MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-271J17
Chromosome	1 (Build37)
Map Location	180,740,021 - 180,897,637
singlet/doublet	doublet
Overlap gene	Kif26b, Smyd3
Upstream gene	EG631584, EG545391, LOC666262, 5830417C01Rik, LOC666284, 4930527J03Rik, LOC666295, B230369F24Rik, LOC669454, 2310005N03Rik, Hnrpu, Efcab2, D230039L06Rik
Downstream gene	LOC666354, LOC433941, Tfb2m, LOC100040874, 9630058J23Rik, Sccpdh, Gm1305, Ahctf1, LOC100040914, LOC100042190, Cdc42bpa
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG631584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631584 MGI:3647531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	EG545391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545391 MGI:3648036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666262 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 4 Proteins pseudo : _no_value

name	5830417C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78825 MGI:1926075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins pseudo : _no_value

name	4930527J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75164 MGI:1922414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC666295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 581 ESTs, 3 Proteins pseudo : _no_value

name	B230369F24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320110 MGI:2443392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC669454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	2310005N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66359 MGI:1913609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51810 MGI:1858195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcab2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68226 MGI:1915476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230039L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240945 MGI:3045335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif26b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269152 MGI:2447076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69726 MGI:1916976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC433941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 540 ESTs, 4 Proteins

name	Tfb2m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15278 MGI:107937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	9630058J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226744 MGI:2445141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sccpdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109232 MGI:1924486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383592 MGI:2686151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Ahctf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226747 MGI:1915033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100042190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 10 Proteins pseudo : _no_value

name	Cdc42bpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 122 ESTs, 12 Proteins

name	EG631584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245378 GeneID:631584 MGI:3647531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG631584 transcript_id : XM_982472.2

name	EG545391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350437 GeneID:545391 MGI:3648036
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545391 transcript_id : NM_001034899.2

name	5830417C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637811 GeneID:78825 MGI:1926075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830417C01 gene transcript_id : NM_024282.3

name	4930527J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364560 GeneID:75164 MGI:1922414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930527J03 gene transcript_id : XM_982795.1

name	LOC669454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245441 GeneID:669454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical LOC669454 transcript_id : XM_001478186.1

name	2310005N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887807 GeneID:66359 MGI:1913609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310005N03 gene transcript_id : NM_025511.2

name	Hnrpu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949050 GeneID:51810 MGI:1858195
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U transcript_id : NM_016805.1

name	Efcab2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541840 GeneID:68226 MGI:1915476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand calcium binding domain 2 transcript_id : NM_026626.2

name	D230039L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803292 GeneID:240945 MGI:3045335
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230039L06 gene transcript_id : NM_177724.3

name	Kif26b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328422 GeneID:269152 MGI:2447076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 26B transcript_id : NM_177757.3

name	Smyd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130353 GeneID:69726 MGI:1916976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 3 transcript_id : NM_027188.3

name	LOC433941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245445 GeneID:433941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 540 ESTs, 4 Proteins product : similar to ribosomal protein transcript_id : XM_001478364.1

name	Tfb2m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378778 GeneID:15278 MGI:107937
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor B2, mitochondrial transcript_id : NM_008249.3

name	LOC100040874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245384 GeneID:100040874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040874 transcript_id : XM_001475424.1

name	9630058J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328475 GeneID:226744 MGI:2445141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630058J23 gene transcript_id : NM_146105.3

name	Sccpdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382199 GeneID:109232 MGI:1924486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : saccharopine dehydrogenase (putative) transcript_id : NM_178653.3

name	Gm1305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245388 GeneID:383592 MGI:2686151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : gene model 1305, (NCBI) transcript_id : XM_357140.6

name	Ahctf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006852 GeneID:226747 MGI:1915033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT hook containing transcription factor 1 transcript_id : NM_026375.1

name	LOC100040914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245392 GeneID:100040914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040914 transcript_id : XM_001475479.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364568 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 116 ESTs, 8 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 16 transcript_id : XM_991276.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364570 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 108 ESTs, 8 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 14 transcript_id : XM_991198.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364572 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 110 ESTs, 10 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 15 transcript_id : XM_991226.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364574 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 105 ESTs, 10 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 13 transcript_id : XM_991179.1

