MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-261K13
Chromosome	1 (Build37)
Map Location	172,120,958 - 172,257,096
singlet/doublet	doublet
Overlap gene	Uhmk1, Sh2d1b2, EG622708, Sh2d1b1, EG665574, 1700015E13Rik
Upstream gene	EG383613, Nuf2, Rgs5, Rgs4, LOC100039960, 1700084C01Rik, Hsd17b7, Ddr2, LOC100040571, Uap1
Downstream gene	Nos1ap, LOC100040002, LOC640532, Olfml2b, Atf6, Dusp12, Fcrlb, Fcrla, LOC100040778, Fcgr2b, Fcgr4, Fcgr3, 1700009P17Rik, Sdhc, Mpz, Pcp4l1, Nr1i3, Tomm40l, Apoa2, Fcer1g, Ndufs2, Adamts4, B4galt3, Ppox, Usp21, Ufc1, EG622236
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG383613 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383613 MGI:3643416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 7 Proteins

name	Nuf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66977 MGI:1914227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19737 MGI:1098434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19736 MGI:108409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700084C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78465 MGI:1925715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd17b7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15490 MGI:1330808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18214 MGI:1345277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Uap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107652 MGI:1334459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uhmk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16589 MGI:1341908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2d1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545378 MGI:3622649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622708 MGI:3647370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Sh2d1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26904 MGI:1349420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665574 MGI:3649135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	1700015E13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76925 MGI:1924175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nos1ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70729 MGI:1917979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC640532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1019 ESTs, 7 Proteins pseudo : _no_value

name	Olfml2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320078 MGI:2443310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226641 MGI:1926157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80915 MGI:1890614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrlb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435653 MGI:3576487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98752 MGI:2138647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040778 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 192 ESTs, 4 Proteins

name	Fcgr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14130 MGI:95499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fcgr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246256 MGI:2179523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcgr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14131 MGI:95500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700009P17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75472 MGI:1922722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdhc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66052 MGI:1913302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17528 MGI:103177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcp4l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66425 MGI:1913675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 133 ESTs, 1 Protein

name	Nr1i3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12355 MGI:1346307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tomm40l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:641376 MGI:3589112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11807 MGI:88050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcer1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14127 MGI:95496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226646 MGI:2385112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamts4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240913 MGI:1339949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57370 MGI:1928767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19044 MGI:104968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30941 MGI:1353665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ufc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66155 MGI:1913405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622236 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622236 MGI:3645348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 600 ESTs, 6 Proteins

name	EG383613 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245356 GeneID:383613 MGI:3643416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 7 Proteins product : predicted gene, EG383613 transcript_id : XM_357154.6

name	Nuf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802398 GeneID:66977 MGI:1914227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) transcript_id : NM_023284.3

name	Rgs5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801698 GeneID:19737 MGI:1098434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 5 transcript_id : NM_009063.3

name	Rgs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543587 GeneID:19736 MGI:108409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 4 transcript_id : NM_009062.2

name	1700084C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373100 GeneID:78465 MGI:1925715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700084C01 gene transcript_id : NM_001033185.2

name	Hsd17b7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87162469 GeneID:15490 MGI:1330808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 7 transcript_id : NM_010476.3

name	Ddr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13937362 GeneID:18214 MGI:1345277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discoidin domain receptor family, member 2 transcript_id : NM_022563.1

name	LOC100040571 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245362 GeneID:100040571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040571 transcript_id : XM_001475554.1

name	Uap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358975 GeneID:107652 MGI:1334459
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetylglucosamine pyrophosphorylase 1 transcript_id : NM_133806.3

name	Uhmk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254329 GeneID:16589 MGI:1341908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U2AF homology motif (UHM) kinase 1 transcript_id : NM_010633.3

name	Sh2d1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677447 GeneID:545378 MGI:3622649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain protein 1B2 transcript_id : NM_001033499.1

name	EG622708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364510 GeneID:622708 MGI:3647370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG622708 transcript_id : XM_887157.2

name	Sh2d1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356954 GeneID:26904 MGI:1349420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain protein 1B1 transcript_id : NM_012009.3

name	EG665574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364512 GeneID:665574 MGI:3649135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : predicted gene, EG665574 transcript_id : XM_977895.1

name	1700015E13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853562 GeneID:76925 MGI:1924175
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700015E13 gene transcript_id : NM_001039593.1

name	Nos1ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384213 GeneID:70729 MGI:1917979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitric oxide synthase 1 (neuronal) adaptor protein transcript_id : NM_027528.2

name	LOC100040002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245301 GeneID:100040002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100040002 transcript_id : XM_001473929.1

name	Olfml2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982213 GeneID:320078 MGI:2443310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin-like 2B transcript_id : NM_177068.3

name	Atf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486810 GeneID:226641 MGI:1926157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 6 transcript_id : NM_001081304.1

name	Dusp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778929 GeneID:80915 MGI:1890614
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 12 transcript_id : NM_023173.2

name	Fcrlb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288908 GeneID:435653 MGI:3576487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like B transcript_id : NM_001029984.2

name	Fcrla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553084 GeneID:98752 MGI:2138647
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like A transcript_id : NM_145141.1

name	LOC100040778 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245374 GeneID:100040778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 192 ESTs, 4 Proteins product : similar to ubiquinol-cytochrome c reductase binding protein transcript_id : XM_001475899.1

