MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-304J09
Chromosome	1 (Build37)
Map Location	88,733,866 - 88,915,618
singlet/doublet	doublet
Overlap gene	4930429A22Rik, EG620213
Upstream gene	Cab39, Itm2c, 4933407L21Rik, Gpr55, Spata3, 2810459M11Rik, Psmd1, Htr2b, Armc9, B3gnt7, EG383538, Ncl, Snord82, Nmur1, 1700019O17Rik, LOC100040414, Ptma, Pde6d, Cops7b, Nppc
Downstream gene	LOC208256, Akp5, Alpi, Akp3, Ecel1, 1700027L20Rik, Chrnd, Chrng, Eif4e2, Efhd1, Tnrc15, LOC100040600, LOC100040591, 3110079O15Rik, Ngef, LOC620454, Neu2, Inpp5d, Atg16l1, Sag, Usp40
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cab39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12283 MGI:107438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itm2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64294 MGI:1927594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933407L21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71141 MGI:1918391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Gpr55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227326 MGI:2685064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70060 MGI:1917310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	2810459M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72792 MGI:1920042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs

name	Psmd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70247 MGI:1917497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15559 MGI:109323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78795 MGI:1926045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	B3gnt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227327 MGI:2384394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383538 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383538 MGI:3647794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Ncl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17975 MGI:97286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snord82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80828 MGI:1931502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nmur1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14767 MGI:1341898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019O17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71863 MGI:1919113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins

name	LOC100040414 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Ptma (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19231 MGI:97803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde6d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18582 MGI:1270843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cops7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26895 MGI:1349388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nppc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18159 MGI:97369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930429A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208718 MGI:2442555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620213 MGI:3646897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1749 ESTs, 8 Proteins

name	LOC208256 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:208256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Akp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11650 MGI:108009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76768 MGI:1924018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11648 MGI:87984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13599 MGI:1343461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027L20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69453 MGI:1916703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 25 Proteins

name	Chrnd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11447 MGI:87893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11449 MGI:87895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4e2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Efhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98363 MGI:1921607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227331 MGI:2138584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040600 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100040591 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 23 Proteins

name	3110079O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73234 MGI:1920484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins

name	Ngef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53972 MGI:1858414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 201 ESTs

name	Neu2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23956 MGI:1344417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inpp5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16331 MGI:107357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg16l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77040 MGI:1924290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20215 MGI:98227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227334 MGI:2443184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cab39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982581 GeneID:12283 MGI:107438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 39 transcript_id : NM_133781.2

name	Itm2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386544 GeneID:64294 MGI:1927594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integral membrane protein 2C transcript_id : NM_022417.2

name	4933407L21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363800 GeneID:71141 MGI:1918391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA 4933407L21 gene transcript_id : XM_976810.1

name	Gpr55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185937 GeneID:227326 MGI:2685064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 55 transcript_id : NM_001033290.2

name	Spata3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208835 GeneID:70060 MGI:1917310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 3 transcript_id : NM_027029.1

name	Spata3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803477 GeneID:70060 MGI:1917310
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 3 transcript_id : NM_028647.2

name	Spata3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801662 GeneID:70060 MGI:1917310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 3 transcript_id : NM_027300.2

name	2810459M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363804 GeneID:72792 MGI:1920042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs product : RIKEN cDNA 2810459M11 gene transcript_id : XM_484890.4

name	Psmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351621 GeneID:70247 MGI:1917497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 transcript_id : NM_027357.2

name	Htr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130975 GeneID:15559 MGI:109323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-hydroxytryptamine (serotonin) receptor 2B transcript_id : NM_008311.2

name	Armc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637816 GeneID:78795 MGI:1926045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 9 transcript_id : NM_030184.2

name	Armc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637814 GeneID:78795 MGI:1926045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 9 transcript_id : NM_027456.1

name	B3gnt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644580 GeneID:227327 MGI:2384394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 transcript_id : NM_145222.1

name	EG383538 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363806 GeneID:383538 MGI:3647794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG383538 transcript_id : XM_357111.4

name	Ncl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875536 GeneID:17975 MGI:97286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolin transcript_id : NM_010880.3

name	Nmur1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110606 GeneID:14767 MGI:1341898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuromedin U receptor 1 transcript_id : NM_010341.1

name	1700019O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363802 GeneID:71863 MGI:1919113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins product : RIKEN cDNA 1700019O17 gene, transcript variant 1 transcript_id : XM_484891.3

name	1700019O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363803 GeneID:71863 MGI:1919113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : RIKEN cDNA 1700019O17 gene, transcript variant 2 transcript_id : XM_895919.2

name	LOC100040414 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234193 GeneID:100040414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to ribosomal protein L30 transcript_id : XM_001474704.1

name	Ptma (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130608 GeneID:19231 MGI:97803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prothymosin alpha transcript_id : NM_008972.2

name	Pde6d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982129 GeneID:18582 MGI:1270843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 6D, cGMP-specific, rod, delta transcript_id : NM_008801.2

name	Cops7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129901 GeneID:26895 MGI:1349388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 7b (Arabidopsis thaliana) transcript_id : NM_172974.2

name	Nppc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803342 GeneID:18159 MGI:97369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natriuretic peptide precursor type C transcript_id : NM_010933.3

name	4930429A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24233555 GeneID:208718 MGI:2442555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930429A22 gene transcript_id : NM_153530.1

name	EG620213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363805 GeneID:620213 MGI:3646897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1748 ESTs, 8 Proteins product : predicted gene, EG620213 transcript_id : XM_885296.2

name	Akp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244097 GeneID:11650 MGI:108009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 5 transcript_id : NM_007433.3

name	Alpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487322 GeneID:76768 MGI:1924018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase, intestinal transcript_id : NM_001081082.1

name	Akp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347478 GeneID:11648 MGI:87984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 3, intestine, not Mn requiring transcript_id : NM_007432.2

name	Ecel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254535 GeneID:13599 MGI:1343461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelin converting enzyme-like 1 transcript_id : NM_021306.2

name	1700027L20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234183 GeneID:69453 MGI:1916703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 25 Proteins product : RIKEN cDNA 1700027L20 gene transcript_id : XM_487606.5

name	Chrnd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225334 GeneID:11447 MGI:87893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, delta polypeptide transcript_id : NM_021600.2

name	Chrng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964695 GeneID:11449 MGI:87895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, gamma polypeptide transcript_id : NM_009604.3