name	EG631584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245379 GeneID:631584 MGI:3647531
definition	codon_start : 1 product : similar to chromosome 1 open reading frame 101 protein_id : XP_987566.2

name	EG545391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064861 GeneID:545391 MGI:3648036
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC545391 protein_id : NP_001030071.1

name	5830417C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313498 GeneID:78825 MGI:1926075
definition	codon_start : 1 product : hypothetical protein LOC78825 protein_id : NP_077244.1

name	4930527J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364561 GeneID:75164 MGI:1922414
definition	codon_start : 1 product : hypothetical protein LOC75164 protein_id : XP_987889.1

name	LOC669454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245442 GeneID:669454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478236.1

name	2310005N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313516 CCDS:CCDS15556.1 GeneID:66359 MGI:1913609
definition	codon_start : 1 product : RIKEN cDNA 2310005N03 protein_id : NP_079787.1

name	Hnrpu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949051 GeneID:51810 MGI:1858195
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : nuclear matrix protein sp120; scaffold attachment factor A product : heterogenous nuclear ribonucleoprotein U protein_id : NP_058085.1

name	Efcab2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386110 CCDS:CCDS15557.1 GeneID:68226 MGI:1915476
definition	codon_start : 1 product : EF-hand calcium binding domain 2 protein_id : NP_080902.1

name	D230039L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244198 CCDS:CCDS15558.1 GeneID:240945 MGI:3045335
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC240945 protein_id : NP_808392.1

name	Kif26b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328423 CCDS:CCDS15559.1 GeneID:269152 MGI:2447076
definition	codon_start : 1 exception : mismatches in translation note : N-11 kinesin product : kinesin family member 26B protein_id : NP_808425.2

name	Smyd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312378 CCDS:CCDS15560.1 GeneID:69726 MGI:1916976
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 note : zinc finger, MYND domain containing 1 product : SET and MYND domain containing 3 protein_id : NP_081464.1

name	LOC433941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245446 GeneID:433941
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_001478414.1

name	Tfb2m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490373 CCDS:CCDS15561.1 GeneID:15278 MGI:107937
definition	codon_start : 1 note : house-keeping protein 1 product : transcription factor B2, mitochondrial protein_id : NP_032275.2

name	LOC100040874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245385 GeneID:100040874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475474.1

name	9630058J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559922 CCDS:CCDS15562.1 GeneID:226744 MGI:2445141
definition	codon_start : 1 product : hypothetical protein LOC226744 protein_id : NP_666217.2

name	Sccpdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520019 CCDS:CCDS15563.1 GeneID:109232 MGI:1924486
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0047131 - saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity [Evidence IEA] codon_start : 1 product : saccharopine dehydrogenase (putative) protein_id : NP_848768.1

name	Gm1305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245389 GeneID:383592 MGI:2686151
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357140.6

name	Ahctf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006853 CCDS:CCDS15564.1 GeneID:226747 MGI:1915033
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : embryonic large molecule derived from yolk sac; putative transcription factor; AT hook containing transciption factor 1 product : transcription factor ELYS protein_id : NP_080651.1

name	LOC100040914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245393 GeneID:100040914
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475529.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364569 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 16 protein_id : XP_996370.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364571 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 14 protein_id : XP_996292.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364573 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 15 protein_id : XP_996320.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364575 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 13 protein_id : XP_996273.1

name	B230369F24Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:320110
definition	number : 1

name	LOC666354 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666354
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:185459
definition	standard_name : BB116930

name	(CDS detail)
type	STS
link
xref	UniSTS:125222
definition	standard_name : MHAa54g11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178528
definition	standard_name : AU023525

name	(CDS detail)
type	STS
link
xref	UniSTS:128731
definition	standard_name : D1Mit371.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128730
definition	standard_name : MT3631

name	(CDS detail)
type	STS
link
xref	UniSTS:180818
definition	standard_name : AI503316

name	(CDS detail)
type	STS
link
xref	UniSTS:210048
definition	standard_name : RH136053