name	Fcgr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063577 GeneID:14130 MGI:95499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity IIb transcript_id : NM_010187.2

name	Fcgr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063578 GeneID:14130 MGI:95499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity IIb transcript_id : NM_001077189.1

name	Fcgr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362368 GeneID:246256 MGI:2179523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity IV transcript_id : NM_144559.1

name	Fcgr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76150626 GeneID:14131 MGI:95500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity III transcript_id : NM_010188.4

name	1700009P17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486892 GeneID:75472 MGI:1922722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700009P17 gene transcript_id : NM_001081275.1

name	Sdhc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803581 GeneID:66052 MGI:1913302
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate dehydrogenase complex, subunit C, integral membrane protein transcript_id : NM_025321.2

name	Mpz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802366 GeneID:17528 MGI:103177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin protein zero transcript_id : NM_008623.3

name	Pcp4l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245310 GeneID:66425 MGI:1913675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 133 ESTs, 1 Protein product : Purkinje cell protein 4-like 1 transcript_id : XM_484933.5

name	Nr1i3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385626 GeneID:12355 MGI:1346307
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group I, member 3 transcript_id : NM_009803.3

name	Tomm40l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802384 GeneID:641376 MGI:3589112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 40 homolog-like (yeast) transcript_id : NM_001037170.2

name	Apoa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304896 GeneID:11807 MGI:88050
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein A-II transcript_id : NM_013474.1

name	Fcer1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91932796 GeneID:14127 MGI:95496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgE, high affinity I, gamma polypeptide transcript_id : NM_010185.4

name	Ndufs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376353 GeneID:226646 MGI:2385112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) Fe-S protein 2 transcript_id : NM_153064.4

name	Adamts4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129941 GeneID:240913 MGI:1339949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4 transcript_id : NM_172845.2

name	B4galt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181157 GeneID:57370 MGI:1928767
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3 transcript_id : NM_020579.1

name	Ppox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431259 GeneID:19044 MGI:104968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protoporphyrinogen oxidase transcript_id : NM_008911.2

name	Usp21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347963 GeneID:30941 MGI:1353665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 21 transcript_id : NM_013919.3

name	Ufc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379212 GeneID:66155 MGI:1913405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-fold modifier conjugating enzyme 1 transcript_id : NM_025388.2

name	EG622236 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245396 GeneID:622236 MGI:3645348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 599 ESTs, 6 Proteins product : predicted gene, EG622236, transcript variant 1 transcript_id : XM_889804.3

name	EG383613 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245357 GeneID:383613 MGI:3643416
definition	codon_start : 1 product : similar to isolog of yeast sui1 and rice gos2; putative protein_id : XP_357154.5

name	Nuf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625714 CCDS:CCDS15463.1 GeneID:66977 MGI:1914227
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0000776 - kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008608 - attachment of spindle microtubules to kinetochore [Evidence ISS]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : cell division cycle associated 1 product : NUF2R protein protein_id : NP_075773.2

name	Rgs5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336055 CCDS:CCDS15464.1 GeneID:19737 MGI:1098434
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signaling 5 protein_id : NP_033089.2

name	Rgs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543588 CCDS:CCDS15465.1 GeneID:19736 MGI:108409
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signaling 4 protein_id : NP_033088.2

name	1700084C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701698 CCDS:CCDS15466.1 GeneID:78465 MGI:1925715
definition	codon_start : 1 product : hypothetical protein LOC78465 protein_id : NP_001028357.1

name	Hsd17b7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87162470 GeneID:15490 MGI:1330808
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000253 - 3-keto sterol reductase activity [Evidence IDA]; GO:0050576 - 3-keto-steroid reductase activity [Evidence IEA]; GO:0004303 - estradiol 17-beta-dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : hydroxysteroid 17-beta dehydrogenase 7; 17-beta-hydroxysteroid dehydrogenase type 7 product : hydroxysteroid (17-beta) dehydrogenase 7 protein_id : NP_034606.3

name	Ddr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937363 GeneID:18214 MGI:1345277
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IDA] codon_start : 1 product : discoidin domain receptor family, member 2 protein_id : NP_072075.1

name	LOC100040571 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245363 GeneID:100040571
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475604.1

name	Uap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520375 CCDS:CCDS15467.1 GeneID:107652 MGI:1334459
definition	EC_number : 2.7.7.23 GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003977 - UDP-N-acetylglucosamine diphosphorylase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : sperm associated antigen 2; antigen X product : UDP-N-acetylglucosamine pyrophosphorylase 1 protein_id : NP_598567.2

name	Uhmk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254330 CCDS:CCDS15468.1 GeneID:16589 MGI:1341908
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence ISS]; GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046825 - regulation of protein export from nucleus [Evidence ISS] codon_start : 1 note : kinase interacting with leukemia-associated gene (stathmin) product : U2AF homology motif (UHM) kinase 1 protein_id : NP_034763.3

name	Sh2d1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677448 CCDS:CCDS15469.1 GeneID:545378 MGI:3622649
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA] codon_start : 1 product : EAT-2-related transducer protein_id : NP_001028671.1

name	EG622708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883142 GeneID:622708 MGI:3647370
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892250.1