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677505 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_023314.3

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677509 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_001039170.1

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677507 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_001039169.1

name	Efhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891752 GeneID:98363 MGI:1921607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF hand domain containing 1 transcript_id : NM_028889.2

name	Tnrc15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382552 GeneID:227331 MGI:2138584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 15 transcript_id : NM_146112.3

name	LOC100040600 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234202 GeneID:100040600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Tnrc15 protein transcript_id : XM_001475127.1

name	LOC100040591 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234200 GeneID:100040591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 23 Proteins product : similar to inward rectifier potassium channel Kir7.1 transcript_id : XM_001475110.1

name	3110079O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363811 GeneID:73234 MGI:1920484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins product : RIKEN cDNA 3110079O15 gene transcript_id : XM_978146.1

name	Ngef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845276 GeneID:53972 MGI:1858414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal guanine nucleotide exchange factor transcript_id : NM_019867.1

name	LOC620454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234206 GeneID:620454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 201 ESTs product : hypothetical LOC620454 transcript_id : XM_001475262.1

name	Neu2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361584 GeneID:23956 MGI:1344417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuraminidase 2 transcript_id : NM_015750.2

name	Inpp5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754355 GeneID:16331 MGI:107357
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase D transcript_id : NM_010566.1

name	Atg16l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350336 GeneID:77040 MGI:1924290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 16-like 1 (yeast) transcript_id : NM_029846.3

name	Sag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980544 GeneID:20215 MGI:98227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinal S-antigen transcript_id : NM_009118.2

name	Usp40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893155 GeneID:227334 MGI:2443184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 40 transcript_id : NM_001033291.2

name	Cab39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982582 CCDS:CCDS15112.1 GeneID:12283 MGI:107438
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence ISS] codon_start : 1 exception : mismatches in translation note : calcium binding protein, 39 kDa product : MO25 protein protein_id : NP_598542.2

name	Itm2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967943 GeneID:64294 MGI:1927594
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy function : expression of this gene product inhibits the growth of E. coli note : integral membrane protein 3 product : integral membrane protein 2C protein_id : NP_071862.1

name	4933407L21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363801 GeneID:71141 MGI:1918391
definition	codon_start : 1 product : hypothetical protein LOC71141 protein_id : XP_981904.1

name	Gpr55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185938 CCDS:CCDS15115.1 GeneID:227326 MGI:2685064
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 55 protein_id : NP_001028462.2

name	Spata3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312528 GeneID:70060 MGI:1917310
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; testis and spermatogenesis cell apoptosis related gene 1 product : testis and spermatogenesis cell apoptosis related protein 1 isoform 2 protein_id : NP_081576.1

name	Spata3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208842 CCDS:CCDS15116.1 GeneID:70060 MGI:1917310
definition	codon_start : 1 note : isoform 3 is encoded by transcript variant 3; testis and spermatogenesis cell apoptosis related gene 1 product : testis and spermatogenesis cell apoptosis related protein 1 isoform 3 protein_id : NP_082923.1

name	Spata3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208836 GeneID:70060 MGI:1917310
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis and spermatogenesis cell apoptosis related gene 1 product : testis and spermatogenesis cell apoptosis related protein 1 isoform 1 protein_id : NP_081305.1

name	2810459M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880946 GeneID:72792 MGI:1920042
definition	codon_start : 1 product : hypothetical protein LOC72792 protein_id : XP_484890.3

name	Psmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315975 CCDS:CCDS15117.1 GeneID:70247 MGI:1917497
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : proteasome 26S non-ATPase subunit 1 protein_id : NP_081633.1

name	Htr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130976 GeneID:15559 MGI:109323
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004993 - serotonin receptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007208 - serotonin receptor, phospholipase C activating pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : 5-hydroxytryptamine (serotonin) receptor 2B protein_id : NP_032337.2

name	Armc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313490 CCDS:CCDS15118.1 GeneID:78795 MGI:1926045
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : armadillo repeat containing 9 isoform 1 protein_id : NP_084460.1

name	Armc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119637815 GeneID:78795 MGI:1926045
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : armadillo repeat containing 9 isoform 2 protein_id : NP_081732.1

name	B3gnt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644581 GeneID:227327 MGI:2384394
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008375 - acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 protein_id : NP_660257.1

name	EG383538 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363807 GeneID:383538 MGI:3647794
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357111.4

name	Ncl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875537 GeneID:17975 MGI:97286
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : nucleolin protein_id : NP_035010.3

name	Nmur1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110607 CCDS:CCDS15119.1 GeneID:14767 MGI:1341898
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008188 - neuropeptide receptor activity [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : alternative start codon product : G protein-coupled receptor 66 protein_id : NP_034471.1 transl_except : (pos:complement(88284714..88284716),aa:Met)

name	1700019O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51705178 GeneID:71863 MGI:1919113
definition	codon_start : 1 product : hypothetical protein LOC71863 isoform 1 protein_id : XP_484891.1

name	1700019O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880884 GeneID:71863 MGI:1919113
definition	codon_start : 1 product : hypothetical protein LOC71863 isoform 2 protein_id : XP_901012.1

name	LOC100040414 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234194 GeneID:100040414
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_001474754.1