name	(CDS detail)
type	STS
link
xref	UniSTS:277316
definition	standard_name : HNRPU_1518

name	(CDS detail)
type	STS
link
xref	UniSTS:162544
definition	standard_name : RH125798

name	(CDS detail)
type	STS
link
xref	UniSTS:268990
definition	standard_name : MARC_26419-26420:1036768776:5

name	(CDS detail)
type	STS
link
xref	UniSTS:162314
definition	standard_name : RH125496

name	(CDS detail)
type	STS
link
xref	UniSTS:31692
definition	standard_name : WI-7584

name	(CDS detail)
type	STS
link
xref	UniSTS:79572
definition	standard_name : WI-8450

name	(CDS detail)
type	STS
link
xref	UniSTS:178527
definition	standard_name : AW557595

name	(CDS detail)
type	STS
link
xref	UniSTS:162363
definition	standard_name : RH125549

name	(CDS detail)
type	STS
link
xref	UniSTS:268469
definition	standard_name : MARC_20677-20678:1024509130:1

name	(CDS detail)
type	STS
link
xref	UniSTS:49593
definition	standard_name : A007A33

name	(CDS detail)
type	STS
link
xref	UniSTS:10169
definition	standard_name : D14S1285

name	(CDS detail)
type	STS
link
xref	UniSTS:207257
definition	standard_name : C86794

name	(CDS detail)
type	STS
link
xref	UniSTS:128922
definition	standard_name : D1Mit62

name	(CDS detail)
type	STS
link
xref	UniSTS:128449
definition	standard_name : D1Mit116

name	(CDS detail)
type	STS
link
xref	UniSTS:128767
definition	standard_name : D1Mit405

name	(CDS detail)
type	STS
link
xref	UniSTS:128674
definition	standard_name : D1Mit315

name	(CDS detail)
type	STS
link
xref	UniSTS:110016
definition	standard_name : AU047954

name	(CDS detail)
type	STS
link
xref	UniSTS:234276
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234157
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167290
definition	standard_name : D1Ertd704e

name	(CDS detail)
type	STS
link
xref	UniSTS:124622
definition	standard_name : 46.MMHAP31FLH4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:143348
definition	standard_name : Hkp1

name	(CDS detail)
type	STS
link
xref	UniSTS:178529
definition	standard_name : AW214504

name	(CDS detail)
type	STS
link
xref	UniSTS:165125
definition	standard_name : AV011447

name	(CDS detail)
type	STS
link
xref	UniSTS:234277
definition

name	LOC666262 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245436 GeneID:666262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 4 Proteins product : similar to translin associated protein X pseudo : _no_value transcript_id : XR_033555.1

name	LOC666284 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245437 GeneID:666284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : similar to developmental pluripotency-associated 2 pseudo : _no_value transcript_id : XR_033578.1

name	LOC666295 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245440 GeneID:666295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 581 ESTs, 3 Proteins product : similar to histone pseudo : _no_value transcript_id : XR_033583.1

name	LOC100042190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245447 GeneID:100042190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033682.1

