MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-288G17
Chromosome	1 (Build37)	13 (Build37)
Map Location	162,953,986 - 162,954,118	37,666,166 - 37,667,308
singlet/doublet	singlet	singlet
Overlap gene	Zbtb37
Upstream gene	4930523C07Rik, 4930562F07Rik, Tnn, Mrps14, Cacybp, Rabgap1l, Gpr52, EG620750, Rc3h1, Serpinc1
Downstream gene	Gas5, Dars2, Cenpl, Klhl20, Ankrd45, 4930469G21Rik, EG665117, EG640200, EG620839, Prdx6, Tnfsf4, Tnfsf18, EG435650, LOC100039623, LOC269134, Fasl, AI848100, EG665109, Pigc, Dnm3
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930523C07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67647 MGI:1914897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4930562F07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75255 MGI:1922505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Tnn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329278 MGI:2665790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64659 MGI:1928141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacybp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12301 MGI:1270839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabgap1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29809 MGI:1352507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620246 MGI:3643278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG620750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620750 MGI:3643753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 390 ESTs, 8 Proteins

name	Rc3h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381305 MGI:2685397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11905 MGI:88095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240869 MGI:2444467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gas5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14455 MGI:95659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226539 MGI:2442510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70454 MGI:1917704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226541 MGI:2444855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73844 MGI:1921094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	4930469G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74933 MGI:1922183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG665117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665117 MGI:3646611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG640200 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640200 MGI:3646894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG620839 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620839 MGI:3648765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Prdx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11758 MGI:894320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22164 MGI:104511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240873 MGI:2673064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG435650 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435650 MGI:3643225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100039623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 127 ESTs, 4 Proteins

name	LOC269134 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:269134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Fasl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14103 MGI:99255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI848100 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226551 MGI:2138346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 120 ESTs, 1 Protein

name	EG665109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665109 MGI:3643469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Pigc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67292 MGI:1914542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103967 MGI:1341299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930562F07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245243 GeneID:75255 MGI:1922505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930562F07 gene transcript_id : XM_001472682.1

name	Tnn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342877 GeneID:329278 MGI:2665790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tenascin N transcript_id : NM_177839.2

name	Mrps14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130313 GeneID:64659 MGI:1928141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S14 transcript_id : NM_025474.3

name	Cacybp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468884 GeneID:12301 MGI:1270839
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcyclin binding protein transcript_id : NM_009786.1

name	Rabgap1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801907 GeneID:29809 MGI:1352507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1-like transcript_id : NM_001038621.2

name	Rabgap1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384545 GeneID:29809 MGI:1352507
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1-like transcript_id : NM_013862.4

name	Gpr52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364459 GeneID:620246 MGI:3643278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : G protein-coupled receptor 52 transcript_id : XM_885170.2

name	EG620750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364462 GeneID:620750 MGI:3643753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 390 ESTs, 8 Proteins product : predicted gene, EG620750 transcript_id : XM_885137.2

name	Rc3h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68131568 GeneID:381305 MGI:2685397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RING CCCH (C3H) domains 1 transcript_id : NM_001024952.1

name	Serpinc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891817 GeneID:11905 MGI:88095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1 transcript_id : NM_080844.3

name	Zbtb37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374324 GeneID:240869 MGI:2444467
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 37 transcript_id : NM_173424.2

name	Dars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801674 GeneID:226539 MGI:2442510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartyl-tRNA synthetase 2 (mitochondrial) transcript_id : NM_172644.3

name	Cenpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354931 GeneID:70454 MGI:1917704
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein L transcript_id : NM_027429.2

name	Klhl20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87116678 GeneID:226541 MGI:2444855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 20 (Drosophila) transcript_id : NM_001039482.1

name	Ankrd45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245249 GeneID:73844 MGI:1921094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : ankyrin repeat domain 45, transcript variant 1 transcript_id : XM_355251.5

name	4930469G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245258 GeneID:74933 MGI:1922183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930469G21 gene transcript_id : XM_001473282.1

name	EG620839 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364469 GeneID:620839 MGI:3648765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG620839 transcript_id : XM_896050.2

name	Prdx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378927 GeneID:11758 MGI:894320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxiredoxin 6 transcript_id : NM_007453.3

name	Tnfsf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678472 GeneID:22164 MGI:104511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 4 transcript_id : NM_009452.1

name	Tnfsf18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538843 GeneID:240873 MGI:2673064
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 18 transcript_id : NM_183391.2

