit181

name	Pinc (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:115392000 GeneID:723792 MGI:3623820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy induced noncoding RNA transcript_id : NR_003202.1

clone name	MSMg01-532L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-252L09.b	B6Ng01-252L09.g
ACC	GA059634	GA059635
length	1,009	396
definition	B6Ng01-252L09.b	B6Ng01-252L09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(73,394,397 - 73,395,398)	(73,529,071 - 73,529,472)
sequence	gaattctttgtctggcatctcattctctacacttactttctaagcacttc tatttactgtctcttccctgcatttctcttctctgatcattttgttttgg agttggttttttttttcccgggttgaaaaaaaatcttaatggttgaatta tggccatttacatttattgatatgattgacatattctgttcactttgctt tatttctagtttatttaaaagtacaacacaggccttagggaatgcattgc ataaggttttattcttccaagcaagtctcctattttatcctatgtcacaa accaagacacttgaaagttcaccattgttacgttgcactattaatcttct ttttcagataaatttcatcttgtaaccacatgtctcattagggctcatgg acttcttcacaaggtttcttgagctcttctgtgtttaaagttatttctct atggcttcaatatttaaaggattctttggcttacctttgaaatctaatag ttttgataggataatttttattctcctggttactttcctgtgctgatgta atagctttattatgctatcattcagatttggtctccctctggcaccttgt aatttagtctgttttctatatgactttcctctttgtcttctgcctttcct ctcttttcatgtcttgggtgctttgtgtttgtgtgtgtgttacatttcag actcagtgtggggtgttacaaaaagtgtgcgctgtgcagagctcttctgc tcaggttggagtatcagcttgcagttttcttcagcctcatcattatttgg ttccagaccaactttcatcagccgcccatgctccgacactcattctgctt tctcgtgataagaatttgtacgtacaaagctggtttgtgtctctacagtt ctgtgctggggcaggtggcttggaaggatttatcagataacatagagaaa cactctcatctgtcagtgtaataaaaatatgggtttttattcctgaacga tttttgttg	caccttcaccgttgccactctggtctgctcagtctgcgagtgtaattgtc atacttcagctacggagttaacaggatgcagactagaacagtcaaattag cgattgctgttctagggagagttttgttacacacagggaagggctcagca gatgatttgaaagggagaaacagacggtggaaggcagattaaggtttaaa aagcaaataaacacgggtgcatatatgtgtgcatatatatatgtatatta atacatatatatgtctgtataagcgtacatactcatgtgtatacacacac acacacacacacacacacacacacacacacacacacacacacatgactac atgtgtgcctgaacgcacataaagagagaggaggaggaggaggagg
quality values	Open. Hide. 62 41 31 26 62 62 62 62 62 59 62 62 59 62 59 59 59 59 62 62 59 59 62 62 62 62 62 62 62 30 20 32 23 21 23 25 28 34 32 32 28 28 40 40 49 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 43 50 34 32 34 50 48 45 32 49 54 62 46 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 59 56 59 56 59 62 59 62 62 62 62 62 62 62 59 54 54 62 59 59 59 62 62 62 62 62 59 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 59 59 54 62 62 62 62 59 56 56 46 45 56 59 62 59 54 59 56 54 62 56 56 62 62 59 62 62 62 62 59 62 62 62 59 59 62 59 59 59 62 62 62 62 62 62 59 51 62 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 51 51 50 59 59 62 56 59 59 59 59 62 62 62 62 62 59 59 59 62 59 59 59 59 59 56 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 49 43 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 56 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 34 56 59 59 51 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 56 62 47 62 62 62 62 56 62 56 62 62 62 62 62 62 62 44 62 56 56 56 62 62 56 62 62 56 62 56 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 62 62 56 56 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 42 62 62 62 54 62 62 62 62 47 62 62 58 58 58 58 58 58 52 51 43 32 58 53 58 58 58 58 54 58 54 52 49 52 54 58 54 58 43 54 49 54 58 54 54 58 54 58 54 39 58 47 58 54 58 58 58 58 58 58 58 44 43 52 52 54 52 58 54 58 52 58 58 54 58 58 52 58 58 58 52 58 54 58 54 51 58 49 58 51 58 58 58 58 49 58 50 44 44 54 51 58 49 42 50 49 53 58 48 51 52 52 58 50 51 50 58 50 50 58 38 49 47 58 58 58 50 58 50 58 41 51 53 58 40 51 58 50 50 42 53 53 58 51 52 40 14 58 46 50 40 31 24 39 51 33 32 32 44 58 37 58 36 30 31 31 15 50 49 50 49 32 45 54 39 49 40 39 53 52 41 50 50 40 39 23 54 26 35 45 52 47 24 37 52 50 32 50 39 44 20 39 23 51 44 44 51 28 49 52 49 44 51 31 39 47 44 41 38 50 31 35 54 51 31 33 31 37 37 33 30 54 40 37 37 32 40 28 37 41 39 52 46 54 33 33 36 18 48 31 31 26 32 34 10 42 32 37 33 45 53 52 29 34 36 35 33 22 32 40 33 40 40 32 31 31 29 31 30 20 34 22 33 34 29 35 42 31 26 51 46 22 20 42 31 46 46 32 23 31 38 32 19 35 31 26 30 18 13 32 21 18 51 33 32 26 29 31 25 30 20 32 14 47 13 14 38 18 8 29 12 40 31 43 18 26 29 31 34 36 30 9 13 17 31 27 30 27 35 32 30 30 31 24 16 46 46 46 17 25 13 44 20 28 31 24 26 26 25 18 16 31 10 7 28 20 38 25 31 33 19 14 13 42 12 8 6 7 6 24 14 6 13 6 10 44 7 8 16 26 15 17 21 31 24 35 27 26 22 26 25 19 28 19 31 21 32 19 23 25 39 43 48 13 14 18 19 20 33 17 26 34 33 40 10 7 5 13 19 20 12 14 33 10 12 10 33 33 39 34 43 8 16 14 18 25	Open. Hide. 44 42 62 42 22 16 25 12 20 18 18 24 25 28 27 21 43 46 50 59 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 51 34 30 41 39 36 36 56 46 46 34 32 33 50 62 54 49 54 59 62 62 62 62 62 59 62 62 59 62 62 62 62 56 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 54 62 62 62 62 62 62 62 48 48 56 43 62 59 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 56 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 45 56 62 62 62 62 62 62 62 62 62 62 62 62 51 56 56 56 56 56 56 62 62 62 62 62 62 62 62 56 62 47 43 37 37 32 46 62 43 62 56 28 38 21 9 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_73394397_73395398
seq2: B6Ng01-252L09.b_47_1055

