MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-268O07
Chromosome	1 (Build37)
Map Location	37,112,295 - 37,282,106
singlet/doublet	doublet
Overlap gene	A230074B11Rik, 4921511C04Rik, Cnga3
Upstream gene	Hs6st1, Ugcgl1, LOC100041123, Lincr, Arid5a, 4632411B12Rik, 4930533C12Rik, Lman2l, Cnnm4, Cnnm3, Ankrd23, Ankrd39, Sema4c, 1700024G10Rik, BC050210, EG623414, Cox5b, Actr1b, 4933424G06Rik, Zap70, Tmem131, EG241053
Downstream gene	Inpp4a, 6330578E17Rik, Unc50, Mgat4a, 2010300C02Rik, Tsga10, EG623661, Mitd1, Mrpl30, Gm776, 2300002O18Rik, Txndc9, EG666434, Eif5b, Rev1, EG329123, Aff3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Hs6st1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50785 MGI:1354958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugcgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320011 MGI:2443162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Lincr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214854 MGI:2429944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214855 MGI:2443039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632411B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226976 MGI:1918055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930533C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211430 MGI:3616091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Lman2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214895 MGI:2443010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnnm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94220 MGI:2151060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94218 MGI:2151055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ankrd23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78321 MGI:1925571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109346 MGI:1914816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20353 MGI:109252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 11 Proteins

name	1700024G10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71849 MGI:1919099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins

name	BC050210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381337 MGI:3026913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623414 MGI:3649065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 167 ESTs, 6 Proteins

name	Cox5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12859 MGI:88475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actr1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226977 MGI:1917446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933424G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71166 MGI:1918416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Zap70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22637 MGI:99613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56030 MGI:1927110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG241053 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241053 MGI:3646154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 423 ESTs, 7 Proteins

name	A230074B11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215413 MGI:2443831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921511C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70853 MGI:1918103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12790 MGI:1341818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inpp4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269180 MGI:1931123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	6330578E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76178 MGI:1923428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67387 MGI:1914637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269181 MGI:2662992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010300C02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72097 MGI:1919347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 51 ESTs, 2 Proteins

name	Tsga10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211484 MGI:2685063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623661 MGI:3645211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mitd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69028 MGI:1916278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107734 MGI:1333820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332427 MGI:2685622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2300002O18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69541 MGI:1916791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98258 MGI:2138153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666434 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666434 MGI:3649002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	Eif5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226982 MGI:2441772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rev1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56210 MGI:1929074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG329123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329123 MGI:3644917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Aff3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16764 MGI:106927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 99 ESTs, 2 Proteins

name	Hs6st1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657187 GeneID:50785 MGI:1354958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 1 transcript_id : NM_015818.1

name	Ugcgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45387932 GeneID:320011 MGI:2443162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-glucose ceramide glucosyltransferase-like 1 transcript_id : NM_198899.1

name	Lincr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130116 GeneID:214854 MGI:2429944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lung-inducible neuralized-related C3HC4 RING domain protein transcript_id : NM_153408.2

name	Arid5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803361 GeneID:214855 MGI:2443039
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 5A (Mrf1 like) transcript_id : NM_145996.3

name	4632411B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803445 GeneID:226976 MGI:1918055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632411B12 gene transcript_id : NM_172652.2

name	Lman2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61656185 GeneID:214895 MGI:2443010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, mannose-binding 2-like transcript_id : NM_001013374.1

name	Cnnm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809003 GeneID:94220 MGI:2151060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M4 transcript_id : NM_033570.1

name	Cnnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196783 GeneID:94218 MGI:2151055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M3 transcript_id : NM_001039551.1

name	Cnnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196781 GeneID:94218 MGI:2151055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M3 transcript_id : NM_053186.2

name	Ankrd23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130132 GeneID:78321 MGI:1925571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 23 transcript_id : NM_153502.3

name	Ankrd39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803363 GeneID:109346 MGI:1914816
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 39 transcript_id : NM_026241.2

name	Sema4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363287 GeneID:20353 MGI:109252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 11 Proteins product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C, transcript variant 3 transcript_id : XM_898566.2

name	1700024G10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233811 GeneID:71849 MGI:1919099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : RIKEN cDNA 1700024G10 gene, transcript variant 2 transcript_id : XM_889674.3

name	BC050210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235749 GeneID:381337 MGI:3026913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050210 transcript_id : NM_201365.1

name	EG623414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233812 GeneID:623414 MGI:3649065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 167 ESTs, 6 Proteins product : predicted gene, EG623414 transcript_id : XM_889697.3

name	Cox5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807194 GeneID:12859 MGI:88475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit Vb transcript_id : NM_009942.2

name	Actr1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130225 GeneID:226977 MGI:1917446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ARP1 actin-related protein 1 homolog B (yeast) transcript_id : NM_146107.2

name	4933424G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363298 GeneID:71166 MGI:1918416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 4933424G06 gene transcript_id : XM_129743.5

name	Zap70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981915 GeneID:22637 MGI:99613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zeta-chain (TCR) associated protein kinase transcript_id : NM_009539.2

name	Tmem131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372305 GeneID:56030 MGI:1927110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 131 transcript_id : NM_018872.2

name	EG241053 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233813 GeneID:241053 MGI:3646154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 423 ESTs, 7 Proteins product : predicted gene, EG241053 transcript_id : XM_136732.6

name	A230074B11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373339 GeneID:215413 MGI:2443831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230074B11 gene transcript_id : NM_177334.3