name	Sh2d1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542592 GeneID:26904 MGI:1349420
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0001784 - phosphotyrosine binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy note : EWS/FLI1 activated transcript 2 product : SH2 domain protein 1B protein_id : NP_036139.2

name	EG665574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364513 GeneID:665574 MGI:3649135
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982989.1

name	1700015E13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853563 CCDS:CCDS15471.1 GeneID:76925 MGI:1924175
definition	codon_start : 1 product : hypothetical protein LOC76925 protein_id : NP_001034682.1

name	Nos1ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625798 GeneID:70729 MGI:1917979
definition	GO_function : GO:0050998 - nitric-oxide synthase binding [Evidence ISS]; GO:0030165 - PDZ domain binding [Evidence ISS] codon_start : 1 product : C-terminal PDZ domain ligand of neuronal nitric oxide synthase protein_id : NP_081804.1

name	LOC100040002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245302 GeneID:100040002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473979.1

name	Olfml2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982214 CCDS:CCDS15473.1 GeneID:320078 MGI:2443310
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : photomedin-2 product : olfactomedin-like 2B protein_id : NP_796042.2

name	Atf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486811 GeneID:226641 MGI:1926157
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : activating transcription factor 6 protein_id : NP_001074773.1

name	Dusp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778930 CCDS:CCDS15474.1 GeneID:80915 MGI:1890614
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 12 protein_id : NP_075662.2

name	Fcrlb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288909 CCDS:CCDS15475.1 GeneID:435653 MGI:3576487
definition	codon_start : 1 note : Fc receptor-like mucin-like 2; Fc receptor related Y product : Fc receptor-like B protein_id : NP_001025155.2

name	Fcrla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553085 GeneID:98752 MGI:2138647
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA] codon_start : 1 note : Fc receptor related protein X; Fc receptor-like mucin-like 1; Fc receptor related X product : Fc receptor homolog expressed in B cells protein_id : NP_660123.1

name	LOC100040778 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245375 GeneID:100040778
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475949.1

name	Fcgr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857783 GeneID:14130 MGI:95499
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence TAS] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0045576 - mast cell activation [Evidence IDA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0050777 - negative regulation of immune response [Evidence IMP]; GO:0001811 - negative regulation of type I hypersensitivity [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Fc-gamma-RII; Fc gamma RIIB; FcgammaRIIB product : Fc receptor, IgG, low affinity IIb isoform 2 protein_id : NP_034317.1

name	Fcgr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063579 GeneID:14130 MGI:95499
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence TAS] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0045576 - mast cell activation [Evidence IDA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0050777 - negative regulation of immune response [Evidence IMP]; GO:0001811 - negative regulation of type I hypersensitivity [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Fc-gamma-RII; Fc gamma RIIB; FcgammaRIIB product : Fc receptor, IgG, low affinity IIb isoform 1 protein_id : NP_001070657.1

name	Fcgr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362369 CCDS:CCDS15476.1 GeneID:246256 MGI:2179523
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Fc receptor-like 3; Fc fragment of IgG, low affinity IIIa, receptor product : Fc gammaRIV protein_id : NP_653142.1

name	Fcgr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753834 CCDS:CCDS15477.1 GeneID:14131 MGI:95500
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IMP]; GO:0019770 - IgG receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001788 - antibody-dependent cellular cytotoxicity [Evidence IMP]; GO:0042590 - antigen processing and presentation of exogenous peptide antigen via MHC class I [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0045576 - mast cell activation [Evidence IDA] [Evidence IMP]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IMP]; GO:0006910 - phagocytosis, recognition [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence IMP]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IMP]; GO:0001812 - positive regulation of type I hypersensitivity [Evidence IMP] [Evidence IDA]; GO:0001798 - positive regulation of type IIa hypersensitivity [Evidence IMP]; GO:0001805 - positive regulation of type III hypersensitivity [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0001820 - serotonin secretion [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Fcg receptor III; FcgammaRIII; Fc gamma receptor III product : Fc receptor, IgG, low affinity III protein_id : NP_034318.1

name	1700009P17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486893 GeneID:75472 MGI:1922722
definition	codon_start : 1 product : hypothetical protein LOC75472 protein_id : NP_001074744.1

name	Sdhc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384690 GeneID:66052 MGI:1913302
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000104 - succinate dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : succinate dehydrogenase complex, subunit C, integral membrane protein protein_id : NP_079597.1

name	Mpz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678928 CCDS:CCDS15479.1 GeneID:17528 MGI:103177
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045217 - intercellular junction maintenance [Evidence IMP] codon_start : 1 exception : mismatches in translation product : myelin protein zero protein_id : NP_032649.1

name	Pcp4l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245311 GeneID:66425 MGI:1913675
definition	codon_start : 1 product : Purkinje cell protein 4-like 1 protein_id : XP_484933.5

name	Nr1i3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921568 CCDS:CCDS15480.1 GeneID:12355 MGI:1346307
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : constitutively transactivates RAREs product : constitutive androstane receptor protein_id : NP_033933.2

name	Tomm40l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921605 CCDS:CCDS15481.1 GeneID:641376 MGI:3589112
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005741 - mitochondrial outer membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0008308 - voltage-gated ion-selective channel activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocase of outer mitochondrial membrane 40 homolog-like protein_id : NP_001032247.1