name	Ptma (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110705 GeneID:19231 MGI:97803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : prothymosin alpha protein_id : NP_032998.1

name	Pde6d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679245 CCDS:CCDS15121.1 GeneID:18582 MGI:1270843
definition	GO_function : GO:0047555 - 3',5'-cyclic-GMP phosphodiesterase activity [Evidence TAS]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007602 - phototransduction [Evidence TAS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : phosphodiesterase 6D, cGMP-specific, rod, delta protein_id : NP_032827.1

name	Cops7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27764886 CCDS:CCDS15122.1 GeneID:26895 MGI:1349388
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : COP9 complex S7b product : COP9 (constitutive photomorphogenic) homolog, subunit 7b protein_id : NP_766562.1

name	Nppc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754880 CCDS:CCDS15123.1 GeneID:18159 MGI:97369
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence TAS]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IDA]; GO:0050880 - regulation of blood vessel size [Evidence IEA] codon_start : 1 note : natriuretic peptide precursor C product : natriuretic peptide precursor type C protein_id : NP_035063.1

name	4930429A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233556 CCDS:CCDS15124.1 GeneID:208718 MGI:2442555
definition	GO_function : GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208718 protein_id : NP_705758.1

name	EG620213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880886 GeneID:620213 MGI:3646897
definition	codon_start : 1 product : similar to ribosomal protein L6 protein_id : XP_890389.1

name	Akp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244098 CCDS:CCDS15126.1 GeneID:11650 MGI:108009
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase 5 protein_id : NP_031459.3

name	Alpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487323 GeneID:76768 MGI:1924018
definition	GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase, intestinal protein_id : NP_001074551.1

name	Akp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347479 CCDS:CCDS15127.1 GeneID:11648 MGI:87984
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase 3, intestine, not Mn requiring protein_id : NP_031458.2

name	Ecel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254536 CCDS:CCDS15128.1 GeneID:13599 MGI:1343461
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IDA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : damage-induced neuronal endopeptidase protein_id : NP_067281.2

name	1700027L20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363810 GeneID:69453 MGI:1916703
definition	codon_start : 1 product : hypothetical protein LOC69453 protein_id : XP_487606.4

name	Chrnd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225335 CCDS:CCDS15129.1 GeneID:11447 MGI:87893
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor delta product : cholinergic receptor, nicotinic, delta polypeptide protein_id : NP_067611.2

name	Chrng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964696 GeneID:11449 MGI:87895
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor gamma product : cholinergic receptor, nicotinic, gamma polypeptide protein_id : NP_033734.3

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677506 CCDS:CCDS15130.1 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 3 protein_id : NP_075803.2

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677510 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 1 protein_id : NP_001034259.1

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677508 CCDS:CCDS15131.1 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 2 protein_id : NP_001034258.1

name	Efhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386360 CCDS:CCDS15132.1 GeneID:98363 MGI:1921607
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0031175 - neurite development [Evidence IMP] codon_start : 1 product : EF hand domain containing 1 protein_id : NP_083165.1

name	LOC100040600 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234203 GeneID:100040600
definition	codon_start : 1 product : similar to Tnrc15 protein protein_id : XP_001475177.1

name	Tnrc15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34365797 CCDS:CCDS15133.1 GeneID:227331 MGI:2138584
definition	codon_start : 1 exception : mismatches in translation product : Grb10 interacting GYF protein 2 protein_id : NP_666224.2

name	LOC100040591 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234201 GeneID:100040591
definition	codon_start : 1 product : similar to inward rectifier potassium channel Kir7.1 protein_id : XP_001475160.1

name	3110079O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363812 GeneID:73234 MGI:1920484
definition	codon_start : 1 product : hypothetical protein LOC73234 protein_id : XP_983240.1

name	Ngef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845277 GeneID:53972 MGI:1858414
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 function : guanine nucleotide exchange factor for Rho-type GTPases note : transforming immortalised mammary epithelial sequence 2 product : neuronal guanine nucleotide exchange factor protein_id : NP_063920.1

name	LOC620454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234207 GeneID:620454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475312.1

name	Neu2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657375 CCDS:CCDS15135.1 GeneID:23956 MGI:1344417
definition	GO_function : GO:0004308 - exo-alpha-sialidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : brain sialidase; cystolic sialidase product : neuraminidase 2 protein_id : NP_056565.1

name	Inpp5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754356 GeneID:16331 MGI:107357
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008340 - determination of adult life span [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IMP]; GO:0050869 - negative regulation of B cell activation [Evidence IMP]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0045779 - negative regulation of bone resorption [Evidence IMP]; GO:0030853 - negative regulation of granulocyte differentiation [Evidence IMP]; GO:0050777 - negative regulation of immune response [Evidence IMP]; GO:0045409 - negative regulation of interleukin-6 biosynthesis [Evidence IMP]; GO:0045656 - negative regulation of monocyte differentiation [Evidence IMP]; GO:0045659 - negative regulation of neutrophil differentiation [Evidence IMP]; GO:0045671 - negative regulation of osteoclast differentiation [Evidence IMP]; GO:0009968 - negative regulation of signal transduction [Evidence IMP]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0045579 - positive regulation of B cell differentiation [Evidence IMP]; GO:0045648 - positive regulation of erythrocyte differentiation [Evidence IMP]; GO:0045621 - positive regulation of lymphocyte differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : inositol polyphosphate-5-phosphatase, 145 kDa; Src homology 2 domain-containing inositol-5-phosphatase; SH2-containing inositol phosphatase SHIP; SH2 containing inositol phosphotase product : inositol polyphosphate-5-phosphatase D protein_id : NP_034696.1

name	Atg16l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777650 CCDS:CCDS15136.1 GeneID:77040 MGI:1924290
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000045 - autophagic vacuole formation [Evidence TAS]; GO:0006914 - autophagy [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta isoform is encoded by transcript variant b; autophagy 16-like; APG16 autophagy 16-like product : APG16L beta isoform protein_id : NP_084122.2

name	Sag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677845 GeneID:20215 MGI:98227
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0002046 - opsin binding [Evidence IDA]; GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : retinal S-antigen protein_id : NP_033144.1

name	Usp40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794623 CCDS:CCDS15137.1 GeneID:227334 MGI:2443184
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 40 product : ubiquitin specific peptidase 40 protein_id : NP_001028463.1