name	4921511C04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803543 GeneID:70853 MGI:1918103
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921511C04 gene transcript_id : NM_027580.2

name	Cnga3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859523 GeneID:12790 MGI:1341818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide gated channel alpha 3 transcript_id : NM_009918.1

name	Inpp4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116586 GeneID:269180 MGI:1931123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-4-phosphatase, type I transcript_id : NM_030266.2

name	Inpp4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090748 GeneID:269180 MGI:1931123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-4-phosphatase, type I transcript_id : NM_172971.2

name	6330578E17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461995 GeneID:76178 MGI:1923428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330578E17 gene transcript_id : NM_198006.3

name	Unc50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921615 GeneID:67387 MGI:1914637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-50 homolog (C. elegans) transcript_id : NM_026123.3

name	Mgat4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239361 GeneID:269181 MGI:2662992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 4, isoenzyme A transcript_id : NM_173870.1

name	2010300C02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233817 GeneID:72097 MGI:1919347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 51 ESTs, 2 Proteins product : RIKEN cDNA 2010300C02 gene transcript_id : XM_129808.8

name	Tsga10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131026 GeneID:211484 MGI:2685063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific 10 transcript_id : NM_207228.2

name	EG623661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802644 GeneID:623661 MGI:3645211
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG623661 transcript_id : NM_001037918.2

name	Mitd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802096 GeneID:69028 MGI:1916278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MIT, microtubule interacting and transport, domain containing 1 transcript_id : NM_026913.2

name	Mrpl30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384716 GeneID:107734 MGI:1333820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L30 transcript_id : NM_027098.2

name	Gm776 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370361 GeneID:332427 MGI:2685622
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 776, (NCBI) transcript_id : NM_001033427.2

name	2300002O18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802162 GeneID:69541 MGI:1916791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2300002O18 gene transcript_id : NM_027111.3

name	Txndc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802781 GeneID:98258 MGI:2138153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 9 transcript_id : NM_172054.4

name	EG666434 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363313 GeneID:666434 MGI:3649002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, EG666434 transcript_id : XM_983830.1

name	Eif5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84043960 GeneID:226982 MGI:2441772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 5B transcript_id : NM_198303.2

name	Rev1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50811869 GeneID:56210 MGI:1929074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REV1 homolog (S. cerevisiae) transcript_id : NM_019570.3

name	EG329123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363315 GeneID:329123 MGI:3644917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG329123 transcript_id : XM_286973.3

name	Aff3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233821 GeneID:16764 MGI:106927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 99 ESTs, 2 Proteins product : AF4/FMR2 family, member 3 transcript_id : XM_001477293.1

name	Hs6st1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657188 GeneID:50785 MGI:1354958
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : heparan sulfate 6-O-sulfotransferase 1 protein_id : NP_056633.1

name	Ugcgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45387933 GeneID:320011 MGI:2443162
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS]; GO:0005793 - ER-Golgi intermediate compartment [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0003980 - UDP-glucose:glycoprotein glucosyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence ISS] GO_process : GO:0051084 - posttranslational protein folding [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP-glucose ceramide glucosyltransferase-like 1 protein_id : NP_942602.1

name	Lincr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510281 CCDS:CCDS14875.1 GeneID:214854 MGI:2429944
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lung inducible neuralized-related C3HC4 RING finger product : lung-inducible neuralized-related C3HC4 RING domain protein protein_id : NP_700457.1

name	Arid5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542476 CCDS:CCDS14876.1 GeneID:214855 MGI:2443039
definition	codon_start : 1 product : modulator recognition factor I protein_id : NP_666108.2

name	4632411B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369930 CCDS:CCDS14877.1 GeneID:226976 MGI:1918055
definition	codon_start : 1 product : hypothetical protein LOC226976 protein_id : NP_766240.1

name	Lman2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656186 CCDS:CCDS14878.1 GeneID:214895 MGI:2443010
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0030134 - ER to Golgi transport vesicle [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005537 - mannose binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS]; GO:0006457 - protein folding [Evidence ISS]; GO:0015031 - protein transport [Evidence ISS] codon_start : 1 product : lectin, mannose-binding 2-like protein_id : NP_001013392.1

name	Cnnm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809004 CCDS:CCDS14879.1 GeneID:94220 MGI:2151060
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ancient conserved domain protein 4 product : cyclin M4 protein_id : NP_291048.1

name	Cnnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196782 CCDS:CCDS14880.1 GeneID:94218 MGI:2151055
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ancient conserved domain protein 3 product : cyclin M3 isoform 1 protein_id : NP_444416.2

name	Cnnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196784 CCDS:CCDS14881.1 GeneID:94218 MGI:2151055
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ancient conserved domain protein 3 product : cyclin M3 isoform 2 protein_id : NP_001034640.1

name	Ankrd23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883850 CCDS:CCDS14882.1 GeneID:78321 MGI:1925571
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006631 - fatty acid metabolism [Evidence IDA] codon_start : 1 note : diabetes-realted ankyrin repeat protein product : diabetes related ankyrin repeat protein protein_id : NP_705722.2

name	Ankrd39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037099 CCDS:CCDS14883.1 GeneID:109346 MGI:1914816
definition	codon_start : 1 product : ankyrin repeat domain 39 protein_id : NP_080517.1

name	Sema4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363288 GeneID:20353 MGI:109252
definition	codon_start : 1 product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C isoform 3 protein_id : XP_903659.2

