MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-309G05
Chromosome	1 (Build37)
Map Location	21,393,832 - 21,394,998
singlet/doublet	singlet
Overlap gene	Kcnq5
Upstream gene	Pkhd1, Il17a, Il17f, Mcm3, Paqr8, Efhc1, Tram2, LOC100040291, Tmem14a, Gsta3, EG632802, EG241041, LOC100040309, Ndg1, BC099381, LOC100040319, AU024076
Downstream gene	D1Mgi28, LOC435612, LOC100040338, Rims1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pkhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241035 MGI:2155808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il17a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16171 MGI:107364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il17f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257630 MGI:2676631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17215 MGI:101845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paqr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74229 MGI:1921479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efhc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71877 MGI:1919127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 5 Proteins

name	Tram2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170829 MGI:1924817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	Tmem14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75712 MGI:1922962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsta3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14859 MGI:95856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG632802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632802 MGI:3648114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 36 Proteins

name	EG241041 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241041 MGI:3647976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100040309 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Ndg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:368204 MGI:2676610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC099381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433278 MGI:3583007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040319 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	AU024076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98582 MGI:2138477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 100 ESTs, 3 Proteins

name	Kcnq5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226922 MGI:1924937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D1Mgi28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665489 MGI:2138381
definition	gene_synonym : AL022788; AL024247; AU040300 note : DNA Segment, Chr 1, Mouse Genome Informatics 28 pseudo : _no_value

name	LOC435612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Rims1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116837 MGI:2152971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Pkhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157465 GeneID:241035 MGI:2155808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney and hepatic disease 1 transcript_id : NM_153179.3

name	Il17a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367609 GeneID:16171 MGI:107364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17A transcript_id : NM_010552.3

name	Il17f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360345 GeneID:257630 MGI:2676631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17F transcript_id : NM_145856.2

name	Mcm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130774 GeneID:17215 MGI:101845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 3 (S. cerevisiae) transcript_id : NM_008563.2

name	Paqr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254345 GeneID:74229 MGI:1921479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progestin and adipoQ receptor family member VIII transcript_id : NM_028829.3

name	Efhc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233628 GeneID:71877 MGI:1919127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 5 Proteins product : EF-hand domain (C-terminal) containing 1, transcript variant 1 transcript_id : XM_129694.8

name	Tram2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131006 GeneID:170829 MGI:1924817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocating chain-associating membrane protein 2 transcript_id : NM_133252.2

name	Tram2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802928 GeneID:170829 MGI:1924817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocating chain-associating membrane protein 2 transcript_id : NM_177409.3

name	Tmem14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948262 GeneID:75712 MGI:1922962
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 14A transcript_id : NM_029398.2

name	Gsta3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325998 GeneID:14859 MGI:95856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, alpha 3 transcript_id : NM_001077353.1

name	Gsta3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325995 GeneID:14859 MGI:95856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, alpha 3 transcript_id : NM_010356.3

name	EG632802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94362800 GeneID:632802 MGI:3648114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 36 Proteins product : predicted gene, EG632802 transcript_id : XM_978542.1

name	Ndg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34304010 GeneID:368204 MGI:2676610
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nur77 downstream gene 1 transcript_id : NM_183322.1

name	BC099381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76573871 GeneID:433278 MGI:3583007
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC099381 transcript_id : NM_001033904.1

name	Kcnq5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130673 GeneID:226922 MGI:1924937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 5 transcript_id : NM_023872.2

name	Rims1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592785 GeneID:116837 MGI:2152971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulating synaptic membrane exocytosis 1 transcript_id : NM_001012625.1

name	Rims1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592775 GeneID:116837 MGI:2152971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulating synaptic membrane exocytosis 1 transcript_id : NM_001012624.1

name	Rims1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592781 GeneID:116837 MGI:2152971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulating synaptic membrane exocytosis 1 transcript_id : NM_001012623.1

name	Rims1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60460914 GeneID:116837 MGI:2152971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulating synaptic membrane exocytosis 1 transcript_id : NM_183018.2

name	Rims1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57528311 GeneID:116837 MGI:2152971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulating synaptic membrane exocytosis 1 transcript_id : NM_053270.1