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 1 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 2 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 3 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 4 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 5 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 6 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 7 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 8 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 9 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 10 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 11 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:210259
definition	standard_name : RH136266

name	(CDS detail)
type	STS
link
xref	UniSTS:165085
definition	standard_name : C78372

name	(CDS detail)
type	STS
link
xref	UniSTS:161592
definition	standard_name : RH124770

name	(CDS detail)
type	STS
link
xref	UniSTS:162566
definition	standard_name : RH125821

name	(CDS detail)
type	STS
link
xref	UniSTS:211834
definition	standard_name : RH128526

name	(CDS detail)
type	STS
link
xref	UniSTS:158821
definition	standard_name : AA960512

name	(CDS detail)
type	STS
link
xref	UniSTS:234167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158820
definition	standard_name : AU041202

name	(CDS detail)
type	STS
link
xref	UniSTS:162073
definition	standard_name : RH125251

name	(CDS detail)
type	STS
link
xref	UniSTS:152977
definition	standard_name : D11S3747

name	(CDS detail)
type	STS
link
xref	UniSTS:178426
definition	standard_name : AV377389

name	(CDS detail)
type	STS
link
xref	UniSTS:163256
definition	standard_name : AJ012488

name	(CDS detail)
type	STS
link
xref	UniSTS:143423
definition	standard_name : Htr2b

name	(CDS detail)
type	STS
link
xref	UniSTS:495966
definition	standard_name : Htr2b

name	(CDS detail)
type	STS
link
xref	UniSTS:128941
definition	standard_name : D1Mit83

name	(CDS detail)
type	STS
link
xref	UniSTS:185445
definition	standard_name : AA986695

name	(CDS detail)
type	STS
link
xref	UniSTS:257487
definition	standard_name : px-26e2

name	(CDS detail)
type	STS
link
xref	UniSTS:142252
definition	standard_name : D1Mit516

name	(CDS detail)
type	STS
link
xref	UniSTS:143994
definition	standard_name : Ncl

name	(CDS detail)
type	STS
link
xref	UniSTS:128779
definition	standard_name : D1Mit415

name	(CDS detail)
type	STS
link
xref	UniSTS:492179
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165087
definition	standard_name : AI841218

name	(CDS detail)
type	STS
link
xref	UniSTS:142285
definition	standard_name : RH125887

name	(CDS detail)
type	STS
link
xref	UniSTS:144060
definition	standard_name : Nppc

name	(CDS detail)
type	STS
link
xref	UniSTS:144061
definition	standard_name : Nppc

name	(CDS detail)
type	STS
link
xref	UniSTS:167298
definition	standard_name : D1Ertd816e

name	(CDS detail)
type	STS
link
xref	UniSTS:210453
definition	standard_name : RH136468

name	(CDS detail)
type	STS
link
xref	UniSTS:178430
definition	standard_name : C77216

name	(CDS detail)
type	STS
link
xref	UniSTS:207187
definition	standard_name : BE199888

name	(CDS detail)
type	STS
link
xref	UniSTS:271950
definition	standard_name : PMC207564P2

name	(CDS detail)
type	STS
link
xref	UniSTS:271949
definition	standard_name : PMC207564P1

name	(CDS detail)
type	STS
link
xref	UniSTS:246003
definition	standard_name : AW527169

name	(CDS detail)
type	STS
link
xref	UniSTS:158824
definition	standard_name : L10076

name	(CDS detail)
type	STS
link
xref	UniSTS:141010
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:128857
definition	standard_name : D1Mit49

name	(CDS detail)
type	STS
link
xref	UniSTS:128880
definition	standard_name : D1Mit51.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128879
definition	standard_name : D1Mit51

name	(CDS detail)
type	STS
link
xref	UniSTS:141009
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:238129
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:141011
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:178431
definition	standard_name : AV129531

name	(CDS detail)
type	STS
link
xref	UniSTS:163257
definition	standard_name : AI036339

name	(CDS detail)
type	STS
link
xref	UniSTS:178429
definition	standard_name : AI452351

name	(CDS detail)
type	STS
link
xref	UniSTS:207188
definition	standard_name : AW822015

name	(CDS detail)
type	STS
link
xref	UniSTS:207189
definition	standard_name : AU024213

name	(CDS detail)
type	STS
link
xref	UniSTS:165993
definition	standard_name : AI852361

name	(CDS detail)
type	STS
link
xref	UniSTS:220713
definition	standard_name : RH138626

name	(CDS detail)
type	STS
link
xref	UniSTS:178428
definition	standard_name : AW259676

name	(CDS detail)
type	STS
link
xref	UniSTS:144630
definition	standard_name : Tims2

name	(CDS detail)
type	STS
link
xref	UniSTS:125527
definition	standard_name : R74947

name	(CDS detail)
type	STS
link
xref	UniSTS:144629
definition	standard_name : Tims2

name	(CDS detail)
type	STS
link
xref	UniSTS:164895
definition	standard_name : Ngef

name	(CDS detail)
type	STS
link
xref	UniSTS:234169
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178427
definition	standard_name : AI323613

name	(CDS detail)
type	STS
link
xref	UniSTS:211834
definition	standard_name : RH128526

name	(CDS detail)
type	STS
link
xref	UniSTS:234167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158821
definition	standard_name : AA960512