name	1700024G10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82878827 GeneID:71849 MGI:1919099
definition	codon_start : 1 product : hypothetical protein LOC71849 isoform 2 protein_id : XP_894767.1

name	BC050210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235750 CCDS:CCDS14885.1 GeneID:381337 MGI:3026913
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381337 protein_id : NP_958753.1

name	EG623414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82878832 GeneID:623414 MGI:3649065
definition	codon_start : 1 product : similar to putative translation initiation factor A121/Sui1 protein_id : XP_894790.1

name	Cox5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807195 CCDS:CCDS14886.1 GeneID:12859 MGI:88475
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase, subunit Vb protein_id : NP_034072.2

name	Actr1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122615 CCDS:CCDS14887.1 GeneID:226977 MGI:1917446
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : ARP1 actin-related protein 1 homolog B protein_id : NP_666219.1

name	4933424G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363299 GeneID:71166 MGI:1918416
definition	codon_start : 1 product : hypothetical protein LOC71166 protein_id : XP_129743.5

name	Zap70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981916 CCDS:CCDS14888.1 GeneID:22637 MGI:99613
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004715 - non-membrane spanning protein tyrosine kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IPI]; GO:0005515 - protein binding [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IMP] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IMP] [Evidence IDA]; GO:0046638 - positive regulation of alpha-beta T cell differentiation [Evidence IMP] [Evidence IGI]; GO:0046641 - positive regulation of alpha-beta T cell proliferation [Evidence IGI]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IMP]; GO:0045582 - positive regulation of T cell differentiation [Evidence ISS] [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence ISS] [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0050852 - T cell receptor signaling pathway [Evidence IMP]; GO:0045061 - thymic T cell selection [Evidence IMP] codon_start : 1 note : zeta-chain (TCR) associated protein kinase (70kD) product : zeta-chain (TCR) associated protein kinase protein_id : NP_033565.2

name	Tmem131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372306 GeneID:56030 MGI:1927110
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 131 protein_id : NP_061360.2

name	EG241053 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82878973 GeneID:241053 MGI:3646154
definition	codon_start : 1 product : similar to ribosomal protein L12 protein_id : XP_136732.3

name	A230074B11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893453 CCDS:CCDS14889.1 GeneID:215413 MGI:2443831
definition	codon_start : 1 product : hypothetical protein LOC215413 protein_id : NP_796308.1

name	4921511C04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037221 GeneID:70853 MGI:1918103
definition	codon_start : 1 product : hypothetical protein LOC70853 protein_id : NP_081856.1

name	Cnga3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859524 CCDS:CCDS14890.1 GeneID:12790 MGI:1341818
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0001750 - photoreceptor outer segment [Evidence IDA] GO_function : GO:0030553 - cGMP binding [Evidence IEA]; GO:0005221 - intracellular cyclic nucleotide activated cation channel activity [Evidence IPI]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : cyclic nucleotide gated channel alpha 3 protein_id : NP_034048.1

name	Inpp4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116587 GeneID:269180 MGI:1931123
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016316 - phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity [Evidence TAS] GO_process : GO:0006798 - polyphosphate catabolism [Evidence TAS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; inositol polyphosphate-4-phosphatase, type I, 107kD product : inositol polyphosphate-4-phosphatase, type I isoform 1 protein_id : NP_084542.2

name	Inpp4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090749 GeneID:269180 MGI:1931123
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016316 - phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity [Evidence TAS] GO_process : GO:0006798 - polyphosphate catabolism [Evidence TAS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; inositol polyphosphate-4-phosphatase, type I, 107kD product : inositol polyphosphate-4-phosphatase, type I isoform 2 protein_id : NP_766559.2

name	6330578E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461996 GeneID:76178 MGI:1923428
definition	codon_start : 1 product : hypothetical protein LOC76178 protein_id : NP_932123.3

name	Unc50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385628 CCDS:CCDS14892.1 GeneID:67387 MGI:1914637
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA] codon_start : 1 product : UNC50 protein_id : NP_080399.1

name	Mgat4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239362 CCDS:CCDS14893.1 GeneID:269181 MGI:2662992
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : N-acetylglucosaminyltransferase IVa product : mannoside acetylglucosaminyltransferase 4, isoenzyme A protein_id : NP_776295.1

name	2010300C02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233818 GeneID:72097 MGI:1919347
definition	codon_start : 1 product : hypothetical protein LOC72097 protein_id : XP_129808.7

name	Tsga10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402207 CCDS:CCDS14894.1 GeneID:211484 MGI:2685063
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005198 - structural molecule activity [Evidence ISS] GO_process : GO:0030031 - cell projection biogenesis [Evidence IMP] codon_start : 1 product : testis specific 10 protein_id : NP_997111.1

name	EG623661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702310 CCDS:CCDS14895.1 GeneID:623661 MGI:3645211
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC623661 protein_id : NP_001033007.1

name	Mitd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625710 GeneID:69028 MGI:1916278
definition	codon_start : 1 product : MIT, microtubule interacting and transport, domain containing 1 protein_id : NP_081189.1

name	Mrpl30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312302 CCDS:CCDS14896.1 GeneID:107734 MGI:1333820
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005761 - mitochondrial ribosome [Evidence IEA] [Evidence ISS]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L30 protein_id : NP_081374.1

name	Gm776 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701937 CCDS:CCDS14897.1 GeneID:332427 MGI:2685622
definition	GO_function : GO:0003796 - lysozyme activity [Evidence IEA] GO_process : GO:0016998 - cell wall catabolism [Evidence IEA]; GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC332427 protein_id : NP_001028599.1