clone name	MSMg01-437L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189G13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502C14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-158G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-487A15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-347L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540F03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-540M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-292C06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485J22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301I16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426H18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-331B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485N24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-448D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427A20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-111I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-129F04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-234J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492E19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-327D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-271J17.b	B6Ng01-271J17.g
ACC	GA073642	GA073643
length	1,140	1,108
definition	B6Ng01-271J17.b	B6Ng01-271J17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(180,896,503 - 180,897,637)	(180,740,021 - 180,741,051)
sequence	gaattccagtaggaaatagtagcatcaggtgtgcgtttttaaacaagaaa gagaggagatagggctagagagatggctcagcgtttgaaagtgcccgctg ttcttctagaggacctaagttcagttcctaacaccccctttaggaggcat ccaacctcttgtaacttcgcttcagagaatctaaacaccctcttctgact tccgtgggtatcagcacatatgtgcatggagtgcacgtgtgcatgaattt acacacacacacacaccactttttaaatatcaaatatttaaaaagaggaa gtaaagaaaaaatgatgcatagtgactaaactgtcttaaagaaaacaagc acaaatgtccctatcaaagagtctaatcccagtagtagccagaagctgag tgggaaacctggacttgtgcctctggctgtcaccagcaaggtgtcatcct tactcccttttagagtgatgtcagggtcagcctgcttgaacaaggtttgc ataaaatccagattcccaaaatgtctatattttagttgaaaaccattcac catacaaagaaccagccttaatctttataatcgatcaacagataccagct ttgagagagtagatacattagactcgtttgacagtgatgtcacaacagcc tttgtaaagatgctgcttcagtgagtaattataaacacttttgcaacaaa caagaatcgtagtaagtctcgtgaagagagaaaggtgtgacggaacacac agaaaccagagagccaataaattcaggaagcaagcgaggagagagaaact cagcgccaattgcacagggagaaaaccataataaaagtcaaattgaacat ggccttggggacttggggactgatgactagtaatgctagctttctcacat tcgactcccagagagagaagagaaatggtaagtaaaaaaaaaatactttg aaacaatattagaggcatcgaagctgggaaaagaaaaaactaagcagatg acaaaaattttatgtgtaaaatgcatacacaggaacatattaacatataa tagagtttatattattataatttatatataaagtattataactaattaaa tcagtagccaattagtaccatctagatcaacatcataagt	gaattcacaggcatgtgcatgcacacctgcacacacaaacatatgcacac ctgaatacacaaacatatgcacagctgcacacagagacatatgcacacct gcatacacagacttatgcacacctgcacacacagacttatgcacacctgc acacacaaacatatgcacacctgcacacacagacttatgcacacccgaat acacaaacatatgcacagctgcacacagagacatatgcacacctgcatac acagctatatgcacacctgcacacacaaacatatgtacacctgaatacac aaacatatgcacagctgcacacacagacttatgcacacctgcacacacaa acatatgcacacctgcacacacaaacatatgcacacctgaatacacaaac atatgcacagctgcacacacaaacatatgcacacctgcacacacaaacat atgcacacctgaatacacaaacatatgcacagctgcacacagagacatat gcacacctgcatacacagctatatgcacacctgcacacacaaacatatgc acaccatgcacacacaaataaaaacaaaatagcatcgttatgctccagat tctgcagaatacaagggaactacttacattaggagtctaataactaacta atatctatttaacttaggagtctccatagaaaaatcattattctgaattt tgtactttgcacctatgtctactaagatttaaaactagttcagtgtgcaa tttattgtgttctgggtccatttatagaattcactatgtaattttaaata aatcttccttttgttttgatcgatttctctctttctcactatttgttttc cagatggttttctttccgtacagcttcagttaatcgtttgataatccctt tccaaaaatgcttactaagttaactatttttatatgacaaagaagtaatt aagaaataacatgaaagttagttgagaccaatgaaataaacaagaggact ctactgtttttgccttatttttaaatttcttccttctgccccggccctcg tcatcatgtctatccccatgcacatgcacagcttgtactgagccacgggg ggtggggg