name	LOC100039623 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245274 GeneID:100039623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 127 ESTs, 4 Proteins product : similar to Aph1a protein transcript_id : XM_001473374.1

name	Fasl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130000 GeneID:14103 MGI:99255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas ligand (TNF superfamily, member 6) transcript_id : NM_010177.3

name	AI848100 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245255 GeneID:226551 MGI:2138346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 120 ESTs, 1 Protein product : expressed sequence AI848100 transcript_id : XM_975051.2

name	EG665109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364463 GeneID:665109 MGI:3643469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG665109 transcript_id : XM_975494.1

name	Pigc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794579 GeneID:67292 MGI:1914542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class C transcript_id : NM_026078.2

name	Pigc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794577 GeneID:67292 MGI:1914542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class C transcript_id : NM_001039045.1

name	Dnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490430 GeneID:103967 MGI:1341299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 3 transcript_id : NM_001038619.1

name	4930562F07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245244 GeneID:75255 MGI:1922505
definition	codon_start : 1 product : hypothetical protein LOC75255 protein_id : XP_001472732.1

name	Tnn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244420 CCDS:CCDS15404.1 GeneID:329278 MGI:2665790
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IDA]; GO:0005178 - integrin binding [Evidence IDA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0016049 - cell growth [Evidence IDA]; GO:0016477 - cell migration [Evidence IDA]; GO:0007160 - cell-matrix adhesion [Evidence IDA] codon_start : 1 exception : mismatches in translation note : tenasin W product : tenascin N protein_id : NP_808507.1

name	Mrps14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384894 CCDS:CCDS15405.1 GeneID:64659 MGI:1928141
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S14 protein_id : NP_079750.1

name	Cacybp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468885 CCDS:CCDS15406.1 GeneID:12301 MGI:1270839
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005641 - nuclear envelope lumen [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : calcyclin binding protein protein_id : NP_033916.1

name	Rabgap1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490375 CCDS:CCDS15407.1 GeneID:29809 MGI:1352507
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant 2; rab6 GTPase activating protein-like; expressed in hematopoietic cells, heart, liver product : RAB GTPase activating protein 1-like isoform b protein_id : NP_001033710.1

name	Rabgap1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31455616 CCDS:CCDS15408.1 GeneID:29809 MGI:1352507
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; rab6 GTPase activating protein-like; expressed in hematopoietic cells, heart, liver product : RAB GTPase activating protein 1-like isoform a protein_id : NP_038890.2

name	Gpr52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82882993 GeneID:620246 MGI:3643278
definition	codon_start : 1 product : similar to G protein-coupled receptor 52 protein_id : XP_890263.1

name	EG620750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883044 GeneID:620750 MGI:3643753
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_890230.1

name	Rc3h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68131569 CCDS:CCDS15410.1 GeneID:381305 MGI:2685397
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045623 - negative regulation of T-helper cell differentiation [Evidence IMP] codon_start : 1 product : roquin protein_id : NP_001020123.1

name	Serpinc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252782 CCDS:CCDS15411.1 GeneID:11905 MGI:88095
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 note : anti-thrombin 3; antithrombin product : serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1 protein_id : NP_543120.1

name	Zbtb37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734134 CCDS:CCDS15412.1 GeneID:240869 MGI:2444467
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 37 protein_id : NP_775600.1

name	Dars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369928 CCDS:CCDS15413.1 GeneID:226539 MGI:2442510
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0004815 - aspartate-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006422 - aspartyl-tRNA aminoacylation [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : aspartyl-tRNA synthetase 2 (mitochondrial) protein_id : NP_766232.1

name	Cenpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74959804 CCDS:CCDS15414.1 GeneID:70454 MGI:1917704
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : centromere protein L protein_id : NP_081705.1

name	Klhl20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87116679 GeneID:226541 MGI:2444855
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : Kelch-like ECT2 interacting protein; kelch-like 18 product : kelch-like 20 protein_id : NP_001034571.1

name	Ankrd45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245250 GeneID:73844 MGI:1921094
definition	codon_start : 1 product : ankyrin repeat domain 45 isoform 1 protein_id : XP_355251.5

name	4930469G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245259 GeneID:74933 MGI:1922183
definition	codon_start : 1 product : hypothetical protein LOC74933 protein_id : XP_001473332.1