name	2300002O18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931148 GeneID:69541 MGI:1916791
definition	GO_function : GO:0003796 - lysozyme activity [Evidence IEA] GO_process : GO:0016998 - cell wall catabolism [Evidence IEA]; GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69541 protein_id : NP_081387.1

name	Txndc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25286717 CCDS:CCDS14898.1 GeneID:98258 MGI:2138153
definition	codon_start : 1 product : ATP binding protein associated with cell differentiation protein_id : NP_742051.1

name	EG666434 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363314 GeneID:666434 MGI:3649002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988924.1

name	Eif5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84043961 GeneID:226982 MGI:2441772
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 5B protein_id : NP_938045.2

name	Rev1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254551 CCDS:CCDS14899.1 GeneID:56210 MGI:1929074
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0017125 - deoxycytidyl transferase activity [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0042276 - error-prone postreplication DNA repair [Evidence ISS] [Evidence IDA]; GO:0006280 - mutagenesis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : REV1-like protein_id : NP_062516.2

name	EG329123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363316 GeneID:329123 MGI:3644917
definition	codon_start : 1 product : hypothetical protein protein_id : XP_286973.2

name	Aff3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233822 GeneID:16764 MGI:106927
definition	codon_start : 1 product : similar to AF4/FMR2 family member 3 (Protein LAF-4) (Lymphoid nuclear protein related to AF4) protein_id : XP_001477343.1

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 1 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 2 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 3 pseudo : _no_value

name	LOC100041123 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041123
definition	number : 4 pseudo : _no_value

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 1

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 2

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 3

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 4

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 5

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 6

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 7

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 8

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 9

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 10

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 11

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 12

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 13

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 14

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 15

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 16

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 17

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 18

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 19

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 20

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 21

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 22

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 23

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 24

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 25

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 26

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 27

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 28

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 29

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 30

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 31

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 32

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 33

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 34

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 35

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 36

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 37

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 38

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 39

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 40

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 41

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 42

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 43

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 44

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 45

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 46

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 47

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 48

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 49

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 50

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 51

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 52

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 53

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 54

name	4930533C12Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211430
definition	number : 55

name	(CDS detail)
type	STS
link
xref	UniSTS:128628
definition	standard_name : D1Mit278

name	(CDS detail)
type	STS
link
xref	UniSTS:234108
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:463453
definition	standard_name : Hs6st1

name	(CDS detail)
type	STS
link
xref	UniSTS:463454
definition	standard_name : Hs6st1

name	(CDS detail)
type	STS
link
xref	UniSTS:234109
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165069
definition	standard_name : AI414429

name	(CDS detail)
type	STS
link
xref	UniSTS:164110
definition	standard_name : AI448372

name	(CDS detail)
type	STS
link
xref	UniSTS:161805
definition	standard_name : RH124983

name	(CDS detail)
type	STS
link
xref	UniSTS:225338
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207145
definition	standard_name : RH127223

name	(CDS detail)
type	STS
link
xref	UniSTS:158785
definition	standard_name : AI431067

name	(CDS detail)
type	STS
link
xref	UniSTS:248487
definition	standard_name : BF413022

name	(CDS detail)
type	STS
link
xref	UniSTS:178376
definition	standard_name : AI647574

name	(CDS detail)
type	STS
link
xref	UniSTS:163045
definition	standard_name : RH126337

name	(CDS detail)
type	STS
link
xref	UniSTS:261569
definition	standard_name : AA859983

name	(CDS detail)
type	STS
link
xref	UniSTS:165070
definition	standard_name : AI853437

name	(CDS detail)
type	STS
link
xref	UniSTS:165071
definition	standard_name : AI851923

name	(CDS detail)
type	STS
link
xref	UniSTS:158784
definition	standard_name : AA960180

name	(CDS detail)
type	STS
link
xref	UniSTS:116249
definition	standard_name : D1Mit171

name	(CDS detail)
type	STS
link
xref	UniSTS:178375
definition	standard_name : AI327364

name	(CDS detail)
type	STS
link
xref	UniSTS:125022
definition	standard_name : MDB0491

name	(CDS detail)
type	STS
link
xref	UniSTS:142229
definition	standard_name : D1Bwg0491e

name	(CDS detail)
type	STS
link
xref	UniSTS:231591
definition	standard_name : RH142344

name	(CDS detail)
type	STS
link
xref	UniSTS:212909
definition	standard_name : RH129611

name	(CDS detail)
type	STS
link
xref	UniSTS:167296
definition	standard_name : D1Ertd799e

name	(CDS detail)
type	STS
link
xref	UniSTS:272099
definition	standard_name : PMC22124P1

name	(CDS detail)
type	STS
link
xref	UniSTS:228365
definition	standard_name : D9Rat188

name	(CDS detail)
type	STS
link
xref	UniSTS:271641
definition	standard_name : PMC17638P1

name	(CDS detail)
type	STS
link
xref	UniSTS:178377
definition	standard_name : R74740

name	(CDS detail)
type	STS
link
xref	UniSTS:125516
definition	standard_name : R74740

name	(CDS detail)
type	STS
link
xref	UniSTS:234110
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128588
definition	standard_name : D1Mit244

name	(CDS detail)
type	STS
link
xref	UniSTS:128589
definition	standard_name : D1Mit245

name	(CDS detail)
type	STS
link
xref	UniSTS:123821
definition	standard_name : 28.MMHAP28FLB4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:165072
definition	standard_name : AI843383