name	(CDS detail)
type	STS
link
xref	UniSTS:161592
definition	standard_name : RH124770

name	(CDS detail)
type	STS
link
xref	UniSTS:162566
definition	standard_name : RH125821

name	(CDS detail)
type	STS
link
xref	UniSTS:268029
definition	standard_name : MARC_16423-16424:1018632150:1

name	(CDS detail)
type	STS
link
xref	UniSTS:209981
definition	standard_name : RH135985

name	(CDS detail)
type	STS
link
xref	UniSTS:159352
definition	standard_name : AI035639

name	(CDS detail)
type	STS
link
xref	UniSTS:163169
definition	standard_name : RH126461

name	(CDS detail)
type	STS
link
xref	UniSTS:158822
definition	standard_name : M24086

name	(CDS detail)
type	STS
link
xref	UniSTS:124943
definition	standard_name : M24086

name	(CDS detail)
type	STS
link
xref	UniSTS:498517
definition	standard_name : Dgkd

name	(CDS detail)
type	STS
link
xref	UniSTS:165086
definition	standard_name : AI841987

name	Snord82 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872143 GeneID:80828 MGI:1931502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, C/D box 82 transcript_id : NR_002851.1

clone name	MSMg01-545O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376J03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-157O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-511H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-474H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-135O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E21
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-304J09.b	B6Ng01-304J09.g
ACC	GA098106	GA098107
length	1,157	1,050
definition	B6Ng01-304J09.b	B6Ng01-304J09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(88,733,866 - 88,734,997)	(88,914,574 - 88,915,618)
sequence	gaattccctgcctacttcacttggactgctagggaatattaaatctagtg ctgtatgcgaatcatctaatacaatgccaagtgtgtgatatcagctccat gatgagttactagttacagggttgagtgtgattagcaccaagcttttcat gtacaggcctatgttttgggacacagtctcatagaagtttcttcaagagt gtggaataatgagcatatattgggtgtccctcccactttttacagatgtg gttggctttcatatttcagaagagccaaagcccatgtgtaatctcatcca cagtgtttcagtgcagcactgttggcatctcaggctttctgcctgaggtt aatcttttctcttgggctctgatcttattccttccttcccagggacccct cctttttctaattgagctcacttctaccacaccttcttgacttgtttctt cccatcatcagctaactattcaaagcccctcttatcttaaaaaaataaaa tgttcaaaaccatgtggcaatttctctccctatatagccaccaccctata ttattctactccttcacagctagacttcctgagcctcagtccacaccctc atccccacagtccacatcacactcaatttcccaggcacagcatcctggtt tttctttgttattcattatgattggtctcaccagagttacctgtgtgtga ccttgttactatagccacattgctgaatatgctttccccattcaaatgct ttcaggctttggcttctatgaccagacatcagccgctgctgctgcctcct cctcctcctccttctttcttttcttcttcctctacctctctgaccacacc tcagttttctttggaaacttttcttctgttcctttgcttgaaaattgatg ttctcgtctctcctaatctgaacagtctctgagggaagagccatttgtgt tcattcgtctggttcttcttattataccaggtgacttacatgggactagt ttctagccccaaaattctccttctggaggcaacatatctaattagcagag ccttcaggccttcactaacccccctgagctatgttccctttccacggctt tacctggtgccagtccatggttctcattcttccagtggagccattagaac tcacatg	gaattcctatcccagagaggaaagaggggatctctagtgcaagccggctt gaaagactcgccatactagtgagccctggacgtgatgggagactgtgcct cagagagaaacgtggaaaagcagctgagggtgactgccaagcctctgcat gcacacacccaccaaacatgcaccacacatgtataagcacaggaaaatga aataagaaacaagaattaaaaaattgtcatttgaaaatttgacatttgtt atgtgaaataagttggacctagactgacaaatatattctgtctcatgcat ggaatctagatgaaaaagagagaggagaggagaggaactattttggaagg gccaggggagtgggaacaagacacagtgatgggcatgaccatcgaagtat aagtacacgtgtatagaaagggcaacgcaaatccattatttggtataatt agtacataagtagataggtgtggttgtacatgtgtttggttctagcattt aggatgctgaggcagaaggtttaaagttcagggccatcctgggctacctc ctgagattctgtgtcaaaaggaaacatccccaaacaaagcaaaaaaaaaa aaaaaaaaaaaacaaaacaaaacaaaaaaaaaaacccactgtatagcaga tcaattacaacaacatttaatcacaactatgaccttttgcctcacttctt tctttctagctgaggcagtgtattgattttgtccactaaaaacaaatgaa caaacagaaaaacctacactcttagaaaattttgcatcttctgcctcaat attttaagctatggatttgtggcttagagaaaggtttcacttgccaaaca gtttgcctcagtatcactactgcattgggtaataaggaccagcattggta gcaaaagtcaggaagcatgacaggtccactgcagtccaatgtgggaaagc aggtagccatggtgggggtgggcagaataagcagcctcatacatttgatc gcatgctaaggaaaccacaaaaattagatccaaccaaaagttgggagaga