quality values	Open. Hide. 46 31 23 31 62 62 17 15 62 49 62 62 62 47 62 56 33 54 62 62 62 62 62 62 54 54 59 59 62 59 62 62 49 49 49 62 62 62 62 59 62 62 62 59 62 59 49 42 54 62 62 62 62 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 56 42 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 58 49 49 58 58 58 58 58 58 58 52 54 44 46 52 54 58 58 54 58 58 54 58 54 58 39 54 58 58 58 58 54 58 54 54 58 39 58 58 58 58 58 58 58 58 58 52 54 47 58 58 58 58 58 58 58 58 54 58 54 54 58 54 46 58 54 52 58 58 58 58 58 58 46 41 58 53 58 50 58 58 51 58 52 51 58 50 58 58 58 54 51 54 58 53 54 54 58 58 58 54 50 49 52 49 58 46 51 58 54 51 34 58 50 51 58 53 52 49 58 49 53 51 58 53 51 58 51 51 38 31 49 49 58 58 50 58 51 49 40 51 58 58 58 36 41 52 49 32 44 49 51 58 54 58 52 42 51 44 58 58 54 58 49 27 51 46 25 58 58 40 50 58 53 58 41 50 53 49 32 54 31 49 40 51 53 53 52 53 52 51 42 54 54 54 38 54 34 51 40 50 54 30 21 39 21 54 52 54 49 37 49 54 54 31 51 39 49 37 42 40 40 49 49 36 47 49 32 49 47 31 31 35 21 35 22 33 53 40 54 27 33 35 32 32 52 51 35 32 37 45 37 39 44 51 44 37 32 36 26 26 52 42 52 37 51 54 30 29 52 40 40 31 42 52 52 31 17 45 53 45 40 37 28 33 31 42 49 49 22 27 47 47 47 41 15 40 31 41 32 40 32 38 49 52 43 32 31 32 35 51 36 31 51 33 27 40 30 20 37 39 46 19 27 23 23 26 51 51 33 29 23 31 33 30 46 46 30 31 21 30 41 37 32 43 43 31 33 33 31 26 33 33 31 42 32 36 38 29 37 31 48 31 31 28 32 31 31 28 41 31 42 28 38 29 31 26 47 31 17 13 30 23 41 34 31 17 29 44 16 20 7 27 46 28 23 32 46 31 39 29 32 19 12 6 5 9 16 48 48 46 47 25 21 20 26 10 31 9 30 31 44 22 24 21 26 26 22 26 31 31 33 42 33 32 20 21 34 32 24 30 30 24 25 30 19 48 9 22 43 48 33 20 32 47 43 44 48 33 23 31 19 38 22 14 21 15 29 19 32 13 7 6 39 43 31 14 32 48 43 17 17 13 20 11 15 9 6 43 34 31 14 21 27 14 37 15 13 7 22 11 24 9 38 13 13 7 29 10 9 17 14 13 28 7 12 9 16 21 8 9 6 6 12 14 18 32 11 15 16 10 9 18 8 24 27 28 25 9 16 18 34 6 21 6 6 4 9 16 12 40 20 27 5 5 20 27 13 19 8 15 9 13 23 26 6 6 16 24 8 7 16 20 4 3 2 6 9 6 12 9 14 12 21 21 18 16 12 16 10 14 15 15 18 12 15 18 15 11 12 17 4 5 4 9 9 5 19 11 6	Open. Hide. 46 35 56 39 62 41 42 62 47 62 49 44 56 62 62 62 62 59 56 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 59 62 62 62 49 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 54 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 54 54 58 58 58 54 54 52 58 58 54 58 58 58 58 54 51 30 58 58 58 54 58 52 47 54 58 58 58 58 46 51 54 58 54 58 54 44 41 52 58 46 58 49 58 58 52 51 42 58 38 39 53 53 41 48 49 49 38 58 48 47 51 51 58 51 50 42 48 37 51 47 50 19 58 46 46 52 58 53 50 58 50 51 50 52 53 58 58 58 58 39 58 46 53 51 58 48 50 51 58 50 49 58 49 58 51 46 23 58 58 39 54 50 53 50 50 50 52 50 32 54 58 58 58 33 33 52 50 44 44 50 50 51 52 41 40 51 58 52 58 58 41 54 37 41 50 53 54 41 50 42 37 49 54 49 52 39 51 47 49 40 35 52 45 40 54 37 35 17 54 37 31 54 54 51 35 52 49 49 54 44 28 30 11 7 36 23 38 39 33 31 33 54 38 52 47 39 54 31 54 47 37 52 34 53 54 54 27 25 46 25 26 54 52 33 32 37 42 34 33 27 28 32 33 31 34 53 35 53 34 32 45 19 49 49 32 36 52 47 32 39 53 49 33 46 41 40 37 52 39 52 52 24 31 32 47 47 32 27 31 29 30 29 37 16 47 40 30 21 27 42 38 38 51 45 31 30 31 35 39 31 31 21 51 30 45 16 51 51 8 14 33 31 22 34 13 22 29 16 46 46 31 31 31 47 12 9 37 30 23 32 31 32 32 36 32 12 31 17 28 24 22 31 8 9 31 31 32 48 30 31 28 10 17 39 29 20 41 17 39 46 31 22 22 26 46 48 48 31 25 31 27 37 23 31 31 35 27 28 18 18 9 32 26 23 30 31 23 46 46 48 11 24 25 24 28 30 32 26 21 44 25 5 23 25 16 31 16 44 9 20 31 21 11 29 47 20 15 26 21 15 11 24 6 9 37 31 13 14 23 26 29 31 23 11 13 7 23 13 25 14 20 16 21 32 48 29 22 31 48 32 23 24 21 21 25 7 9 15 10 27 32 31 23 29 13 19 21 48 48 43 19 22 17 8 20 18 32 20 34 29 28 28 21 47 28 15 29 9 17 13 21 6 10 7 17 10 14 5 3 28 30 15 6 3 3 26 16 17 19 5 3 10 17 9 16 10 6 5 3 8 15 26 13 15 15 34 20 6 4 11 8 6 6 11 12 10 7 6 5 5 13 5 4 4 7 11 20 18 8 6 2 4 14 7 6 10 13 26 26 27 26 14 3 7 20 29 30 28