name	(CDS detail)
type	STS
link
xref	UniSTS:122680
definition	standard_name : 01.MMHAP93FRA7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128886
definition	standard_name : D1Mit518

name	(CDS detail)
type	STS
link
xref	UniSTS:207146
definition	standard_name : BB201698

name	(CDS detail)
type	STS
link
xref	UniSTS:165073
definition	standard_name : AI098020

name	(CDS detail)
type	STS
link
xref	UniSTS:161849
definition	standard_name : RH125027

name	(CDS detail)
type	STS
link
xref	UniSTS:234111
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207147
definition	standard_name : AU022044

name	(CDS detail)
type	STS
link
xref	UniSTS:207148
definition	standard_name : RH126814

name	(CDS detail)
type	STS
link
xref	UniSTS:22322
definition	standard_name : STS-D80227

clone name	MSMg01-140B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-462H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427A12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-427I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523P18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-361O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-497P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-268O07.b	B6Ng01-268O07.g
ACC	GA071635	GA071636
length	1,031	1,143
definition	B6Ng01-268O07.b	B6Ng01-268O07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(37,112,295 - 37,113,311)	(37,280,961 - 37,282,106)
sequence	gaattcaggtccttgcttgagttgcaagcaccctatagactgaaccatct ctccagaccttaccattctatttttttaattacttattttatgtatatga gtacactgttgctctcttcagacacaccagaagagggcattggatcccat tacagatggttgtgagccaaatgtggctgctgggaattgaattcaggacc tctggaagaacaatcagtgttcttaaccactgagccatctttccagtccc ttagcattctattttatgtggaataaattgcaagagctttcggctttcgg ctgaacaccccagtacagtaaaggcagttttcagctccatagcatctcca gggaaaagcatctctgcaaaagagtttcagtatcacaaggtaactaacaa atgttaaaccattcccaggaaaacctttgcttttgagtatattgttttct gtatacgatggcctagaaaataaatgtgctagtttttcttttagattttg aggtattacttttctttgaatctctgtttgatttagcatcgcagcactaa attatgaaatgtttccagctcccctgtcccctctacatcatgaaggcagc tctgtccttgtttctgcctttggtaacttatagtatttgcccatttaaca gtgcatgtctactattttcttttttgttgttggctttttttttttttttt tttttgagacagggtttctctgtatagccctggctgtcctggaactcact ttgtagaccaggctggccttgaactcagaaatccacctgcttctgcctcc cgagtgctgggactaaaggcgtgcgccaccattgccctactatttctata tagaaagtttgaggacagtggattttatctctttttataaatgagacgat gggaagaatatacattgtttgcttttcttaaaaaaaataaaaaaagaagt tttagttattctggggcactcacctggccgagccacttacgcacccctgg ttcgagaactttctggtaaccaaccctcccc	gaattcaacttggcctttattgttggcctggctatgtgactgggtcaggc attgacctgactcacatacatgcccataatcttttacttctcttttcttg tactaaaacctgaagccctggagaaatccttcattttatttaaaaactgc ttctctagattccccacgcatacataaagaatggaatgaaaagcacacag ggtcagggaagtggcagagatctgaaggatggccgtcaccataggacacc tcacctgtcccgggcacctgctctctgtatgctctggtctctgttctgat gtcttgaactgtgtactaacttattggatcctcatacagtgccatgagtg attcacactggaaatgtccatctcataaaccaaactccaaacagccaaca attcccacggtgttccatgtctggagccttttcttgagccatttttaatg gccgtaatattcttcctttctacccccaaacttcagggtagaagaaaaat tcacaatactgagacctgtaagccagccataggaacacacatcgccccat acccagttccaagggttagatacacgctagcaattttagggtgacataga gggaaagcccccaaagccttgcacaacaagccgtgtttgagagtttaagt ggctttatgtaagagacaagttaagagatcttgaaggagatatagatcaa tgggaagatgttcactgattgtgtctaaatgtcaactgacaaatggacca acaatatgtggtaaatccacataatagatcactacctgccaaggaaaaag aatgaaatactagtttgtttgttttttaattaaaatccatattacatgct gtaacatggattgacattatgctttgtggaaaaagccagacatggaagac tgtgatttcatgggaaactcgaagaattagataaatccataaagacagaa agtagatttaatttgccaggttagagtaggaaatttagaaagaaggaggg atgttaataggcacaggatgtctttttggggggtgtttacagttctaaaa ttaattgtgatggtccgaactgtggatttattaacaatccaataccttag tgagtgatcttgtagtatgtatgaatttccttaaagaaataat