seq1  GAATTCTTTGTCTGGCATCTCATTCTCTACACTTACTTTCTAAGCACTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGTCTGGCATCTCATTCTCTACACTTACTTTCTAAGCACTTC  50

seq1  TATTTACTGTCTCTTCCCTGCATTTCTCTTCTCTGATCATTTTGTTTTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTACTGTCTCTTCCCTGCATTTCTCTTCTCTGATCATTTTGTTTTGG  100

seq1  AGTTGGTTTTTTTTTTCCCGGGTTGAAAAAAAATCTTAATGGTTGAATTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGGTTTTTTTTTTCCCGGGTTGAAAAAAAATCTTAATGGTTGAATTA  150

seq1  TGGCCATTTACATTTATTGATATGATTGACATATTCTGTTCACTTTGCTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCATTTACATTTATTGATATGATTGACATATTCTGTTCACTTTGCTT  200

seq1  TATTTCTAGTTTATTTAAAAGTACAACACAGGCCTTAGGGAATGCATTGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTCTAGTTTATTTAAAAGTACAACACAGGCCTTAGGGAATGCATTGC  250

seq1  ATAAGGTTTTATTCTTCCAAGCAAGTCTCCTATTTTATCCTATGTCACAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGTTTTATTCTTCCAAGCAAGTCTCCTATTTTATCCTATGTCACAA  300

seq1  ACCAAGACACTTGAAAGTTCACCATTGTTACGTTGCACTATTAATCTTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAGACACTTGAAAGTTCACCATTGTTACGTTGCACTATTAATCTTCT  350

seq1  TTTTCAGATAAATTTCATCTTGTAACCACATGTCTCATTAGGGCTCATGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCAGATAAATTTCATCTTGTAACCACATGTCTCATTAGGGCTCATGG  400

seq1  ACTTCTTCACAAGGTTTCTTGAGCTCTTCTGTGTTTAAAGTTATTTCTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCTTCACAAGGTTTCTTGAGCTCTTCTGTGTTTAAAGTTATTTCTCT  450

seq1  ATGGCTTCAATATTTAAAGGATTCTTTGGCTTACCTTTGAAATCTAATAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTTCAATATTTAAAGGATTCTTTGGCTTACCTTTGAAATCTAATAG  500