quality values	Open. Hide. 41 29 22 20 58 58 49 49 58 62 62 62 46 52 62 62 62 37 20 54 62 62 62 62 35 47 62 62 62 54 62 13 16 11 14 18 17 24 21 19 27 22 24 23 23 23 34 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 30 43 20 34 30 30 54 36 43 28 48 46 46 59 59 62 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 59 62 54 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 58 58 58 58 58 58 58 58 58 58 49 54 54 58 58 58 58 58 58 52 45 54 58 58 58 58 58 58 58 58 58 58 58 58 58 52 54 58 54 58 58 52 58 58 58 58 58 58 58 58 58 58 50 58 58 58 54 58 52 58 58 45 41 54 58 58 58 58 58 58 50 58 51 58 58 58 50 58 51 58 58 58 46 51 51 49 58 58 51 51 54 58 58 58 52 58 58 58 58 51 58 37 53 53 58 49 41 58 52 47 58 53 58 51 58 58 58 58 50 58 58 58 51 46 51 58 51 58 46 48 50 51 58 50 53 41 58 53 46 54 53 32 58 58 58 52 58 58 53 52 41 51 52 40 58 32 58 50 26 32 58 50 58 39 46 40 58 50 51 31 21 58 53 52 54 40 50 41 39 40 53 52 54 52 51 49 40 53 42 45 51 53 54 53 51 49 38 37 52 39 51 53 54 54 54 41 54 54 44 40 47 53 42 37 54 52 35 54 32 41 54 33 42 35 25 54 29 54 54 37 41 51 26 46 54 42 31 45 40 40 53 26 37 40 45 54 35 37 42 39 37 33 53 49 51 45 40 53 37 40 52 43 32 52 33 51 36 35 47 26 32 53 31 25 47 21 32 53 41 45 52 32 47 53 51 40 41 32 32 51 51 46 31 22 45 33 30 31 31 51 27 33 30 31 18 40 40 31 32 31 40 31 42 14 37 28 31 27 23 40 45 31 38 28 36 51 51 39 39 36 48 32 30 16 30 47 33 31 31 46 46 31 31 30 33 31 32 42 17 46 29 36 33 46 36 34 31 21 33 35 33 48 46 42 29 27 31 30 21 21 7 46 32 21 26 32 32 32 31 31 25 30 41 32 37 27 29 31 31 20 32 37 34 21 14 31 31 11 20 26 30 32 16 36 15 18 7 7 26 17 26 29 9 5 41 21 31 14 22 13 24 8 15 33 29 33 21 32 31 18 17 17 17 27 25 10 7 21 8 7 11 6 9 10 26 24 24 8 44 7 6 8 30 21 22 13 33 21 20 21 21 27 39 14 32 24 10 21 8 17 48 14 16 7 16 28 14 36 31 13 10 34 31 16 18 6 4 9 4 12 16 6 4 4 5 10 10 6 8 31 31 12 7 6 7 12 26 16 14 10 23 9 10 27 11 9 7 4 7 6 19 14 8 6 5 5 7 18 8 8 13 7 10 17 19 26 17 13 12 3 6 28 28 15 6 7 18 6 15 11 3 4 7 7 7 4 13 11 24 40 15 9 8 6 8 9 8 28 8 18 14 18 8 13 5 4 7 7 12 9 13 8 2 3 4 16 8 20 4 3 6 8 9 2 7 20 14 16 17 6 17 5 7 21 5 4 7 4 9 10 13 8 14 13 11 11 8 24 19 4 6 6 5 6 6 7 9	Open. Hide. 62 35 24 38 62 62 62 62 62 62 62 10 11 7 8 10 8 14 10 15 21 20 18 22 21 39 50 49 49 38 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 24 49 30 29 28 13 25 23 23 36 45 28 23 27 34 35 62 59 62 62 62 62 59 59 62 59 59 62 62 59 59 62 62 62 62 59 59 59 59 62 62 59 59 62 62 62 62 62 46 59 59 59 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 59 54 54 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 49 62 59 62 62 43 45 38 30 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 37 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 41 62 62 62 62 62 42 62 52 52 42 58 44 37 49 48 58 45 41 58 58 58 54 54 54 54 40 58 58 58 58 54 58 58 58 58 58 58 58 58 54 52 48 46 46 44 58 58 58 58 41 42 39 58 54 58 58 54 58 58 52 52 58 58 48 42 58 58 58 47 52 52 58 54 58 58 58 37 58 58 58 52 51 49 49 51 45 41 49 49 58 58 58 51 51 48 47 44 50 48 48 48 50 51 47 29 41 28 50 37 47 47 27 41 34 50 54 35 58 39 50 51 52 50 51 50 50 50 43 15 39 43 23 21 22 20 34 20 27 37 37 27 35 46 27 49 50 46 40 28 50 50 50 46 32 50 42 37 29 42 21 39 47 27 30 35 42 45 24 50 50 40 49 41 26 35 37 37 39 40 49 53 50 40 23 24 44 40 41 22 39 41 49 50 39 46 31 39 38 50 40 47 32 39 35 39 42 37 50 32 50 25 36 26 31 37 18 25 31 24 42 25 44 44 50 35 35 34 53 41 9 36 37 42 54 54 46 28 34 42 49 27 35 52 34 6 28 24 46 24 41 35 19 54 47 46 51 30 31 33 40 31 41 30 34 32 42 46 30 17 7 31 52 41 41 34 52 53 22 34 40 35 32 32 29 26 40 27 14 12 47 26 27 32 33 31 28 20 51 40 9 27 24 30 40 29 31 32 28 31 23 19 40 15 30 24 40 27 19 28 22 20 5 40 26 28 46 16 32 37 27 51 42 42 25 21 14 19 31 21 32 12 47 27 32 38 26 23 42 21 26 30 24 15 8 9 11 14 25 32 27 14 29 30 34 38 20 31 31 26 28 36 14 42 33 31 35 24 17 11 24 8 8 14 9 19 16 19 27 11 27 20 8 20 9 17 18 19 14 31 43 30 31 25 31 21 15 18 12 27 21 24 19 29 30 8 8 14 32 36 14 32 12 14 29 32 31 12 13 6 15 16 26 7 6 8 11 8 11 44 13 16 11 11 8 31 27 25 22 18 33 14 25 17 9 11 15 11 7 25 38 44 41 21 30 33 36 31 32 23 13 14 4 5 15 33 12 13 11 6 13 11 22 17 24 22 13 31 11 23 37 7 16 10 10 20 14 15 8 13 11 31 7 6 28 18 10 13 37 7 31 8 15 27 10 4 30 10 7 3 8 13 6 7 5 8 10 16 10 10 15 19 28 19 11 13 8 11 16 30 10 23 6 15 8 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_88733866_88734997
seq2: B6Ng01-304J09.b_47_1203