quality values	Open. Hide. 58 26 25 25 51 34 18 52 49 58 58 58 54 58 58 58 58 58 58 58 62 62 62 47 52 62 47 62 62 56 54 62 62 62 56 62 39 41 43 62 62 62 43 62 62 47 47 62 62 62 62 62 62 47 39 62 54 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 43 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 47 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 62 62 62 62 62 62 62 62 62 62 62 56 62 56 54 54 47 62 62 62 62 62 62 62 62 62 62 62 54 43 62 62 62 47 39 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 54 52 54 52 58 58 54 58 58 58 58 41 58 54 54 54 58 58 58 58 58 54 58 58 52 54 58 54 58 54 58 54 46 47 58 54 58 52 58 58 52 54 52 47 58 54 52 52 54 58 52 47 42 58 58 47 52 58 54 52 58 58 40 46 58 54 39 54 47 58 52 53 53 58 50 58 52 52 53 51 51 39 58 58 50 58 50 58 58 58 58 51 46 32 51 58 26 54 58 30 31 58 58 58 58 58 49 38 58 58 58 58 58 58 58 10 9 7 5 5 9 22 11 16 18 42 13 22 31 39 25 7 21 28 15 29 22 12 15 10 12 9 13 13 32 53 29 34 31 41 32 39 49 18 24 26 13 39 31 30 31 34 39 39 39 17 18 37 15 26 12 22 13 32 6 32 25 23 17 15 17 24 39 12 20 9 28 32 35 22 16 26 37 28 18 40 42 45 39 32 37 20 25 14 10 24 28 23 31 42 28 37 37 22 20 34 26 27 13 53 37 42 40 24 21 14 26 25 25 15 24 23 24 18 13 44 11 16 27 32 24 12 33 54 14 17 52 17 24 12 14 10 45 32 19 9 16 33 24 45 33 36 24 23 16 32 21 26 14 29 40 45 28 31 20 17 21 24 17 9 18 16 29 8 8 4 12 18 31 13 45 31 31 26 14 40 13 31 13 40 46 36 23 25 8 6 5 7 13 28 31 13 36 26 10 40 24 30 23 27 18 11 9 10 20 9 9 8 21 11 23 30 9 32 18 42 15 13 13 8 46 46 9 11 28 35 18 12 6 22 36 37 26 10 7 23 30 28 25 23 30 31 12 21 13 10 21 34 35 31 15 11 12 6 12 13 6 7 30 25 31 29 9 27 6 7 14 21 8 19 15 8 10 10 16 9 31 30 10 7 7 9 9 8 5 4 5 5 7 9 12 33 29 13 15 11 9 5 5 11 6 26 8 21 20 11 16 44 13 8 34 21 37 14 42 13 8 6 26 10 21 41 23 13 14 36 32 11	Open. Hide. 62 49 30 47 62 47 59 59 62 62 62 62 40 50 59 56 46 49 49 46 48 54 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 54 54 59 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 52 58 58 58 58 58 58 54 58 58 58 54 58 54 58 58 54 58 58 58 58 46 42 58 58 52 52 58 58 58 58 58 58 58 58 48 49 58 58 58 58 58 58 58 54 58 58 49 54 58 58 52 58 54 52 58 58 48 58 54 58 52 58 52 58 58 54 58 58 58 58 42 58 58 58 58 53 47 51 58 51 54 42 28 47 49 58 45 49 54 50 51 58 49 50 58 53 58 53 58 58 53 51 54 50 58 49 58 58 39 37 58 58 51 50 58 47 52 50 58 54 51 54 33 58 58 49 58 51 49 47 58 58 58 53 53 58 58 43 54 53 53 58 54 49 50 52 52 51 51 37 43 50 53 58 54 33 58 50 58 58 44 58 35 58 50 49 58 45 53 51 39 47 58 41 41 58 58 40 53 53 53 52 42 52 40 58 29 47 50 41 51 42 54 45 52 54 42 54 37 32 37 53 53 53 49 49 41 15 51 49 30 53 39 41 42 45 39 29 35 42 40 40 50 54 54 49 41 38 35 46 22 36 32 39 45 33 41 47 54 35 37 45 53 40 53 34 53 45 41 54 41 45 53 40 45 31 37 53 45 45 39 42 32 54 42 45 54 32 36 31 42 27 32 33 19 32 36 42 47 47 42 45 53 26 33 49 33 45 32 34 29 53 32 53 33 52 40 40 34 35 33 40 35 45 42 37 53 31 31 42 33 37 22 27 45 46 46 51 51 51 31 25 42 51 31 37 46 51 32 42 39 36 43 42 24 45 46 31 42 32 51 27 41 18 46 46 48 48 33 18 18 41 43 32 48 46 31 31 36 34 31 38 42 37 20 34 34 34 32 41 38 36 46 25 30 23 31 31 33 31 31 22 24 33 31 25 31 29 37 38 32 36 35 33 42 48 31 31 33 38 37 41 48 46 48 37 31 32 26 30 18 32 16 16 32 32 33 20 19 11 31 19 32 37 33 34 34 31 48 34 38 24 21 15 44 13 30 36 32 31 33 32 8 5 11 13 16 44 12 12 8 12 13 16 24 44 28 29 19 38 21 33 23 36 25 13 8 11 21 22 28 37 19 18 14 21 19 28 11 48 17 20 29 11 48 16 22 12 26 13 4 16 11 20 29 12 15 19 21 5 4 11 10 33 9 25 36 25 14 17 18 31 13 9 10 27 8 6 18 15 30 15 11 16 22 11 18 12 6 8 6 15 18 13 11 17 7 22 14 25 6 7 11 28 13 47 34 30 9 28 38 31 47 47 14 8 16 10 33 21 6 9 7 19 9 28 19 14 21 29 34 16 15 6 5 5 6 9 11 5 8 21 16 16 7 3 1 3 1 6 11 8 4 6 5 7 17 3 5 6 4 5 5 3 3 3 3 3 5 2 5 7 13 8 14 8 8 9 25 18 11 4 4 10 16 15 10 23 11 15 12 18 6 12 13 8 5 2 2 7 15 1 5 2 2 6 5 10 8 6 7 1 3 4 3 17 7 9 24 19 4 4 2 3 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_37112295_37113311
seq2: B6Ng01-268O07.b_47_1077