name	EG620839 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883046 GeneID:620839 MGI:3648765
definition	codon_start : 1 product : hypothetical protein protein_id : XP_901143.1

name	Prdx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671549 CCDS:CCDS15415.1 GeneID:11758 MGI:894320
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IMP]; GO:0051920 - peroxiredoxin activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0000302 - response to reactive oxygen species [Evidence IMP] codon_start : 1 note : peroxiredoxin 6, related sequence 3; anti-oxidant protein 2, related sequence 3; peroxiredoxin 5, related sequence 3; acidic calcium-independent phospholipase A2; 1-Cys Prx product : peroxiredoxin 6 protein_id : NP_031479.1

name	Tnfsf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678473 CCDS:CCDS15416.1 GeneID:22164 MGI:104511
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IPI] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IPI]; GO:0050710 - negative regulation of cytokine secretion [Evidence IPI] codon_start : 1 note : tax-transcriptionally activated glycoprotein 1 ligand; atherosclerosis 1 product : tumor necrosis factor (ligand) superfamily, member 4 protein_id : NP_033478.1

name	Tnfsf18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538844 CCDS:CCDS15417.1 GeneID:240873 MGI:2673064
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GITR ligand; glucocorticoid-induced-tumor necrosis factor receptor ligand product : tumor necrosis factor (ligand) superfamily, member 18 protein_id : NP_899247.2

name	LOC100039623 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245275 GeneID:100039623
definition	codon_start : 1 product : similar to Aph1a protein protein_id : XP_001473424.1

name	Fasl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753818 CCDS:CCDS15418.1 GeneID:14103 MGI:99255
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IGI]; GO:0006955 - immune response [Evidence IEA]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0046666 - retinal cell programmed cell death [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Fas antigen ligand; generalized lymphoproliferative disease; tumor necrosis factor (ligand) superfamily, member 6 product : Fas ligand (TNF superfamily, member 6) protein_id : NP_034307.1

name	AI848100 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364482 GeneID:226551 MGI:2138346
definition	codon_start : 1 product : membrane protein CH1 protein_id : XP_980145.1

name	EG665109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364464 GeneID:665109 MGI:3643469
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980588.1

name	Pigc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794578 CCDS:CCDS15419.1 GeneID:67292 MGI:1914542
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : phosphatidylinositol glycan, classC protein_id : NP_001034134.1

name	Pigc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313016 CCDS:CCDS15419.1 GeneID:67292 MGI:1914542
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : phosphatidylinositol glycan, classC protein_id : NP_080354.1

name	Dnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490431 GeneID:103967 MGI:1341299
definition	EC_number : 3.6.5.5 GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : testicular dynamin; t-dynamin; Dyna III; Dynamin III product : dynamin 3 protein_id : NP_001033708.1

name	EG665117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665117
definition	number : 1 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 1 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 2 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 3 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 4 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 5 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 6 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 7 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 8 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 9 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 10 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 11 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 12 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 13 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 14 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 15 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 16 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 17 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 18 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 19 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 20 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 21 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 22 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 23 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 24 pseudo : _no_value

name	EG640200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640200
definition	number : 25 pseudo : _no_value

name	EG435650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435650
definition	number : 1 pseudo : _no_value

name	EG435650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435650
definition	number : 2 pseudo : _no_value

name	EG435650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435650
definition	number : 3 pseudo : _no_value

name	EG435650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435650
definition	number : 4 pseudo : _no_value

name	EG435650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435650
definition	number : 5 pseudo : _no_value

name	LOC269134 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269134
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:265652
definition	standard_name : D1Pgn3

name	(CDS detail)
type	STS
link
xref	UniSTS:265653
definition	standard_name : D1Pgn4

name	(CDS detail)
type	STS
link
xref	UniSTS:265657
definition	standard_name : D1Pgn8

name	(CDS detail)
type	STS
link
xref	UniSTS:265650
definition	standard_name : D1Pgn12

name	(CDS detail)
type	STS
link
xref	UniSTS:265647
definition	standard_name : D1Pgn1

name	(CDS detail)
type	STS
link
xref	UniSTS:162186
definition	standard_name : RH125364

name	(CDS detail)
type	STS
link
xref	UniSTS:234247
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161314
definition	standard_name : RH124492

name	(CDS detail)
type	STS
link
xref	UniSTS:178483
definition	standard_name : AW049894

name	(CDS detail)
type	STS
link
xref	UniSTS:128441
definition	standard_name : D1Mit105