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_180896503_180897637
seq2: B6Ng01-271J17.b_45_1184 (reverse)

seq1  ACTTATGAATGTTGATCTTAGATGGTACTAATTTGCTAACTGATTT-ATT  49
      ||||||| ||||||||| ||||||||||||||| ||| |||||||| |||
seq2  ACTTATG-ATGTTGATC-TAGATGGTACTAATTGGCT-ACTGATTTAATT  47

seq1  AGTTATAATACTTTATATTATTAATTATAAT-ATAT-AACTCTATTATAT  97
      ||||||||||||||||| ||| ||||||||| |||| |||||||||||||
seq2  AGTTATAATACTTTATA-TATAAATTATAATAATATAAACTCTATTATAT  96

seq1  GTT-ATATGTT-CTGTGTATGCATTTTACACATAAAA-TTTTGTCATCTG  144
      ||| ||||||| ||||||||||||||||||||||||| ||||||||||||
seq2  GTTAATATGTTCCTGTGTATGCATTTTACACATAAAATTTTTGTCATCTG  146

seq1  CTTAGTTTTTTCTTTT-CCAGCTTCGATGCCTCTAATATTGTTTC-AAGT  192
      |||||||||||||||| |||||||||||||||||||||||||||| ||||
seq2  CTTAGTTTTTTCTTTTCCCAGCTTCGATGCCTCTAATATTGTTTCAAAGT  196

seq1  A-TTTTTTTATACTTACCATTTCTCTTCTCTCTCTGGGAGTCGAATGTGA  241
      | ||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTTTTTTACTTACCATTTCTCTTCTCTCTCTGGGAGTCGAATGTGA  246

seq1  GAAAGCTAGCATTACTAGTCATCAGTCCCCAAGTCCCCAAGGCCATGTTC  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGCTAGCATTACTAGTCATCAGTCCCCAAGTCCCCAAGGCCATGTTC  296

seq1  AATTTGACTTTTATTATGGTTTTCTCCCTGTGCAATTGGCGCTGAGTTTC  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTGACTTTTATTATGGTTTTCTCCCTGTGCAATTGGCGCTGAGTTTC  346

seq1  TCTCTCCTCGCTTGCTTCCTGAATTTATTGGCTCTCTGGTTTCTGTGTGT  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCCTCGCTTGCTTCCTGAATTTATTGGCTCTCTGGTTTCTGTGTGT  396

seq1  TCCGTCACACCTTTCTCTCTTCACGAGACTTACTACGATTCTTGTTTGTT  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTCACACCTTTCTCTCTTCACGAGACTTACTACGATTCTTGTTTGTT  446

seq1  GCAAAAGTGTTTATAATTACTCACTGAAGCAGCATCTTTACAAAGGCTGT  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAAGTGTTTATAATTACTCACTGAAGCAGCATCTTTACAAAGGCTGT  496

seq1  TGTGACATCACTGTCAAACGAGTCTAATGTATCTACTCTCTCAAAGCTGG  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACATCACTGTCAAACGAGTCTAATGTATCTACTCTCTCAAAGCTGG  546