seq1  GAATTCCCTGCCTACTTCACTTGGACTGCTAGGGAATATTAAATCTAGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTGCCTACTTCACTTGGACTGCTAGGGAATATTAAATCTAGTG  50

seq1  CTGTATGCGAATCATCTAATACAATGCCAAGTGTGTGATATCAGCTCCAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTATGCGAATCATCTAATACAATGCCAAGTGTGTGATATCAGCTCCAT  100

seq1  GATGAGTTACTAGTTACAGGGTTGAGTGTGATTAGCACCAAGCTTTTCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAGTTACTAGTTACAGGGTTGAGTGTGATTAGCACCAAGCTTTTCAT  150

seq1  GTACAGGCCTATGTTTTGGGACACAGTCTCATAGAAGTTTCTTCAAGAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAGGCCTATGTTTTGGGACACAGTCTCATAGAAGTTTCTTCAAGAGT  200

seq1  GTGGAATAATGAGCATATATTGGGTGTCCCTCCCACTTTTTACAGATGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAATAATGAGCATATATTGGGTGTCCCTCCCACTTTTTACAGATGTG  250

seq1  GTTGGCTTTCATATTTCAGAAGAGCCAAAGCCCATGTGTAATCTCATCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGCTTTCATATTTCAGAAGAGCCAAAGCCCATGTGTAATCTCATCCA  300

seq1  CAGTGTTTCAGTGCAGCACTGTTGGCATCTCAGGCTTTCTGCCTGAGGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTTTCAGTGCAGCACTGTTGGCATCTCAGGCTTTCTGCCTGAGGTT  350

seq1  AATCTTTTCTCTTGGGCTCTGATCTTATTCCTTCCTTCCCAGGGACCCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTTTTCTCTTGGGCTCTGATCTTATTCCTTCCTTCCCAGGGACCCCT  400

seq1  CCTTTTTCTAATTGAGCTCACTTCTACCACACCTTCTTGACTTGTTTCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTTTCTAATTGAGCTCACTTCTACCACACCTTCTTGACTTGTTTCTT  450

seq1  CCCATCATCAGCTAACTATTCAAAGCCCCTCTTATCTTAAAAAAATAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCATCAGCTAACTATTCAAAGCCCCTCTTATCTTAAAAAAATAAAA  500

seq1  TGTTCAAAACCATGTGGCAATTTCTCTCCCTATATAGCCACCACCCTATA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCAAAACCATGTGGCAATTTCTCTCCCTATATAGCCACCACCCTATA  550

seq1  TTATTCTACTCCTTCACAGCTAGACTTCCTGAGCCTCAGTCCACACCCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTCTACTCCTTCACAGCTAGACTTCCTGAGCCTCAGTCCACACCCTC  600

seq1  ATCCCCACAGTCCACATCACACTCAATTTCCCAGGCACAGCATCCTGGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCCACAGTCCACATCACACTCAATTTCCCAGGCACAGCATCCTGGTT  650

seq1  TTTCTTTGTTATTCATTATGATTGGTCTCACCAGAGTTACCTGTGTGTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTGTTATTCATTATGATTGGTCTCACCAGAGTTACCTGTGTGTGA  700

seq1  CCTTGTTACTATAGCCACATTGCTGAATATGCTTTCCCCATTCAAATGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGTTACTATAGCCACATTGCTGAATATGCTTTCCCCATTCAAATGCT  750

seq1  TTCAGGCTTTGGCTTCTATGACCAGACATCAGCCGCTGCTGCTGCCTCCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGCTTTGGCTTCTATGACCAGACATCAGCCGCTGCTGCTGCCTCCT  800

seq1  CCTCCTCCTCCTTCTTTCTTTTCTTCTTCCTCTACCTCTCTGACCACACC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCTCCTTCTTTCTTTTCTTCTTCCTCTACCTCTCTGACCACACC  850

seq1  TCAGTTTTCTTTGGAAACTTTTCTTCTGTTCCTTTGCTTGAAAATTGATG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTTTCTTTGGAAACTTTTCTTCTGTTCCTTTGCTTGAAAATTGATG  900

seq1  TTCTCGTCTCTCCTAATCTGAACAGTCTCTGAGGG-AGAGCCA-TTGTGT  948
      ||||||||||||||||||||||||||||||||||| ||||||| ||||||
seq2  TTCTCGTCTCTCCTAATCTGAACAGTCTCTGAGGGAAGAGCCATTTGTGT  950

seq1  TCATTCGTCTG----TTCTCTATATA-CAAGTGACTTACAT-GGACTAG-  991
      |||||||||||    ||||   |||| || ||||||||||| ||||||| 
seq2  TCATTCGTCTGGTTCTTCTTATTATACCAGGTGACTTACATGGGACTAGT  1000

seq1  TTCTAGCCC---AAATCTTCCTCTTGA-GCAACATATCTAA-TAGCAGAG  1036
      |||||||||   || ||| | ||| || ||||||||||||| ||||||||
seq2  TTCTAGCCCCAAAATTCTCCTTCTGGAGGCAACATATCTAATTAGCAGAG  1050

seq1  CC-TCAAGC--TCACTAACCCCCCTGAGCTTATGT--CCTTT-CACG--C  1078
      || ||| ||  |||||||||||||||||| |||||  ||||| ||||   
seq2  CCTTCAGGCCTTCACTAACCCCCCTGAGC-TATGTTCCCTTTCCACGGCT  1099