name	Apoa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304897 GeneID:11807 MGI:88050
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence ISS] GO_process : GO:0015759 - beta-glucoside transport [Evidence NAS]; GO:0006631 - fatty acid metabolism [Evidence NAS]; GO:0006006 - glucose metabolism [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA]; GO:0050995 - negative regulation of lipid catabolism [Evidence ISS]; GO:0050748 - negative regulation of lipoprotein metabolism [Evidence ISS]; GO:0042119 - neutrophil activation [Evidence ISS]; GO:0045416 - positive regulation of interleukin-8 biosynthesis [Evidence ISS]; GO:0030300 - regulation of cholesterol absorption [Evidence IMP]; GO:0001817 - regulation of cytokine production [Evidence ISS]; GO:0009749 - response to glucose stimulus [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : apolipoprotein A-II protein_id : NP_038502.1

name	Fcer1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753830 CCDS:CCDS15483.1 GeneID:14127 MGI:95496
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0045121 - lipid raft [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0019863 - IgE binding [Evidence IDA]; GO:0019864 - IgG binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0042590 - antigen processing and presentation of exogenous peptide antigen via MHC class I [Evidence IMP]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA] [Evidence IMP]; GO:0042742 - defense response to bacterium [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IMP]; GO:0050778 - positive regulation of immune response [Evidence IMP]; GO:0045082 - positive regulation of interleukin-10 biosynthesis [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence IMP]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IMP]; GO:0001798 - positive regulation of type IIa hypersensitivity [Evidence IMP]; GO:0001805 - positive regulation of type III hypersensitivity [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : Fc receptor, IgE, high affinity I, gamma polypeptide protein_id : NP_034315.1

name	Ndufs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346461 CCDS:CCDS15484.1 GeneID:226646 MGI:2385112
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016651 - oxidoreductase activity, acting on NADH or NADPH [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH-coenzyme Q reductase product : NADH dehydrogenase (ubiquinone) Fe-S protein 2 protein_id : NP_694704.1

name	Adamts4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370274 CCDS:CCDS15485.1 GeneID:240913 MGI:1339949
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 note : aggrecanase-1 product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4 protein_id : NP_766433.1

name	B4galt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181158 CCDS:CCDS15486.1 GeneID:57370 MGI:1928767
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003831 - beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003945 - N-acetyllactosamine synthase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : beta-1,4-galactosyltransferase III; beta4GalT-III product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3 protein_id : NP_065604.1

name	Ppox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679445 CCDS:CCDS15487.1 GeneID:19044 MGI:104968
definition	GO_component : GO:0031304 - intrinsic to mitochondrial inner membrane [Evidence IDA]; GO:0031966 - mitochondrial membrane [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004729 - protoporphyrinogen oxidase activity [Evidence IEA] [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence ISS] [Evidence IEA]; GO:0006783 - heme biosynthesis [Evidence IEA] [Evidence ISS]; GO:0006779 - porphyrin biosynthesis [Evidence IEA] codon_start : 1 note : protoporhyrinogen oxidase product : protoporphyrinogen oxidase protein_id : NP_032937.1

name	Usp21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305615 GeneID:30941 MGI:1353665
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin specific protease 23; ubiquitin specific protease 21 product : ubiquitin-specific protease 21 protein_id : NP_038947.1

name	Ufc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384768 CCDS:CCDS15488.1 GeneID:66155 MGI:1913405
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : Ufm1-conjugating enzyme 1 protein_id : NP_079664.1

name	EG622236 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883122 GeneID:622236 MGI:3645348
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_894897.1

name	LOC100039960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039960
definition	number : 2 pseudo : _no_value

name	LOC100039960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039960
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:116262
definition	standard_name : D1Mit36

name	(CDS detail)
type	STS
link
xref	UniSTS:128764
definition	standard_name : D1Mit402

name	(CDS detail)
type	STS
link
xref	UniSTS:124365
definition	standard_name : 40.MMHAP33FLF4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207250
definition	standard_name : RH127219

name	(CDS detail)
type	STS
link
xref	UniSTS:178513
definition	standard_name : AU044112

name	(CDS detail)
type	STS
link
xref	UniSTS:495957
definition	standard_name : Rgs5

name	(CDS detail)
type	STS
link
xref	UniSTS:249355
definition	standard_name : AA817884

name	(CDS detail)
type	STS
link
xref	UniSTS:234267
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143034
definition	standard_name : AA004315

name	(CDS detail)
type	STS
link
xref	UniSTS:123118
definition	standard_name : 12.MMHAP37FRD9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128890
definition	standard_name : D1Mit524

name	(CDS detail)
type	STS
link
xref	UniSTS:158886
definition	standard_name : AI266814

name	(CDS detail)
type	STS
link
xref	UniSTS:163271
definition	standard_name : Y15733

name	(CDS detail)
type	STS
link
xref	UniSTS:213793
definition	standard_name : RH130509

name	(CDS detail)
type	STS
link
xref	UniSTS:164140
definition	standard_name : AI838577

name	(CDS detail)
type	STS
link
xref	UniSTS:234264
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:248458
definition	standard_name : BE116270

name	(CDS detail)
type	STS
link
xref	UniSTS:108994
definition	standard_name : G49238

name	(CDS detail)
type	STS
link
xref	UniSTS:178505
definition	standard_name : AW495251