name	(CDS detail)
type	STS
link
xref	UniSTS:128873
definition	standard_name : D1Mit503

name	(CDS detail)
type	STS
link
xref	UniSTS:161872
definition	standard_name : RH125050

name	(CDS detail)
type	STS
link
xref	UniSTS:123384
definition	standard_name : 18.MMHAP50FLF3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:248409
definition	standard_name : AA997206

name	(CDS detail)
type	STS
link
xref	UniSTS:234249
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158870
definition	standard_name : AI114908

name	(CDS detail)
type	STS
link
xref	UniSTS:212714
definition	standard_name : RH129407

name	(CDS detail)
type	STS
link
xref	UniSTS:270159
definition	standard_name : PMC109273P1

name	(CDS detail)
type	STS
link
xref	UniSTS:496737
definition	standard_name : Gas5

name	(CDS detail)
type	STS
link
xref	UniSTS:143166
definition	standard_name : Gas5

name	(CDS detail)
type	STS
link
xref	UniSTS:207240
definition	standard_name : AW107496

name	(CDS detail)
type	STS
link
xref	UniSTS:164135
definition	standard_name : AW121806

name	(CDS detail)
type	STS
link
xref	UniSTS:178485
definition	standard_name : AI504637

name	(CDS detail)
type	STS
link
xref	UniSTS:234250
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:211397
definition	standard_name : RH128089

name	(CDS detail)
type	STS
link
xref	UniSTS:141091
definition	standard_name : Prdx5

name	(CDS detail)
type	STS
link
xref	UniSTS:234248
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128615
definition	standard_name : D1Mit266.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128614
definition	standard_name : MT2136

name	(CDS detail)
type	STS
link
xref	UniSTS:123114
definition	standard_name : 12.MMHAP33FLD3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:231303
definition	standard_name : MARC_7139-7140:992008251:1

name	(CDS detail)
type	STS
link
xref	UniSTS:207241
definition	standard_name : AU014768

name	(CDS detail)
type	STS
link
xref	UniSTS:233989
definition	standard_name : D1Ins1

name	(CDS detail)
type	STS
link
xref	UniSTS:143073
definition	standard_name : Tnfsf6

name	(CDS detail)
type	STS
link
xref	UniSTS:158872
definition	standard_name : U06948

name	(CDS detail)
type	STS
link
xref	UniSTS:125655
definition	standard_name : U06948

name	(CDS detail)
type	STS
link
xref	UniSTS:158871
definition	standard_name : AI848100

name	(CDS detail)
type	STS
link
xref	UniSTS:490683
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:180590
definition	standard_name : AI323415

name	(CDS detail)
type	STS
link
xref	UniSTS:207242
definition	standard_name : AI035346

name	(CDS detail)
type	STS
link
xref	UniSTS:178486
definition	standard_name : AW212108

name	(CDS detail)
type	STS
link
xref	UniSTS:211493
definition	standard_name : RH128185

name	(CDS detail)
type	STS
link
xref	UniSTS:265651
definition	standard_name : D1Pgn2

name	(CDS detail)
type	STS
link
xref	UniSTS:178487
definition	standard_name : AW061159

name	(CDS detail)
type	STS
link
xref	UniSTS:128874
definition	standard_name : D1Mit504

name	4930523C07Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149245242 GeneID:67647 MGI:1914897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 4930523C07 gene transcript_id : XR_035190.1

name	Gas5 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:144226204 GeneID:14455 MGI:95659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest specific 5 transcript_id : NR_002840.2