seq1  TTACCT-GTGCCAGCCCATTGTTCCTCATTCTT-CAGT-GAG-CATTAGA  1124
      |||||| ||||||| |||| ||| ||||||||| |||| ||| |||||||
seq2  TTACCTGGTGCCAGTCCATGGTT-CTCATTCTTCCAGTGGAGCCATTAGA  1148

seq1  A-TCACATG  1132
      | |||||||
seq2  ACTCACATG  1157

seq1: chr1_88914574_88915618
seq2: B6Ng01-304J09.g_68_1117 (reverse)

seq1  TCTCTCCCAACCTTTTGTT-GATCTATTTTTTTGTGGTTTCCTTAGCATG  49
      ||||||||||| ||| ||| ||||||  ||||||||||||||||||||||
seq2  TCTCTCCCAACTTTTGGTTGGATCTA-ATTTTTGTGGTTTCCTTAGCATG  49

seq1  CGATCAAATGTATGA-GCTGCTTTATCTGCCCA-CCCCACCATGGCTACC  97
      ||||||||||||||| |||||||  |||||||| ||||||||||||||||
seq2  CGATCAAATGTATGAGGCTGCTTATTCTGCCCACCCCCACCATGGCTACC  99

seq1  TGCTCTCCCACA-TGGACTGCAGTGGGACCTGTCATGCTTCCTGACTTTT  146
      |||| ||||||| ||||||||||| |||||||||||||||||||||||||
seq2  TGCTTTCCCACATTGGACTGCAGT-GGACCTGTCATGCTTCCTGACTTTT  148

seq1  GCTACCAATGCTGGT-CTTATTA-CCAATGCAGTAGTGATACTGAGGCAA  194
      ||||||||||||||| ||||||| ||||||||||||||||||||||||||
seq2  GCTACCAATGCTGGTCCTTATTACCCAATGCAGTAGTGATACTGAGGCAA  198

seq1  ACTGTTTGGC-AGTGAAACCTTTCTCTAAGCCACAAATCCATAGCTTAAA  243
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  ACTGTTTGGCAAGTGAAACCTTTCTCTAAGCCACAAATCCATAGCTTAAA  248

seq1  ATATTGAGGCAGAAGATGCAAAATTTTCTAAGAGTGTAGGTTTTTCTGTT  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGAGGCAGAAGATGCAAAATTTTCTAAGAGTGTAGGTTTTTCTGTT  298

seq1  TGTTCATTTGTTTTTAGTGGACAAAATCAATACACTGCCTCAGCTAGAAA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCATTTGTTTTTAGTGGACAAAATCAATACACTGCCTCAGCTAGAAA  348

seq1  GAAAGAAGTGAGGCAAAAGGTCATAGTTGTGATTAAATGTTGTTGTAATT  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAAGTGAGGCAAAAGGTCATAGTTGTGATTAAATGTTGTTGTAATT  398

seq1  GATCTGCTATACAGTGGGTTTTTTTTTTTGTTTTGTTTTGTTTTTTTTTT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTGCTATACAGTGGGTTTTTTTTTTTGTTTTGTTTTGTTTTTTTTTT  448

seq1  TTTTTTTTTTTTGCTTTGTTTGGGGATGTTTCCTTTTGACACAGAATCTC  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTTTTGCTTTGTTTGGGGATGTTTCCTTTTGACACAGAATCTC  498

seq1  AGGAGGTAGCCCAGGATGGCCCTGAACTTTAAACCTTCTGCCTCAGCATC  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGGTAGCCCAGGATGGCCCTGAACTTTAAACCTTCTGCCTCAGCATC  548

seq1  CTAAATGCTAGAACCAAACACATGTACAACCACACCTATCTACTTATGTA  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATGCTAGAACCAAACACATGTACAACCACACCTATCTACTTATGTA  598

seq1  CTAATTATACCAAATAATGGATTTGCGTTGCCCTTTCTATACACGTGTAC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATTATACCAAATAATGGATTTGCGTTGCCCTTTCTATACACGTGTAC  648

seq1  TTATACTTCGATGGTCATGCCCATCACTGTGTCTTGTTCCCACTCCCCTG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATACTTCGATGGTCATGCCCATCACTGTGTCTTGTTCCCACTCCCCTG  698

seq1  GCCCTTCCAAAATAGTTCCTCTCCTCTCCTCTCTCTTTTTCATCTAGATT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTTCCAAAATAGTTCCTCTCCTCTCCTCTCTCTTTTTCATCTAGATT  748

seq1  CCATGCATGAGACAGAATATATTTGTCAGTCTAGGTCCAACTTATTTCAC  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGCATGAGACAGAATATATTTGTCAGTCTAGGTCCAACTTATTTCAC  798

seq1  ATAACAAATGTCAAATTTTCAAATGACAATTTTTTAATTCTTGTTTCTTA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACAAATGTCAAATTTTCAAATGACAATTTTTTAATTCTTGTTTCTTA  848

seq1  TTTCATTTTCCTGTGCTTATACATGTGTGGTGCATGTTTGGTGGGTGTGT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATTTTCCTGTGCTTATACATGTGTGGTGCATGTTTGGTGGGTGTGT  898

seq1  GCATGCAGAGGCTTGGCAGTCACCCTCAGCTGCTTTTCCACGTTTCTCTC  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCAGAGGCTTGGCAGTCACCCTCAGCTGCTTTTCCACGTTTCTCTC  948

seq1  TGAGGCACAGTCTCCCATCACGTCCAGGGCTCACTAGTATGGCGAGTCTT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCACAGTCTCCCATCACGTCCAGGGCTCACTAGTATGGCGAGTCTT  998

seq1  TCAAGCCGGCTTGCACTAGAGATCCCCTCTTTCCTCTCTGGGATAGGAAT  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGCCGGCTTGCACTAGAGATCCCCTCTTTCCTCTCTGGGATAGGAAT  1048

seq1  TC  1045
      ||
seq2  TC  1050

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information