name	(CDS detail)
type	STS
link
xref	UniSTS:161210
definition	standard_name : RH124388

name	(CDS detail)
type	STS
link
xref	UniSTS:143024
definition	standard_name : AA437972

name	(CDS detail)
type	STS
link
xref	UniSTS:207249
definition	standard_name : AU021979

name	(CDS detail)
type	STS
link
xref	UniSTS:158885
definition	standard_name : AI449218

name	(CDS detail)
type	STS
link
xref	UniSTS:162417
definition	standard_name : RH125603

name	(CDS detail)
type	STS
link
xref	UniSTS:128711
definition	standard_name : D1Mit353

name	(CDS detail)
type	STS
link
xref	UniSTS:128877
definition	standard_name : D1Mit508

name	(CDS detail)
type	STS
link
xref	UniSTS:125316
definition	standard_name : MHAa78a4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:214203
definition	standard_name : RH130919

name	(CDS detail)
type	STS
link
xref	UniSTS:159043
definition	standard_name : AU042046

name	(CDS detail)
type	STS
link
xref	UniSTS:128545
definition	standard_name : D1Mit205

name	(CDS detail)
type	STS
link
xref	UniSTS:128825
definition	standard_name : D1Mit455

name	(CDS detail)
type	STS
link
xref	UniSTS:142249
definition	standard_name : D1Mit473

name	(CDS detail)
type	STS
link
xref	UniSTS:106044
definition	standard_name : G45242

name	(CDS detail)
type	STS
link
xref	UniSTS:178506
definition	standard_name : AI467542

name	(CDS detail)
type	STS
link
xref	UniSTS:218943
definition	standard_name : RH136854

name	(CDS detail)
type	STS
link
xref	UniSTS:143035
definition	standard_name : AA789574

name	(CDS detail)
type	STS
link
xref	UniSTS:158884
definition	standard_name : AI326426

name	(CDS detail)
type	STS
link
xref	UniSTS:128619
definition	standard_name : D1Mit270

name	(CDS detail)
type	STS
link
xref	UniSTS:178508
definition	standard_name : AW061147

name	(CDS detail)
type	STS
link
xref	UniSTS:178514
definition	standard_name : AW049275

name	(CDS detail)
type	STS
link
xref	UniSTS:143022
definition	standard_name : AA027408

name	(CDS detail)
type	STS
link
xref	UniSTS:185457
definition	standard_name : BB219290

name	(CDS detail)
type	STS
link
xref	UniSTS:123612
definition	standard_name : 23.MMHAP61FLH2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125784
definition	standard_name : X04648

name	(CDS detail)
type	STS
link
xref	UniSTS:165121
definition	standard_name : AI528646

name	(CDS detail)
type	STS
link
xref	UniSTS:128484
definition	standard_name : D1Mit147

name	(CDS detail)
type	STS
link
xref	UniSTS:128485
definition	standard_name : D1Mit148

name	(CDS detail)
type	STS
link
xref	UniSTS:128483
definition	standard_name : D1Mit146

name	(CDS detail)
type	STS
link
xref	UniSTS:178510
definition	standard_name : M14215

name	(CDS detail)
type	STS
link
xref	UniSTS:123914
definition	standard_name : 30.MMHAP69FRB12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178509
definition	standard_name : AV282292

name	(CDS detail)
type	STS
link
xref	UniSTS:207247
definition	standard_name : AW742715

name	(CDS detail)
type	STS
link
xref	UniSTS:210535
definition	standard_name : RH136553

name	(CDS detail)
type	STS
link
xref	UniSTS:158883
definition	standard_name : AI316496

name	(CDS detail)
type	STS
link
xref	UniSTS:123661
definition	standard_name : 24.MMHAP87FRH9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234265
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143018
definition	standard_name : AA209988

name	(CDS detail)
type	STS
link
xref	UniSTS:164138
definition	standard_name : AI551208

name	(CDS detail)
type	STS
link
xref	UniSTS:272971
definition	standard_name : PMC316377P4

name	(CDS detail)
type	STS
link
xref	UniSTS:141108
definition	standard_name : Apoa2

name	(CDS detail)
type	STS
link
xref	UniSTS:143082
definition	standard_name : Fcer1g

name	(CDS detail)
type	STS
link
xref	UniSTS:165122
definition	standard_name : AI573376

name	(CDS detail)
type	STS
link
xref	UniSTS:224644
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161025
definition	standard_name : RH124203

name	(CDS detail)
type	STS
link
xref	UniSTS:499184
definition	standard_name : Ndufs2

name	(CDS detail)
type	STS
link
xref	UniSTS:495974
definition	standard_name : Adamts4

name	(CDS detail)
type	STS
link
xref	UniSTS:234266
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161960
definition	standard_name : RH125138

name	(CDS detail)
type	STS
link
xref	UniSTS:32953
definition	standard_name : RH64578

name	(CDS detail)
type	STS
link
xref	UniSTS:178515
definition	standard_name : AW125175

name	(CDS detail)
type	STS
link
xref	UniSTS:211850
definition	standard_name : RH128542

name	(CDS detail)
type	STS
link
xref	UniSTS:144255
definition	standard_name : Ppox

name	(CDS detail)
type	STS
link
xref	UniSTS:94919
definition	standard_name : G43283

name	(CDS detail)
type	STS
link
xref	UniSTS:143014
definition	standard_name : W53272