name	Pkhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157466 CCDS:CCDS14841.1 GeneID:241035 MGI:2155808
definition	GO_component : GO:0031362 - anchored to external side of plasma membrane [Evidence ISS]; GO:0016324 - apical plasma membrane [Evidence ISS]; GO:0005932 - basal body [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence ISS] GO_process : GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0042592 - homeostasis [Evidence ISS]; GO:0001822 - kidney development [Evidence IDA]; GO:0051271 - negative regulation of cell motility [Evidence IMP] codon_start : 1 note : TIG multiple domains 1; tigmin product : polyductin protein_id : NP_694819.2

name	Il17a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754324 CCDS:CCDS14842.1 GeneID:16171 MGI:107364
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : interleukin 17 protein_id : NP_034682.1

name	Il17f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360346 GeneID:257630 MGI:2676631
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : interleukin 17F protein_id : NP_665855.2

name	Mcm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859484 CCDS:CCDS14843.1 GeneID:17215 MGI:101845
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mini chromosome maintenance deficient product : minichromosome maintenance deficient 3 protein_id : NP_032589.1

name	Paqr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254346 CCDS:CCDS14844.1 GeneID:74229 MGI:1921479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : progestin and adipoQ receptor family member VIII protein_id : NP_083105.3

name	Efhc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233629 GeneID:71877 MGI:1919127
definition	codon_start : 1 product : EF-hand domain (C-terminal) containing 1 isoform 1 protein_id : XP_129694.7

name	Tram2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875432 CCDS:CCDS14846.1 GeneID:170829 MGI:1924817
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocating chain-associating membrane protein 2 protein_id : NP_573515.1

name	Tram2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916683 CCDS:CCDS14846.1 GeneID:170829 MGI:1924817
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocating chain-associating membrane protein 2 protein_id : NP_803128.1

name	Tmem14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948263 GeneID:75712 MGI:1922962
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : transmembrane protein 14A protein_id : NP_083674.2

name	Gsta3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116325999 GeneID:14859 MGI:95856
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : glutathione S-transferase, alpha 3 protein_id : NP_001070821.1

name	Gsta3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981724 CCDS:CCDS14847.1 GeneID:14859 MGI:95856
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : glutathione S-transferase, alpha 3 protein_id : NP_034486.2

name	EG632802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94362801 GeneID:632802 MGI:3648114
definition	codon_start : 1 product : similar to centrin 4 protein_id : XP_983636.1

name	Ndg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304011 CCDS:CCDS14848.1 GeneID:368204 MGI:2676610
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0006919 - caspase activation [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Nur77 downstream protein 1 product : Nur77 downstream gene 1 protein_id : NP_899145.1

name	BC099381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76573872 GeneID:433278 MGI:3583007
definition	codon_start : 1 product : hypothetical protein LOC433278 protein_id : NP_001029076.1

name	Kcnq5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68534949 GeneID:226922 MGI:1924937
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage-gated channel, subfamily Q, member 5 protein_id : NP_076361.1

name	Rims1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60592786 GeneID:116837 MGI:2152971
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 5 is encoded by transcript variant 5; Rab3 effector; Rab3 interacting protein 1; Rim1delta56-105; Rim1delta83-105; synaptic exocytosis regulator 1 product : regulating synaptic membrane exocytosis 1 isoform 5 protein_id : NP_001012643.1

name	Rims1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60592776 GeneID:116837 MGI:2152971
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 4 is encoded by transcript variant 4; Rab3 effector; Rab3 interacting protein 1; Rim1delta56-105; Rim1delta83-105; synaptic exocytosis regulator 1 product : regulating synaptic membrane exocytosis 1 isoform 4 protein_id : NP_001012642.1

name	Rims1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60592782 GeneID:116837 MGI:2152971
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 3 is encoded by transcript variant 3; Rab3 effector; Rab3 interacting protein 1; Rim1delta56-105; Rim1delta83-105; synaptic exocytosis regulator 1 product : regulating synaptic membrane exocytosis 1 isoform 3 protein_id : NP_001012641.1

name	Rims1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60460915 GeneID:116837 MGI:2152971
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 2 is encoded by transcript variant 2; Rab3 effector; Rab3 interacting protein 1; Rim1delta56-105; Rim1delta83-105; synaptic exocytosis regulator 1 product : regulating synaptic membrane exocytosis 1 isoform 2 protein_id : NP_898839.2