seq1  GAATTCAGGTCCTTGCTTGAGTTGCAAGCACCCTATAGACTGAACCATCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGGTCCTTGCTTGAGTTGCAAGCACCCTATAGACTGAACCATCT  50

seq1  CTCCAGACCTTACCATTCTATTTTTTTAATTACTTATTTTATGTATATGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGACCTTACCATTCTATTTTTTTAATTACTTATTTTATGTATATGA  100

seq1  GTACACTGTTGCTCTCTTCAGACACACCAGAAGAGGGCATTGGATCCCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACACTGTTGCTCTCTTCAGACACACCAGAAGAGGGCATTGGATCCCAT  150

seq1  TACAGATGGTTGTGAGCCAAATGTGGCTGCTGGGAATTGAATTCAGGACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGATGGTTGTGAGCCAAATGTGGCTGCTGGGAATTGAATTCAGGACC  200

seq1  TCTGGAAGAACAATCAGTGTTCTTAACCACTGAGCCATCTTTCCAGTCCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAAGAACAATCAGTGTTCTTAACCACTGAGCCATCTTTCCAGTCCC  250

seq1  TTAGCATTCTATTTTATGTGGAATAAATTGCAAGAGCTTTCGGCTTTCGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCATTCTATTTTATGTGGAATAAATTGCAAGAGCTTTCGGCTTTCGG  300

seq1  CTGAACACCCCAGTACAGTAAAGGCAGTTTTCAGCTCCATAGCATCTCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACACCCCAGTACAGTAAAGGCAGTTTTCAGCTCCATAGCATCTCCA  350

seq1  GGGAAAAGCATCTCTGCAAAAGAGTTTCAGTATCACAAGGTAACTAACAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAAAGCATCTCTGCAAAAGAGTTTCAGTATCACAAGGTAACTAACAA  400

seq1  ATGTTAAACCATTCCCAGGAAAACCTTTGCTTTTGAGTATATTGTTTTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTAAACCATTCCCAGGAAAACCTTTGCTTTTGAGTATATTGTTTTCT  450

seq1  GTATACGATGGCCTAGAAAATAAATGTGCTAGTTTTTCTTTTAGATTTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATACGATGGCCTAGAAAATAAATGTGCTAGTTTTTCTTTTAGATTTTG  500

seq1  AGGTATTACTTTTCTTTGAATCTCTGTTTGATTTAGCATCGCAGCACTAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTATTACTTTTCTTTGAATCTCTGTTTGATTTAGCATCGCAGCACTAA  550

seq1  ATTATGAAATGTTTCCAGCTCCCCTGTCCCCTCTACATCATGAAGGCAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATGAAATGTTTCCAGCTCCCCTGTCCCCTCTACATCATGAAGGCAGC  600

seq1  TCTGTCCTTGTTTCTGCCTTTGGTAACTTATAGTATTTGCCCATTTAACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCCTTGTTTCTGCCTTTGGTAACTTATAGTATTTGCCCATTTAACA  650

seq1  GTGCATGTCTACTATTTTCTTTTTTGTTGTTGGCTTTTTTTTTTTTTTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCATGTCTACTATTTTCTTTTTTGTTGTTGGCTTTTTTTTTTTTTTTT  700

seq1  TTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACT  750

seq1  TTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCACCTGCTTCTGCCTCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCACCTGCTTCTGCCTCC  800

seq1  CGAGTGCTGGGACTAAAGGCGTGCGCCACCA-TGCCCTACTATTTTCTAT  849
      ||||||||||||||||||||||||||||||| |||||||||| |||||||
seq2  CGAGTGCTGGGACTAAAGGCGTGCGCCACCATTGCCCTACTA-TTTCTAT  849

seq1  ATAGAAAGTTTGAGGACAGTGGATTTAATCTCTTTTATTAGATGAGACGA  899
      |||||||||||||||||||||||||| |||||||||  || |||||||||
seq2  ATAGAAAGTTTGAGGACAGTGGATTTTATCTCTTTTTATAAATGAGACGA  899

seq1  TGGGATGAATAAACAT--GTTGC-TTTCTTAAAAAAAA-AAAAAAAG-AG  944
      ||||| ||||| ||||   |||| |||||||||||||| |||||||| ||
seq2  TGGGAAGAATATACATTGTTTGCTTTTCTTAAAAAAAATAAAAAAAGAAG  949

seq1  TTTTAG-TATCTTGGGCCACTCA-CTGCCGGAG-CACTGACGCACCC--T  989
      |||||| |||  |||| |||||| ||| | ||| |||| ||||||||   
seq2  TTTTAGTTATTCTGGGGCACTCACCTGGCCGAGCCACTTACGCACCCCTG  999

seq1  GTCAGAGA--CTTCTGG--AACAACCCTCCCC  1017
      ||  ||||   ||||||  | |||||||||||
seq2  GTTCGAGAACTTTCTGGTAACCAACCCTCCCC  1031

seq1: chr1_37280961_37282106
seq2: B6Ng01-268O07.g_67_1209 (reverse)

seq1  ATTATTTCTTTTAGAGAAATCATTTACATACTACAAAGATCACTCACTTA  50
      ||||||||||| ||  || |||  |||||||||| |||||||||||| ||
seq2  ATTATTTCTTTAAGGAAATTCA--TACATACTAC-AAGATCACTCAC-TA  46