name	(CDS detail)
type	STS
link
xref	UniSTS:72126
definition	standard_name : STS-Z40895

name	(CDS detail)
type	STS
link
xref	UniSTS:143015
definition	standard_name : AA062310

name	LOC640532 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245303 GeneID:640532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1019 ESTs, 7 Proteins product : similar to Rpl17 protein pseudo : _no_value transcript_id : XR_031469.1

clone name	MSMg01-157E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397M20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349H03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-187G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094L10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-261K13.b	B6Ng01-261K13.g
ACC	GA066271	GA066272
length	1,061	674
definition	B6Ng01-261K13.b	B6Ng01-261K13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(172,120,958 - 172,122,018)	(172,256,423 - 172,257,096)
sequence	gaattcatccctacaactttactcctggcattagacactctgagaagcaa ctggctcgcatagatccacacctacattaactgtaaaatatctttttgaa ttaatgatcacttactaccaagattttcatccaggtaatgggttctcctt ggagtatttatatagctattagctatgcgatattgctaaaatctgagaca aaactcttccccgaggtatttagacctgactttgaaattggattatcgaa gtttacagtgctactttaaataggaatggccacatatagacttatatatc tgaatacttagtcactagggaatggcgctacttgacaggaattaggaggt gtggccttgttgaaagaggtgtgtcactaagtgtgggtttggggtttcag aagctcaagccaggcccagggctctttctcttcctgctgccaatgaatcc agatgcagagatatcagtcactctccagcaccatgtctgcctgcaagcca ccatgctccctgccctgatgacaacagagcccaagtcaatgctttccttg ataaccgctgccatgggggaagtctctggttggccagctgccggggacca cgtggctatccaggggctgtgcataactggccccattcccccctggatgc ggtactctggagagcagtacacaaaggacacaacatgaagtctgggaagc agttaaagcgtttatgctgtgggcaaaatgggtggacgtggaattcccag aacccacatcaatgatgggtgggtgtggcagctcacctgtaattccaacc ataaaaggcagagacaaggggtccccagagcaaagctggctaaccagact agctatgctagcaagctctgggaccgattggttgagagacccttctcaaa gatggaagagtgattgacaaagtcttcacatcagccttaggccttgacac atggatgcacacatgcacaccagctctgtacatgccccctatgcccacac ccaccacacatgtacaaagaggagtacacgcctcggaggtaaagtggggg ggagagggggg	gaattcattataatagcaatggacttttaggaatttaggtagatgatccg agccatttgagaagaactggctacctcttagcatccagatggagtctgtg ccctgaagtcgggttggaatatagctgctttgtgggagattgggctgatc acccttgcttgttttcagaggaatccttgagtttgacttctatggaggac actggtaattcatgcttccttggagaccagtaggctgagccttctctcta ttatgggcaagtcagggatggtgaagaaacatgcttgagttccaggcagg gtcagggattatatggatagctgaaggtggtcaggaagggaggatagttg gaaagttatctgggaaggccaatgtatgcaccagccttcttgtgtgttct gcctcctcttctcctgactccggagtgaagcgaagcccgatggcagagtg ttcctttcctctgtacactttcaggaagcatccggcagcctatccttaat caaatcagcaagggtgtggctttaaagagctctcttgtcatcttgccttt gctgactgtacccgaggcaccagccttgtgggtcactttgttccacattt caggagacttggaatcagtgggatgctgctccaaggtactagatagaacc tcagaggtggggtgggggtgggga
quality values	Open. Hide. 58 42 19 26 54 31 20 54 62 62 62 62 62 54 26 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 59 59 59 45 37 59 56 56 56 46 62 62 54 59 59 62 62 62 62 62 62 62 62 62 49 49 49 49 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 54 49 54 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 38 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 54 47 58 58 58 58 58 58 54 54 54 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 52 48 58 54 53 58 48 52 58 58 58 58 58 54 58 58 58 36 26 48 48 58 54 38 45 58 58 53 51 51 58 46 41 58 58 58 58 58 58 58 58 54 53 42 51 51 58 58 58 58 45 42 51 58 47 42 47 58 51 58 58 58 58 58 58 54 58 36 33 51 41 50 58 50 50 51 54 58 53 58 58 58 36 46 50 52 53 52 50 53 53 52 51 51 58 51 49 58 51 40 42 51 50 58 53 52 47 58 49 49 35 52 58 51 58 58 49 46 49 35 50 40 40 58 53 52 58 53 52 41 40 37 33 35 52 52 45 45 47 49 42 54 49 44 41 38 54 54 51 42 50 54 53 45 53 49 38 22 33 44 40 51 51 45 35 53 26 54 37 40 34 54 39 52 54 53 40 47 34 53 42 35 47 42 53 37 26 54 54 52 36 54 54 54 52 54 37 54 53 39 45 32 53 41 40 33 33 52 39 42 35 34 41 20 53 37 53 29 46 53 32 34 40 35 53 53 25 28 24 7 32 26 52 21 31 26 10 35 32 49 51 51 31 31 51 46 51 28 30 51 15 30 28 51 51 31 37 43 33 22 17 31 31 31 21 40 31 23 45 23 33 43 26 31 34 31 36 36 34 25 25 29 31 26 31 31 31 36 34 31 46 46 24 17 6 20 15 42 31 43 25 21 8 13 27 42 23 42 23 33 20 40 32 22 30 31 31 31 28 46 25 19 24 15 31 30 24 32 20 26 8 31 31 19 11 41 31 31 18 27 46 39 25 33 35 22 37 26 25 29 23 37 31 21 25 31 24 22 21 29 25 22 24 21 35 32 31 31 20 18 29 22 32 38 27 15 17 33 31 27 24 21 18 19 32 36 31 17 31 24 14 31 31 27 34 31 23 24 24 14 20 9 13 14 33 32 34 36 39 29 19 27 31 14 28 43 7 4 8 11 13 48 30 15 25 21 15 21 19 29 31 32 34 26 27 11 12 37 31 10 37 26 11 29 9 30 17 17 12 14 15 24 15 11 6 5 4 25 13 22 12 11 34 12 14 20 24 8 5 10 10 21 10 5 5 7 9 25 40 29 34 28	Open. Hide. 62 47 42 47 62 47 29 62 62 62 45 43 39 32 22 22 40 34 43 46 49 49 59 62 62 62 54 54 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 59 59 62 62 62 59 62 56 54 54 59 62 54 54 62 62 62 62 59 62 62 62 62 62 62 54 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 20 32 38 15 22 32 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 56 62 62 56 56 56 56 62 62 62 52 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 54 38 54 45 38 54 58 54 58 58 58 58 58 54 58 58 54 49 58 58 58 58 54 45 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 54 58 58 58 58 58 58 58 54 58 58 58 54 52 54 54 54 52 49 28 58 58 51 50 58 47 58 58 58 52 58 54 42 58 58 49 50 58 53 58 51 58 51 58 58 51 24 19 9 11 10 18 18 51 44 29 37 58 58 50 46 41 58 58 51 58 58 43 46 37 50 58 49 50 58 49 28 32 47 52 52 51 44 51 53 52 27 37 16 49 44 40 50 50 43 23 44 50 50 39 33 39 49 58 46 51 29 39 54 18 35 38 53 54 54 54 45 51 51 44 54 54 41 41 44 21 15 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_172120958_172122018
seq2: B6Ng01-261K13.b_45_1105