name	Rims1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57528312 GeneID:116837 MGI:2152971
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; Rab3 effector; Rab3 interacting protein 1; Rim1delta56-105; Rim1delta83-105; synaptic exocytosis regulator 1 product : regulating synaptic membrane exocytosis 1 isoform 1 protein_id : NP_444500.1

name	LOC100040309 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040309
definition	number : 6 pseudo : _no_value

name	LOC100040309 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040309
definition	number : 5 pseudo : _no_value

name	LOC100040309 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040309
definition	number : 4 pseudo : _no_value

name	LOC100040309 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040309
definition	number : 3 pseudo : _no_value

name	LOC100040309 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040309
definition	number : 2 pseudo : _no_value

name	LOC100040309 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040309
definition	number : 1 pseudo : _no_value

name	LOC100040319 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040319
definition	number : 1 pseudo : _no_value

name	LOC100040319 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040319
definition	number : 2 pseudo : _no_value

name	LOC100040319 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040319
definition	number : 3 pseudo : _no_value

name	LOC100040319 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040319
definition	number : 4 pseudo : _no_value

name	LOC435612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435612
definition	number : 1 pseudo : _no_value

name	LOC100040338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040338
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:123282
definition	standard_name : 15.MMHAP97FRE9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128887
definition	standard_name : D1Mit52

name	(CDS detail)
type	STS
link
xref	UniSTS:128888
definition	standard_name : D1Mit52.2

name	(CDS detail)
type	STS
link
xref	UniSTS:128626
definition	standard_name : D1Mit276

name	(CDS detail)
type	STS
link
xref	UniSTS:125623
definition	standard_name : Results_ER_9_6_95_92.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:124008
definition	standard_name : 32.MMHAP90FLC5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:224808
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207135
definition	standard_name : C87042

name	(CDS detail)
type	STS
link
xref	UniSTS:207136
definition	standard_name : RH126856

name	(CDS detail)
type	STS
link
xref	UniSTS:163244
definition	standard_name : X62154

name	(CDS detail)
type	STS
link
xref	UniSTS:128576
definition	standard_name : D1Mit231

name	(CDS detail)
type	STS
link
xref	UniSTS:123112
definition	standard_name : 12.MMHAP31FLD3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128761
definition	standard_name : D1Mit4

name	(CDS detail)
type	STS
link
xref	UniSTS:128732
definition	standard_name : D1Mit372

name	(CDS detail)
type	STS
link
xref	UniSTS:207133
definition	standard_name : RH127230

name	(CDS detail)
type	STS
link
xref	UniSTS:128732
definition	standard_name : D1Mit372

name	(CDS detail)
type	STS
link
xref	UniSTS:234078
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488652
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207132
definition	standard_name : AU015226

name	(CDS detail)
type	STS
link
xref	UniSTS:234078
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488652
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207134
definition	standard_name : AU014713

name	(CDS detail)
type	STS
link
xref	UniSTS:207132
definition	standard_name : AU015226

name	(CDS detail)
type	STS
link
xref	UniSTS:207138
definition	standard_name : RH127167

name	(CDS detail)
type	STS
link
xref	UniSTS:207137
definition	standard_name : C86372

name	(CDS detail)
type	STS
link
xref	UniSTS:185433
definition	standard_name : AU024076

name	(CDS detail)
type	STS
link
xref	UniSTS:128675
definition	standard_name : D1Mit317

name	(CDS detail)
type	STS
link
xref	UniSTS:124569
definition	standard_name : 45.MMHAP22FRG12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158778
definition	standard_name : AU040300

name	(CDS detail)
type	STS
link
xref	UniSTS:161771
definition	standard_name : RH124949

name	(CDS detail)
type	STS
link
xref	UniSTS:162327
definition	standard_name : RH125509

name	(CDS detail)
type	STS
link
xref	UniSTS:234079
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207139
definition	standard_name : RH127017

name	(CDS detail)
type	STS
link
xref	UniSTS:123866
definition	standard_name : 29.MMHAP53FLB5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125605
definition	standard_name : Results_ER_9_5_95_33.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:167261
definition	standard_name : D1Ertd228e

name	LOC100040291 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149233630 GeneID:100040291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to glutathione S-transferase Yc subunit pseudo : _no_value transcript_id : XR_031749.1

name	EG241041 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872149 GeneID:241041 MGI:3647976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG241041 pseudo : _no_value transcript_id : NR_002858.1