seq1  AAGTATTGATTTTGTTTTATTATATCCACAGTTTGGAACCATCACAATAT  100
      | ||||||  |   | ||| || |||||||||| || ||||||||||| |
seq2  AGGTATTGGAT---TGTTAATAAATCCACAGTTCGG-ACCATCACAAT-T  91

seq1  AATTTTAGAACTGTAAACACCCCC--AAAAGACATCCTGTGCCTATTAAC  148
      ||||||||||||||||||||||||  ||||||||||||||||||||||||
seq2  AATTTTAGAACTGTAAACACCCCCCAAAAAGACATCCTGTGCCTATTAAC  141

seq1  ATCCCT-CTTCTTTCTAAATTCCCTACTCTAACCTTGGCAATT-AATCTA  196
      |||||| |||||||||||||| ||||||||||||| |  |||| ||||||
seq2  ATCCCTCCTTCTTTCTAAATTTCCTACTCTAACCTGGCAAATTAAATCTA  191

seq1  CTTTCTGTCTTTATGGATTTATCT-ATTCTTCGAGTTT-CCATGAAATCA  244
      |||||||||||||||||||||||| ||||||||||||| |||||||||||
seq2  CTTTCTGTCTTTATGGATTTATCTAATTCTTCGAGTTTCCCATGAAATCA  241

seq1  CAGTCTTCCATGTCTGGCTTTTTCCACAAAGCATAATGTCAATCCATGTT  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTTCCATGTCTGGCTTTTTCCACAAAGCATAATGTCAATCCATGTT  291

seq1  ACAGCATGTAATATGGATTTTAATTAAAAAACAAACAAACTAGTATTTCA  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCATGTAATATGGATTTTAATTAAAAAACAAACAAACTAGTATTTCA  341

seq1  TTCTTTTTCCTTGGCAGGTAGTGATCTATTATGTGGATTTACCACATATT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTTTCCTTGGCAGGTAGTGATCTATTATGTGGATTTACCACATATT  391

seq1  GTTGGTCCATTTGTCAGTTGACATTTAGACACAATCAGTGAACATCTTCC  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGTCCATTTGTCAGTTGACATTTAGACACAATCAGTGAACATCTTCC  441

seq1  CATTGATCTATATCTCCTTCAAGATCTCTTAACTTGTCTCTTACATAAAG  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGATCTATATCTCCTTCAAGATCTCTTAACTTGTCTCTTACATAAAG  491

seq1  CCACTTAAACTCTCAAACACGGCTTGTTGTGCAAGGCTTTGGGGGCTTTC  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTTAAACTCTCAAACACGGCTTGTTGTGCAAGGCTTTGGGGGCTTTC  541

seq1  CCTCTATGTCACCCTAAAATTGCTAGCGTGTATCTAACCCTTGGAACTGG  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTATGTCACCCTAAAATTGCTAGCGTGTATCTAACCCTTGGAACTGG  591

seq1  GTATGGGGCGATGTGTGTTCCTATGGCTGGCTTACAGGTCTCAGTATTGT  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGGGGCGATGTGTGTTCCTATGGCTGGCTTACAGGTCTCAGTATTGT  641

seq1  GAATTTTTCTTCTACCCTGAAGTTTGGGGGTAGAAAGGAAGAATATTACG  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTTTTCTTCTACCCTGAAGTTTGGGGGTAGAAAGGAAGAATATTACG  691

seq1  GCCATTAAAAATGGCTCAAGAAAAGGCTCCAGACATGGAACACCGTGGGA  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTAAAAATGGCTCAAGAAAAGGCTCCAGACATGGAACACCGTGGGA  741

seq1  ATTGTTGGCTGTTTGGAGTTTGGTTTATGAGATGGACATTTCCAGTGTGA  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTGGCTGTTTGGAGTTTGGTTTATGAGATGGACATTTCCAGTGTGA  791

seq1  ATCACTCATGGCACTGTATGAGGATCCAATAAGTTAGTACACAGTTCAAG  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACTCATGGCACTGTATGAGGATCCAATAAGTTAGTACACAGTTCAAG  841

seq1  ACATCAGAACAGAGACCAGAGCATACAGAGAGCAGGTGCCCGGGACAGGT  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCAGAACAGAGACCAGAGCATACAGAGAGCAGGTGCCCGGGACAGGT  891

seq1  GAGGTGTCCTATGGTGACGGCCATCCTTCAGATCTCTGCCACTTCCCTGA  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTGTCCTATGGTGACGGCCATCCTTCAGATCTCTGCCACTTCCCTGA  941

seq1  CCCTGTGTGCTTTTCATTCCATTCTTTATGTATGCGTGGGGAATCTAGAG  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGTGTGCTTTTCATTCCATTCTTTATGTATGCGTGGGGAATCTAGAG  991

seq1  AAGCAGTTTTTAAATAAAATGAAGGATTTCTCCAGGGCTTCAGGTTTTAG  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGTTTTTAAATAAAATGAAGGATTTCTCCAGGGCTTCAGGTTTTAG  1041

seq1  TACAAGAAAAGAGAAGTAAAAGATTATGGGCATGTATGTGAGTCAGGTCA  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAGAAAAGAGAAGTAAAAGATTATGGGCATGTATGTGAGTCAGGTCA  1091

seq1  ATGCCTGACCCAGTCACATAGCCAGGCCAACAATAAAGGCCAAGTTGAAT  1144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCTGACCCAGTCACATAGCCAGGCCAACAATAAAGGCCAAGTTGAAT  1141

seq1  TC  1146
      ||
seq2  TC  1143

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information