seq1  GAATTCATCCCTACAACTTTACTCCTGGCATTAGACACTCTGAGAAGCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCCCTACAACTTTACTCCTGGCATTAGACACTCTGAGAAGCAA  50

seq1  CTGGCTCGCATAGATCCACACCTACATTAACTGTAAAATATCTTTTTGAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTCGCATAGATCCACACCTACATTAACTGTAAAATATCTTTTTGAA  100

seq1  TTAATGATCACTTACTACCAAGATTTTCATCCAGGTAATGGGTTCTCCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATGATCACTTACTACCAAGATTTTCATCCAGGTAATGGGTTCTCCTT  150

seq1  GGAGTATTTATATAGCTATTAGCTATGCGATATTGCTAAAATCTGAGACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTATTTATATAGCTATTAGCTATGCGATATTGCTAAAATCTGAGACA  200

seq1  AAACTCTTCCCCGAGGTATTTAGACCTGACTTTGAAATTGGATTATCGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCTTCCCCGAGGTATTTAGACCTGACTTTGAAATTGGATTATCGAA  250

seq1  GTTTACAGTGCTACTTTAAATAGGAATGGCCACATATAGACTTATATATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTACAGTGCTACTTTAAATAGGAATGGCCACATATAGACTTATATATC  300

seq1  TGAATACTTAGTCACTAGGGAATGGCGCTACTTGACAGGAATTAGGAGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATACTTAGTCACTAGGGAATGGCGCTACTTGACAGGAATTAGGAGGT  350

seq1  GTGGCCTTGTTGAAAGAGGTGTGTCACTAAGTGTGGGTTTGGGGTTTCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCTTGTTGAAAGAGGTGTGTCACTAAGTGTGGGTTTGGGGTTTCAG  400

seq1  AAGCTCAAGCCAGGCCCAGGGCTCTTTCTCTTCCTGCTGCCAATGAATCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTCAAGCCAGGCCCAGGGCTCTTTCTCTTCCTGCTGCCAATGAATCC  450

seq1  AGATGCAGAGATATCAGTCACTCTCCAGCACCATGTCTGCCTGCAAGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGCAGAGATATCAGTCACTCTCCAGCACCATGTCTGCCTGCAAGCCA  500

seq1  CCATGCTCCCTGCCCTGATGACAACAGAGCCCAAGTCAATGCTTTCCTTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGCTCCCTGCCCTGATGACAACAGAGCCCAAGTCAATGCTTTCCTTG  550

seq1  ATAACCGCTGCCATGGGGGAAGTCTCTGGTTGGCCAGCTGCCGGGGACCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACCGCTGCCATGGGGGAAGTCTCTGGTTGGCCAGCTGCCGGGGACCA  600

seq1  CGTGGCTATCCAGGGGCTGTGCATAACTGGCCCCATTCCCCCCTGGATGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGGCTATCCAGGGGCTGTGCATAACTGGCCCCATTCCCCCCTGGATGC  650

seq1  GGTACTCTGGAGAGCAGTACACAAAGGACACAACATGAAGTCTGGGAAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACTCTGGAGAGCAGTACACAAAGGACACAACATGAAGTCTGGGAAGC  700