name	AU024076 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149233632 GeneID:98582 MGI:2138477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 100 ESTs, 3 Proteins product : expressed sequence AU024076 transcript_id : XR_031927.1

clone name	MSMg01-260C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-280F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-535L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-192M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535P23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-339D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025B06
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-309G05.b	B6Ng01-309G05.g
ACC	GA101642	GA101643
length	1,186	1,152
definition	B6Ng01-309G05.b	B6Ng01-309G05.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctgcactaaacccatcaggtcctgtgctttttttgcttggaagac gattaatgactgcatctatttctttaggaaatatgggatagtttagatca ttaatctgatcctgatttaactttggtacctggtatctgtctagaaattt gtccatttcatccaggttttccagttttgttgagtatagccttttgtagt aggatctgatgatgctttggatttcctcaggttctgttgttatgtctccc ttttcatttctgattttgttaattgggataatgtacttgtgccctctagt tagtctggctaagggtttatctatcttcttgatttaaaacaaaacaaaac aaaacaaaacaaaacaaaacaaaacaaaacaaaacaaaacaaaacaaaac agatcctggcttggttgtttctttgaatagttctttttgtttccacttgg ttgatttcagccctgagtttgattatttcctgccttctactcctcttggt ggaatttgcttccttttgttctagagcttttagttatgctgtcaagctct gtctagtttctttttggccatcctcagagctatgagttttcctcttagga atgctttcattgtgtcccataagtttgggtatgttgtggcttcattttca ttaaattttaaaatactttaatttcttttgttatttcttccttgaccaag ttatcatttagtagagtgttgttcaacttcgatgtgaatgttggctttga attatttctgttgttattgaagatcagccttagcccgtggtgatctgata ggatgcatgggataatttcaatatttttgtatcttttgaggcctgttata tggtcagttttggaaaaggtaccatgagttgctgagagaacgtatatcct tttgttttaggataaaatgttgtgtagatatctattaaatccattcgttt cataacttctgtttgtttcaatgtgtctctgttagtttctgtttccagga ttctgttccatttgatggagagttgggatgttgaagtcacccccacctat tatttgtgtggaagggtgcaaatgggttgcttaaagctaactgtacctta actgggaatggaatgtggatggccttccattgagcactaattcgaattga gctcattctgaagatttacccttgattgagacttga	gaattccattgagaagactctttgagaagatacagtatcagggttaacaa ataaccaatgtttgccacagttatggtggagattttaaaatcttgtttta aatgaaggaaactaaaggagacactatgaaaataaaatatggctgacttt tgctgtttttaacctttgaaattctttagttgctttcagataattattaa ctgacaagataaaaatttctttttttttcttttttttttttgtctttttc tttctttcttttttttccgagacagggtttttctgtatagccctggctgt cctggaactcgctttgtcgaccaggctggcctcgaactcagaagtccacc tacctctgcctgggagtaaaggcgtgcgccaccaccacccggctaagata aaagtttctttctttttcttttttttagaacctttgctctctctggtcca ctctgtccgccatgtcccgaagatttatttattattgtacataagtacac tgtagctgagtccagatgcaccagaagagggagtctgatctcattatgga ttgttgctgtgatttgaactcaggacctttggaagagcagtcagtgctct taactgctgagccatctcgccagcccaagataaaagtggcaatcctaagg tgttttaaagaacattgtctattcataaggcaattagatactctccattt cattcttaaaacatatactgatcattaggaggccaggcatggtgacacag gcctttaatcccagcaccagggaggcagaggaaggcgaatctctgttagt tcaaggccagcctagtctactgagtgagttccaagacagccagagctctg tagagagacgctgtctcaaaaaacaaacaagattaagttcaggagtggag agagagctcagttaagggcactaaataagggactagagtgtgatacccag caccacagctgggcatggcaagctcacaccgattcacaactccagtctag gagatcaacagcttcttctgacctgggcactaaggtccgagcacagaatg tatatgcaggactaaacttcacaccataaataaacgttaacgattagcat gaaattacacctgaatgctatcttgctgatgaatgaattcaagctgaaag tg