seq1  TATCTGTTGATCGATTATAAAGATTAAGGCTGGTTCTTTGTATGGTGAAT  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTGTTGATCGATTATAAAGATTAAGGCTGGTTCTTTGTATGGTGAAT  596

seq1  GGTTTTCAACTAAAATATAGACATTTTGGGAATCTGGATTTTATGCAAAC  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTTCAACTAAAATATAGACATTTTGGGAATCTGGATTTTATGCAAAC  646

seq1  CTTGTTCAAGCAGGCTGACCCTGACATCACTCTAAAAGGGAGTAAGGATG  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTTCAAGCAGGCTGACCCTGACATCACTCTAAAAGGGAGTAAGGATG  696

seq1  ACACCTTGCTGGTGACAGCCAGAGGCACAAGTCCAGGTTTCCCACTCAGC  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTTGCTGGTGACAGCCAGAGGCACAAGTCCAGGTTTCCCACTCAGC  746

seq1  TTCTGGCTACTACTGGGATTAGACTCTTTGATAGGGACATTTGTGCTTGT  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGGCTACTACTGGGATTAGACTCTTTGATAGGGACATTTGTGCTTGT  796

seq1  TTTCTTTAAGACAGTTTAGTCACTATGCATCATTTTTTCTTTACTTCCTC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTAAGACAGTTTAGTCACTATGCATCATTTTTTCTTTACTTCCTC  846

seq1  TTTTTAAATATTTGATATTTAAAAAGTGGTGTGTGTGTGTGTGTAAATTC  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAAATATTTGATATTTAAAAAGTGGTGTGTGTGTGTGTGTAAATTC  896

seq1  ATGCACACGTGCACTCCATGCACATATGTGCTGATACCCACGGAAGTCAG  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCACACGTGCACTCCATGCACATATGTGCTGATACCCACGGAAGTCAG  946

seq1  AAGAGGGTGTTTAGATTCTCTGAAGCGAAGTTACAAGAGGTTGGATGCCT  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGGTGTTTAGATTCTCTGAAGCGAAGTTACAAGAGGTTGGATGCCT  996

seq1  CCTAAAGGGGGTGTTAGGAACTGAACTTAGGTCCTCTAGAAGAACAGCGG  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAAGGGGGTGTTAGGAACTGAACTTAGGTCCTCTAGAAGAACAGCGG  1046

seq1  GCACTTTCAAACGCTGAGCCATCTCTCTAGCCCTATCTCCTCTCTTTCTT  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTTTCAAACGCTGAGCCATCTCTCTAGCCCTATCTCCTCTCTTTCTT  1096

seq1  GTTTAAAAACGCACACCTGATGCTACTATTTCCTACTGGAATTC  1135
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAAAAACGCACACCTGATGCTACTATTTCCTACTGGAATTC  1140

seq1: chr1_180740021_180741051
seq2: B6Ng01-271J17.g_142_1173

seq1  GCACACAGAGACATATGCACACCTGCATACACAGACTTATGCACACCTGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACACAGAGACATATGCACACCTGCATACACAGACTTATGCACACCTGC  50

seq1  ACACACAGACATATGCACACCTGCACACACAAACATATGCACACCTGCAC  100
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  ACACACAGACTTATGCACACCTGCACACACAAACATATGCACACCTGCAC  100

seq1  ACACAAACATATGCACACCTGCACACACAAACATATGCACACCTGCACAC  150
      ||||| || |||||||||| | | ||||||||||||||||| ||||||||
seq2  ACACAGACTTATGCACACCCGAATACACAAACATATGCACAGCTGCACAC  150

seq1  ACAAACATATGCACACCTGCACACACAAACATATGCACACCTGCACACAC  200
      | | ||||||||||||||||| |||||   ||||||||||||||||||||
seq2  AGAGACATATGCACACCTGCATACACAGCTATATGCACACCTGCACACAC  200