seq1  AGTTAAAGCGTTTATGCTGTGGGCAAAATGGGTGGACGTGGAATTCCCAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAAAGCGTTTATGCTGTGGGCAAAATGGGTGGACGTGGAATTCCCAG  750

seq1  AACCCACATCAATGATGGGTGGGTGTGGCAGCTCACCTGTAATTCCAACC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCACATCAATGATGGGTGGGTGTGGCAGCTCACCTGTAATTCCAACC  800

seq1  ATAAAAGGCAGAGACAAGGGGTCCCCAGAGCAAAGCTGGCTAACCAGACT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAGGCAGAGACAAGGGGTCCCCAGAGCAAAGCTGGCTAACCAGACT  850

seq1  AGCTATGCTAGCAAGCTCTGGGACCGATTGGTTGAGAGACCCTTCTCAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTATGCTAGCAAGCTCTGGGACCGATTGGTTGAGAGACCCTTCTCAAA  900

seq1  GATGGAAGAGTGATTGACAAAGTCTTCACATCAGCCTTAGGCCTTGACAC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGAAGAGTGATTGACAAAGTCTTCACATCAGCCTTAGGCCTTGACAC  950

seq1  ATGGATGCACACATGCACACCAGCTCTGTACAATGCCCCCCTATGCCCAC  1000
      ||||||||||||||||||||||||||||||| ||| ||||||||||||||
seq2  ATGGATGCACACATGCACACCAGCTCTGTAC-ATG-CCCCCTATGCCCAC  998

seq1  ACCCACCACACATGTACAAAAGAGGAGTACACGCCTCGAAGGTAAAGTGT  1050
      ||||||||||||||||| |||||||||||||||||||| |||||||||| 
seq2  ACCCACCACACATGTAC-AAAGAGGAGTACACGCCTCGGAGGTAAAGTGG  1047

seq1  GGG---GAGGGGGG  1061
      |||   ||||||||
seq2  GGGGGAGAGGGGGG  1061

seq1: chr1_172256423_172257096
seq2: B6Ng01-261K13.g_66_739 (reverse)

seq1  TTCCCACCCCCACCCCACCTCTGAGGTTCTATCTAGTACCTTGGAGCAGC  50
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCACCCCCACCCCACCTCTGAGGTTCTATCTAGTACCTTGGAGCAGC  50

seq1  ATCCCACTGATTCCAAGTCTCCTGAAATGTGGAACAAAGTGACCCACAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCACTGATTCCAAGTCTCCTGAAATGTGGAACAAAGTGACCCACAAG  100

seq1  GCTGGTGCCTCGGGTACAGTCAGCAAAGGCAAGATGACAAGAGAGCTCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGTGCCTCGGGTACAGTCAGCAAAGGCAAGATGACAAGAGAGCTCTT  150

seq1  TAAAGCCACACCCTTGCTGATTTGATTAAGGATAGGCTGCCGGATGCTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGCCACACCCTTGCTGATTTGATTAAGGATAGGCTGCCGGATGCTTC  200

seq1  CTGAAAGTGTACAGAGGAAAGGAACACTCTGCCATCGGGCTTCGCTTCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAAGTGTACAGAGGAAAGGAACACTCTGCCATCGGGCTTCGCTTCAC  250

seq1  TCCGGAGTCAGGAGAAGAGGAGGCAGAACACACAAGAAGGCTGGTGCATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGGAGTCAGGAGAAGAGGAGGCAGAACACACAAGAAGGCTGGTGCATA  300

seq1  CATTGGCCTTCCCAGATAACTTTCCAACTATCCTCCCTTCCTGACCACCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGGCCTTCCCAGATAACTTTCCAACTATCCTCCCTTCCTGACCACCT  350

seq1  TCAGCTATCCATATAATCCCTGACCCTGCCTGGAACTCAAGCATGTTTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCTATCCATATAATCCCTGACCCTGCCTGGAACTCAAGCATGTTTCT  400

seq1  TCACCATCCCTGACTTGCCCATAATAGAGAGAAGGCTCAGCCTACTGGTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCATCCCTGACTTGCCCATAATAGAGAGAAGGCTCAGCCTACTGGTC  450

seq1  TCCAAGGAAGCATGAATTACCAGTGTCCTCCATAGAAGTCAAACTCAAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAGGAAGCATGAATTACCAGTGTCCTCCATAGAAGTCAAACTCAAGG  500

seq1  ATTCCTCTGAAAACAAGCAAGGGTGATCAGCCCAATCTCCCACAAAGCAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCTCTGAAAACAAGCAAGGGTGATCAGCCCAATCTCCCACAAAGCAG  550

seq1  CTATATTCCAACCCGACTTCAGGGCACAGACTCCATCTGGATGCTAAGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATATTCCAACCCGACTTCAGGGCACAGACTCCATCTGGATGCTAAGAG  600

seq1  GTAGCCAGTTCTTCTCAAATGGCTCGGATCATCTACCTAAATTCCTAAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCCAGTTCTTCTCAAATGGCTCGGATCATCTACCTAAATTCCTAAAA  650

seq1  GTCCATTGCTATTATAATGAATTC  674
      ||||||||||||||||||||||||
seq2  GTCCATTGCTATTATAATGAATTC  674

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information