quality values	Open. Hide. 46 31 32 35 62 62 47 41 52 46 47 62 62 62 62 62 62 47 42 62 41 47 62 62 62 62 62 54 62 62 59 56 46 38 34 46 59 62 62 59 59 62 62 62 62 59 62 62 59 36 62 59 59 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 58 51 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 52 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 45 37 54 52 58 54 58 58 54 54 50 58 54 58 58 54 54 58 54 39 58 58 54 54 52 39 58 54 58 58 54 42 58 58 54 37 58 48 58 58 58 49 52 58 58 58 53 58 54 49 58 54 51 51 51 58 53 58 58 58 58 58 58 50 52 49 58 50 58 54 53 58 54 50 43 49 52 34 51 58 58 40 40 42 41 50 50 58 49 40 58 58 50 50 58 58 50 53 53 54 51 58 50 52 52 49 58 51 53 50 58 58 58 51 32 51 50 52 58 54 53 53 50 43 50 51 50 46 29 24 50 35 54 37 58 52 39 41 50 50 54 58 50 52 30 51 49 37 54 31 50 54 32 39 38 33 37 42 43 53 49 54 54 40 37 49 39 49 44 49 53 54 35 54 32 38 54 40 39 37 54 52 40 53 45 40 45 42 35 54 45 45 47 51 32 45 54 37 37 37 32 54 47 52 53 34 34 31 37 37 24 40 47 47 29 42 31 47 46 40 32 31 47 40 32 53 27 18 32 34 53 45 40 31 12 52 31 25 45 32 31 33 51 51 31 33 26 32 32 24 51 42 33 17 51 32 26 15 51 51 51 45 41 29 34 34 36 33 47 51 43 31 42 32 32 13 25 29 42 28 41 31 30 30 32 42 46 26 31 31 33 38 48 48 31 32 36 32 46 46 39 30 32 22 31 23 31 30 32 26 32 18 25 32 30 31 31 23 36 13 32 9 16 8 4 8 17 31 30 31 31 36 34 37 44 43 29 31 22 44 44 30 17 17 6 31 13 25 41 44 36 25 38 11 25 31 19 38 27 34 19 33 15 17 21 34 32 34 20 19 26 47 31 32 29 33 21 14 18 33 19 24 43 19 22 23 31 20 23 28 33 32 34 19 29 13 34 25 9 12 33 21 28 13 9 13 29 17 22 15 12 8 17 16 8 11 8 12 6 21 34 12 21 12 29 10 38 27 6 15 21 18 18 7 10 9 5 5 6 5 8 10 14 6 9 29 12 12 27 22 20 5 5 5 16 11 9 8 28 40 6 5 10 18 6 18 12 16 13 9 14 23 5 5 14 27 14 18 9 16 20 16 8 18 3 4 12 18 6 7 5 6 7 8 10 15 7 17 18 8 4 10 20 10 22 14 8 19 14 6 5 4 2 5 2 4 2 15 10 4 2 3 1 2 2 1 4 4 5 8 6 8 7 2 5 10 5 7 11 4 21 19 6 8 7 14 19 4 6 8 20 5 21 6 5 6 16 5 3 2 4 8 4 7 3 3 3 7 4 4 6 4 6 3 2 2 8 4 12 3 5 9 5 17 1 1 2 5 5 4 7 5 10 3 3 4 5 13 11 6 13 4 22 7 9 3 2 5 4 6 13 11 5 11 2 1 2 7 6 4	Open. Hide. 62 47 44 44 62 62 44 43 62 62 59 46 32 37 46 45 54 38 62 62 62 62 62 62 59 59 59 62 62 59 49 62 62 59 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 48 54 54 43 54 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 49 49 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 59 62 56 54 43 62 62 59 59 59 54 56 59 59 56 54 56 56 54 62 62 62 62 62 62 59 59 62 28 56 34 31 36 34 38 62 62 54 62 62 59 59 56 32 38 50 50 56 59 56 59 62 54 62 62 62 48 48 56 51 50 54 56 62 59 62 59 59 56 59 51 59 59 59 59 59 56 59 46 59 59 59 51 51 62 59 59 62 62 51 56 