seq1  AAACATATGCACACCTGCACACACAAACATATGCACACCTGCACACACAA  250
      ||||||||| ||||||| | ||||||||||||||||| ||||||||||| 
seq2  AAACATATGTACACCTGAATACACAAACATATGCACAGCTGCACACACAG  250

seq1  ACATATGCACACCTGCACACACAAACATATGCACACCTGCACACACAAAC  300
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTATGCACACCTGCACACACAAACATATGCACACCTGCACACACAAAC  300

seq1  ATATGCACACCTGCACACACAAACATATGCACACCTGCACACACAAACAT  350
      ||||||||||||| | ||||||||||||||||| ||||||||||||||||
seq2  ATATGCACACCTGAATACACAAACATATGCACAGCTGCACACACAAACAT  350

seq1  ATGCACACCTGCACACACAAACATATGCACACCTGAATACACAAACATAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCACACCTGCACACACAAACATATGCACACCTGAATACACAAACATAT  400

seq1  GCACAGCTGCACACAGAGACATATGCACACCTGCATACACAGCTATATGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAGCTGCACACAGAGACATATGCACACCTGCATACACAGCTATATGC  450

seq1  ACACCTGCACACACAAACATATGCACACCATGCACACACAAATAAAAACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTGCACACACAAACATATGCACACCATGCACACACAAATAAAAACA  500

seq1  AAATAGCATCGTTATGCTCCAGATTCTGCAGAATACAAGGGAACTACTTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGCATCGTTATGCTCCAGATTCTGCAGAATACAAGGGAACTACTTA  550

seq1  CATTAGGAGTCTAATAACTAACTAATATCTATTTAACTTAGGAGTCTCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAGGAGTCTAATAACTAACTAATATCTATTTAACTTAGGAGTCTCCA  600

seq1  TAGAAAAATCATTATTCTGAATTTTGTACTTTGCACCTATGTCTACTAAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAAAATCATTATTCTGAATTTTGTACTTTGCACCTATGTCTACTAAG  650

seq1  ATTTAAAACTAGTTCAGTGTGCAATTTATTGTGTTCTGGGTCCATTTATA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAAAACTAGTTCAGTGTGCAATTTATTGTGTTCTGGGTCCATTTATA  700

seq1  GAATTCACTATGTAATTTTAAATAAATCTTCCTTTTGTTTTGATCGATTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTATGTAATTTTAAATAAATCTTCCTTTTGTTTTGATCGATTT  750

seq1  CTCTCTTTCTCACTATTTG-TTTCCAGATGGTTTTCTTTCCGTACAGCTT  799
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  CTCTCTTTCTCACTATTTGTTTTCCAGATGGTTTTCTTTCCGTACAGCTT  800

seq1  CAGTTAATCGTTTGATAAT-CCTTTCCAAAAATGCTTACTAAG-TAACTA  847
      ||||||||||||||||||| ||||||||||||||||||||||| ||||||
seq2  CAGTTAATCGTTTGATAATCCCTTTCCAAAAATGCTTACTAAGTTAACTA  850

seq1  -TTTTATATGACAAAGAAGTAA-TAAGAAATAACATGAAAAGTTAGTTGA  895
       ||||||||||||||||||||| |||||||||||||| ||||||||||||
seq2  TTTTTATATGACAAAGAAGTAATTAAGAAATAACATG-AAAGTTAGTTGA  899

seq1  GACCAATGAAATAAACAAGAGGACTCTACTGTTTTTGCCTTATTTTTAAA  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAATGAAATAAACAAGAGGACTCTACTGTTTTTGCCTTATTTTTAAA  949

seq1  -TTCTTCCTTTCTTGCCCCGCCCTCGTCATCATTGTCTATCCCCCATTGC  994
       ||||||| ||||  ||| ||||||||||||| |||||||||||   |||
seq2  TTTCTTCC-TTCTGCCCCGGCCCTCGTCATCA-TGTCTATCCCC--ATGC  995

seq1  ACATGCACAGGCTTGTACTGGAGCAC-GGGGGTGGGGG  1031
      ||||||||| ||||||||||   ||| |||||||||||
seq2  ACATGCACA-GCTTGTACTGAGCCACGGGGGGTGGGGG  1032

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information