clone name	MSMg01-457C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-217D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301B13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-288G17.b	B6Ng01-288G17.g
ACC	GA086086	GA086087
length	168	1,160
definition	B6Ng01-288G17.b	B6Ng01-288G17.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(162,953,986 - 162,954,118)	(37,666,166 - 37,667,308)
sequence	gaattcattaaaaatgactaaatatccccccccctttttttttcaagaca gggtttctctgtatggctctggtgcctggacctttcattagagaccaggc tggcctcgaattcagaaatccacctgcctctgcctcctgagtgctgggat ttaggtgagcgccaccac	gaattctctgtgctgcctgatttttctggagaggcaggaacagatgtctc ctcatctcagatagggcatccagggcaggtccaagaaacaactccacccc agtctaacttggtgagggaaggaacgtattgtgattacctggcaatggct tgtgatggaaggacagatgactcaagggaactgcctcactacacagccca cccagcatggatgagggctgagaacacctcactgctggaccctgcacaac ctgcagggagcgccactgaagaaaatctcccccacccccaccccagaaac tgtttactgcttgtctgacctcggggagaggacaggccatgtgcatcttc taacactgggtttgaggaggcttgtaagttttgtgggccttttagcttta agagactctttcctcccttagaagggaatgttgagattttgaggaaacaa ctacacaggcatcctaccttcccatccactttccccattaaattaaattt gtccgtaaagcaagctatcagaaactcagtgttatttctgtcaagaagtc ttaacttgcccttcaatgtagttttttgctctgtaatgaacatcctccat accctggctttgtctcctgtctgttttcctcgatgcccacaggaacctga aactctgagtagagagcccagtctgtttcttttatctttgagaactccct caccaccagcagccctgtgaggatgggcatatcttgagtgtatgagatag gtctagacgagtgccactggacctgggtaacagtagaaaatgtggcttcc gaaaagcaaatgagctaataatccactgtctaagtcagggtttctattcc tccacaaaacatcatgaccaagttgggggaggaaaggggttttattcagc ttacagttccaccattgcctgttcatcaccaaaagggaaagtcagggact ggggactcacacagggcagggattctagaggccagggagctgatggcaga ggccacgaacggctgttggttactgggttgctttccttgcttatccagct tgctttcttatagatcccaggactaccagcctaggaatggcacccaccca catgtgggctggacccctgatccctggagcgaatcactattgagagaaaa tgtctatagc
quality values	Open. Hide. 59 59 16 15 62 29 18 43 56 59 62 62 62 27 29 59 62 51 62 62 62 46 59 39 36 54 62 62 62 62 62 54 62 62 62 19 18 15 13 13 18 23 34 15 29 29 23 50 30 33 37 56 56 54 49 56 56 43 46 46 46 50 30 22 48 32 24 56 46 33 34 19 13 19 12 22 17 16 10 10 5 12 7 5 8 10 8 11 7 10 11 13 6 27 13 27 12 8 12 13 11 21 24 12 17 18 13 10 13 11 18 19 13 13 10 40 24 30 33 18 14 10 13 18 13 21 13 23 35 27 27 18 27 17 8 16 16 13 18 23 10 18 18 25 23 27 28 23 17 24 15 10 26 27 30 12 17 10 23 12 12 14 8 11 18 19 18 10	Open. Hide. 56 47 51 37 62 62 62 62 62 49 49 27 30 28 22 28 27 27 22 16 19 25 38 38 38 59 59 62 62 59 59 62 62 59 62 62 62 62 59 62 62 62 54 59 62 62 62 62 62 62 62 42 62 62 62 62 62 51 39 18 35 32 28 27 43 38 50 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 59 59 62 62 54 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 59 62 62 56 62 56 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 44 62 56 46 56 44 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 43 52 47 43 43 40 26 31 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 42 58 58 58 54 58 58 54 54 58 58 58 58 52 42 58 58 58 58 58 58 58 54 54 52 58 58 54 58 58 58 54 58 54 54 58 58 58 54 58 58 58 58 52 54 54 58 58 52 58 52 40 58 58 58 58 58 58 58 58 58 58 58 36 45 58 52 58 58 58 58 49 58 58 51 58 53 51 49 51 48 42 49 49 48 58 43 47 58 58 58 51 51 58 51 54 58 58 58 58 54 58 58 50 58 58 54 52 58 52 53 53 50 51 51 49 58 54 49 58 33 28 58 51 30 44 50 51 51 52 51 48 43 58 46 58 50 58 17 51 53 41 58 38 49 30 52 58 49 50 40 50 41 50 46 40 58 54 53 26 58 58 28 25 50 51 41 51 51 49 58 39 53 33 30 36 39 54 41 52 53 42 54 49 39 53 53 34 37 39 42 43 38 38 14 14 31 38 35 49 21 51 21 29 40 54 44 49 31 45 42 49 52 39 39 53 53 39 52 42 38 32 42 35 49 23 52 45 45 53 30 20 33 42 32 40 41 40 25 46 16 36 40 31 25 21 33 40 54 26 42 27 36 40 53 49 40 40 44 26 28 25 27 18 32 20 40 40 40 42 32 33 31 39 53 32 52 32 45 32 31 53 46 40 21 20 26 27 32 31 31 32 45 25 52 31 31 37 31 30 46 31 51 26 30 31 26 31 29 42 31 46 27 12 32 42 29 9 37 26 28 51 37 31 23 30 29 21 32 35 31 33 45 29 22 9 46 41 46 25 31 42 31 31 38 43 27 19 42 30 38 25 27 21 28 46 46 46 12 31 7 14 27 46 31 8 30 46 35 10 46 46 28 29 30 25 17 9 16 26 24 35 28 31 27 32 33 31 28 31 14 19 23 25 37 11 23 11 25 31 26 15 23 19 19 27 31 21 19 29 20 31 46 18 17 41 16 26 32 7 12 34 28 20 15 44 13 28 32 21 18 32 32 14 17 18 12 24 19 26 12 14 16 17 41 21 6 17 18 44 6 17 10 16 10 22 11 10 23 10 38 7 14 23 17 31 12 34 11 32 23 9 7 6 14 12 22 7 5 12 6 14 8 24 8 4 4 9 4 5 17 26 8 19 12 6 25 7 7 24 8 16 16 7 15 33 18 16 10 29 8 8 30 20 5 5 3 7 10 19 3 10 11 11 5 16 10 6 6 11 4 7 19 30 38 9 11 22 15 16 27 16 7 12 3 9 33 16 20 6 9 22 11 6 9 8 18 13 10 28 21 20 17 14 9 2 4 6 16 20 12 13 7 25 23 7 4 25 8 10 5 11 3 3 4 8 26 14 16 6 18 7 5 6 17 12 21 10 8 15 12 3 29 5 2 3 1 2 2 5 5 3 6 6 2 1 4 9 10 8 7 4 4 5 17 8 24 17 17 5 16 6 4 3 3 2 5 5 6 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_162953986_162954118
seq2: B6Ng01-288G17.b_81_210 (reverse)