seq1  TTTTGATAGGATAATTTTTATTCTCCTGGTTACTTTCCTGTGCTGATGTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGATAGGATAATTTTTATTCTCCTGGTTACTTTCCTGTGCTGATGTA  550

seq1  ATAGCTTTATTATGCTATCATTCAGATTTGGTCTCCCTCTGGCACCTTGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCTTTATTATGCTATCATTCAGATTTGGTCTCCCTCTGGCACCTTGT  600

seq1  AATTTAGTCTGTTTTCTATATGACTTTCCTCTTTGTCTTCTGCCTTTCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAGTCTGTTTTCTATATGACTTTCCTCTTTGTCTTCTGCCTTTCCT  650

seq1  CTCTTTTCATGTCTTGGGTGCTTTGTGTTTGTGTGTGTGTTACATTTCAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTTCATGTCTTGGGTGCTTTGTGTTTGTGTGTGTGTTACATTTCAG  700

seq1  ACTCAGTGTGGGGTGTTAC-AAAAGTGTGCGCTGTGCAGAGCTCTTCTGC  749
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  ACTCAGTGTGGGGTGTTACAAAAAGTGTGCGCTGTGCAGAGCTCTTCTGC  750

seq1  TCAGGTTGGAGTATCAGCTTGCAGTTTTCTTCAGCCTCATCATTATTTGG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGTTGGAGTATCAGCTTGCAGTTTTCTTCAGCCTCATCATTATTTGG  800

seq1  TTCCAGACCAACTTTCATCAGCCGCCCATGCTCCGACACTCATTCTGCTT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGACCAACTTTCATCAGCCGCCCATGCTCCGACACTCATTCTGCTT  850

seq1  TCTCGTGATAAGAATTTGTACGTACAAAGCTGGTTTGTGTCTCTACAGTT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCGTGATAAGAATTTGTACGTACAAAGCTGGTTTGTGTCTCTACAGTT  900

seq1  CTGTGCTGGGGCAGGTGGCTTGGAA-GATTTATCAGATACATTAGAG-AA  947
      ||||||||||||||||||||||||| |||||||||||||   ||||| ||
seq2  CTGTGCTGGGGCAGGTGGCTTGGAAGGATTTATCAGATAACATAGAGAAA  950

seq1  CACTCTCATCTGTCAGTGTAAT-AAAATAT-GGTTTTTA-TCCTGAACGA  994
      |||||||||||||||||||||| ||||||| |||||||| ||||||||||
seq2  CACTCTCATCTGTCAGTGTAATAAAAATATGGGTTTTTATTCCTGAACGA  1000

seq1  -TTTTGTTG  1002
       ||||||||
seq2  TTTTTGTTG  1009

seq1: chr1_73529071_73529472
seq2: B6Ng01-252L09.g_71_472 (reverse)

seq1  CCTCCTCCTCCTCCTCCTCTCTCTTTATGTGCGTTCAGGCACACATGTAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCTCCTCCTCCTCTCTCTTTATGTGCGTTCAGGCACACATGTAG  50

seq1  TCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  100

seq1  GTGTATACACATGAGTATGTACGCTTATACAGACATATATATGTATTAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTATACACATGAGTATGTACGCTTATACAGACATATATATGTATTAAT  150

seq1  ATACATATATATATGCACACATATATGCACCCGTGTTTATTTGCTTTTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATATATATATGCACACATATATGCACCCGTGTTTATTTGCTTTTTA  200

seq1  AACCTTAATCTGCCTTCCACCGTCTGTTTCTCCCTTTCAAATCATCTGCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTTAATCTGCCTTCCACCGTCTGTTTCTCCCTTTCAAATCATCTGCT  250

seq1  GAGCCCTTCCCTGTGTGTAACAAAACTCTCCCTAGAACAGCAATCGCTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCCTTCCCTGTGTGTAACAAAACTCTCCCTAGAACAGCAATCGCTAA  300

seq1  TTTGACTGTTCTAGTCTGCATCCTGTTAACTCCGTAGCTGAAGTATGACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGACTGTTCTAGTCTGCATCCTGTTAACTCCGTAGCTGAAGTATGACA  350

seq1  ATTACACTCGCAGACTGAGCAGACCAGAGTGGCAACGGTGAAGGTGGAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACACTCGCAGACTGAGCAGACCAGAGTGGCAACGGTGAAGGTGGAAT  400

seq1  TC  402
      ||
seq2  TC  402

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information