seq1  GTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGG  50
      |||||||||| | || | ||||||||||||| ||||||||||||||| ||
seq2  GTGGTGGCGCTCACC-TAAATCCCAGCACTCAGGAGGCAGAGGCAGGTGG  49

seq1  ATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGC  100
      |||||||| ||| |||||||||||||||  |  |  || |||||| || |
seq2  ATTTCTGAATTCGAGGCCAGCCTGGTCTCTAATGAAAGGTCCAGG-CA-C  97

seq1  CAGGGCTATACAGAGAAACCCTGTCTCGAAAAA  133
      ||| || ||||||||||||||||||| ||||||
seq2  CAGAGCCATACAGAGAAACCCTGTCTTGAAAAA  130

seq1: chr13_37666166_37667308
seq2: B6Ng01-288G17.g_71_1230

seq1  GAATTCTCTGTGCTGCCTGATTTTTCTGGAGAGGCAGGAACAGATGTCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTGTGCTGCCTGATTTTTCTGGAGAGGCAGGAACAGATGTCTC  50

seq1  CTCATCTCAGATAGGGCATCCAGGGCAGGTCCAAGAAACAACTCCACCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATCTCAGATAGGGCATCCAGGGCAGGTCCAAGAAACAACTCCACCCC  100

seq1  AGTCTAACTTGGTGAGGGAAGGAACGTATTGTGATTACCTGGCAATGGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTAACTTGGTGAGGGAAGGAACGTATTGTGATTACCTGGCAATGGCT  150

seq1  TGTGATGGAAGGACAGATGACTCAAGGGAACTGCCTCACTACACAGCCCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGATGGAAGGACAGATGACTCAAGGGAACTGCCTCACTACACAGCCCA  200

seq1  CCCAGCATGGATGAGGGCTGAGAACACCTCACTGCTGGACCCTGCACAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCATGGATGAGGGCTGAGAACACCTCACTGCTGGACCCTGCACAAC  250

seq1  CTGCAGGGAGCGCCACTGAAGAAAATCTCCCCCACCCCCACCCCAGAAAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCAGGGAGCGCCACTGAAGAAAATCTCCCCCACCCCCACCCCAGAAAC  300

seq1  TGTTTACTGCTTGTCTGACCTCGGGGAGAGGACAGGCCATGTGCATCTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTACTGCTTGTCTGACCTCGGGGAGAGGACAGGCCATGTGCATCTTC  350

seq1  TAACACTGGGTTTGAGGAGGCTTGTAAGTTTTGTGGGCCTTTTAGCTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACACTGGGTTTGAGGAGGCTTGTAAGTTTTGTGGGCCTTTTAGCTTTA  400

seq1  AGAGACTCTTTCCTCCCTTAGAAGGGAATGTTGAGATTTTGAGGAAACAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGACTCTTTCCTCCCTTAGAAGGGAATGTTGAGATTTTGAGGAAACAA  450

seq1  CTACACAGGCATCCTACCTTCCCATCCACTTTCCCCATTAAATTAAATTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACACAGGCATCCTACCTTCCCATCCACTTTCCCCATTAAATTAAATTT  500

seq1  GTCCGTAAAGCAAGCTATCAGAAACTCAGTGTTATTTCTGTCAAGAAGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCGTAAAGCAAGCTATCAGAAACTCAGTGTTATTTCTGTCAAGAAGTC  550

seq1  TTAACTTGCCCTTCAATGTAGTTTTTTGCTCTGTAATGAACATCCTCCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTTGCCCTTCAATGTAGTTTTTTGCTCTGTAATGAACATCCTCCAT  600

seq1  ACCCTGGCTTTGTCTCCTGTCTGTTTTCCTCGATGCCCACAGGAACCTGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTGGCTTTGTCTCCTGTCTGTTTTCCTCGATGCCCACAGGAACCTGA  650

seq1  AACTCTGAGTAGAGAGCCCAGTCTGTTTCTTTTATCTTTGAGAACTCCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCTGAGTAGAGAGCCCAGTCTGTTTCTTTTATCTTTGAGAACTCCCT  700

seq1  CACCACCAGCAGCCCTGTGAGGATGGGCATATCTTGAGTGTATGAGATAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACCAGCAGCCCTGTGAGGATGGGCATATCTTGAGTGTATGAGATAG  750

seq1  GTCTAGACGAGTGCCACTGGACCTGGGTAACAGTAGAAAATGTGGCTTCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTAGACGAGTGCCACTGGACCTGGGTAACAGTAGAAAATGTGGCTTCC  800

seq1  GAAAAGCAAATGAGCTAATAATCCACTGTCTAAGTCAGGGTTTCTATTCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAGCAAATGAGCTAATAATCCACTGTCTAAGTCAGGGTTTCTATTCC  850

seq1  TCCACAAAACATCATGACCAAGTT-GGGGAGGAAAGGG--TTTATTCAGC  897
      |||||||||||||||||||||||| |||||||||||||  ||||||||||
seq2  TCCACAAAACATCATGACCAAGTTGGGGGAGGAAAGGGGTTTTATTCAGC  900

seq1  TTACAGTTCCA-CATTG-CTGTTCATCACCAAA---GGAAGTCA-GGACT  941
      ||||||||||| ||||| |||||||||||||||   | |||||| |||||
seq2  TTACAGTTCCACCATTGCCTGTTCATCACCAAAAGGGAAAGTCAGGGACT  950

seq1  -GGGACTCACACAGGGCA-GGAATCTAGAGGC--AGGAGCTGAT-GCAGA  986
       ||||||||||||||||| ||| |||||||||   ||||||||| |||||
seq2  GGGGACTCACACAGGGCAGGGATTCTAGAGGCCAGGGAGCTGATGGCAGA  1000

seq1  GGCCACGAAGGGCTGTTGTTTACTGGGTTGCTTTCCCTGCCTTATTCAGC  1036
      ||||||||| |||||||| ||||||||||||||||| || ||||| ||||
seq2  GGCCACGAACGGCTGTTGGTTACTGGGTTGCTTTCCTTG-CTTATCCAGC  1049

seq1  TTGCTTTCTTATAGAACCCAAGACTACCAGCCTAGGGATGGCA-CCACCC  1085
      ||||||||||||||| |||| ||||||||||||||| |||||| ||||||
seq2  TTGCTTTCTTATAGATCCCAGGACTACCAGCCTAGGAATGGCACCCACCC  1099

seq1  ACA-ATGGGCTGGA-CCCTGATCCCTTGAGCG-ATCACTAAT-TGAGAAA  1131
      |||  ||||||||| ||||||||||| ||||| ||||||| |  ||||||
seq2  ACATGTGGGCTGGACCCCTGATCCCTGGAGCGAATCACTATTGAGAGAAA  1149

seq1  ATGCCTTATAGC  1143
      ||| | ||||||
seq2  ATGTC-TATAGC  1160

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information