56 59 39 62 62 59 59 59 51 49 62 56 56 59 59 59 56 59 56 43 59 59 56 46 56 59 62 59 59 59 62 62 56 59 43 50 50 56 62 56 59 43 50 51 59 59 51 59 59 45 56 56 45 56 43 50 59 62 49 56 49 46 59 59 59 38 59 56 51 59 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 51 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 46 56 56 56 56 62 62 62 56 62 56 56 62 56 62 62 56 56 62 56 56 56 56 62 62 62 38 47 39 56 56 56 62 62 62 56 62 62 62 54 54 62 52 52 52 43 62 54 62 52 62 62 62 48 62 52 62 52 47 35 52 62 52 62 24 47 47 37 36 47 58 54 54 54 42 45 52 52 34 58 43 22 54 33 46 46 52 52 43 41 52 58 58 40 54 52 54 52 54 44 52 52 54 52 42 39 52 58 52 52 52 52 54 58 53 54 45 30 52 54 54 58 58 54 54 54 46 25 47 45 34 50 51 51 48 51 49 58 51 35 54 21 47 47 35 50 51 47 47 52 58 51 49 52 53 41 37 54 48 58 58 37 49 54 53 40 54 48 35 48 58 53 58 49 49 54 32 53 58 58 42 35 54 40 38 27 54 58 58 54 50 49 58 28 42 36 40 50 50 42 50 37 42 18 49 26 50 40 58 58 40 37 51 51 40 51 51 37 32 33 50 49 32 53 37 38 50 58 39 29 52 41 43 15 49 9 40 49 38 50 39 47 53 53 39 49 39 54 52 53 52 32 51 54 54 40 29 53 52 45 32 39 39 54 54 32 33 38 45 33 40 37 42 35 52 39 45 34 31 37 54 37 14 38 39 13 54 21 47 37 42 46 37 34 39 41 53 40 52 30 25 28 32 35 25 48 30 53 45 53 51 23 31 32 34 47 27 22 32 42 29 15 22 17 24 51 47 41 25 31 18 31 26 19 7 40 33 37 19 46 13 14 31 40 31 34 34 42 31 42 34 41 33 27 41 31 29 37 31 51 44 23 31 26 39 42 35 32 37 17 26 30 28 31 30 14 25 31 32 32 34 43 28 36 33 31 30 11 31 26 37 28 32 36 33 28 21 33 42 28 31 31 31 31 30 27 33 26 33 22 39 23 30 23 11 29 31 31 32 32 30 32 17 48 46 46 46 23 20 31 41 31 31 25 30 18 32 24 31 23 22 8 13 38 21 7 5 9 5 8 5 11 31 33 18 31 13 25 11 31 17 32 32 27 11 34 11 25 10 30 16 47 24 12 16 20 21 22 39 6 14 10 33 7 34 11 17 29 34 7 11 5 6 15 17 6 14 32 22 26 22 39 24 23 21 34 33 34 29 9 10 6 15 32 28 32 48 26 6 20 24 24 21 6 4 12 7 28 11 11 13 15 7 11 23 16 23 15 15 13 11 19 12 19 16 22 11 19 5 5 4 3 9 16 24 11 28 10 20 18 30 11 27 27 24 20 27 27 12 28 10 14 8 12 24 9 5 3 3 3 25 18 12 16 7 9 11 14 5 5 28 5 13 10 16 8 19 4 6 5 6 7 12 16 13 13 5 8 4 4 6 12 7 6 5 19 11 3 15 26 5 4 1 4 12 5 5 3 3 4 6 18 8 7 3 2 3 7 3 1 1 3 17 3 3 2 4 4 11 12 7 11 10 5 4 7 8 15 4 2 3 7 5 4 6 10 6 8 12 2 2 2 3 1 2 1 2 2 8 6 14 2 5 7 5 5 5 23 5 7 8 15 8 5 15 4 4 1 5 6 3 12 28 11 1 2 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_21393832_21394998
seq2: B6Ng01-309G05.g_65_1216

seq1  GAATTCCATTGAGAAGACTCTTTGAGAAGATACAGTATCAGGGTTAACAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATTGAGAAGACTCTTTGAGAAGATACAGTATCAGGGTTAACAA  50

seq1  ATAACCAATGTTTGCCACAGTTATGGTGGAGATTTTAAAATCTTGTTTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACCAATGTTTGCCACAGTTATGGTGGAGATTTTAAAATCTTGTTTTA  100

seq1  AATGAAGGAAACTAAAGGAGACACTATGAAAATAAAATATGGCTGACTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGGAAACTAAAGGAGACACTATGAAAATAAAATATGGCTGACTTT  150

seq1  TGCTGTTTTTAACCTTTGAAATTCTTTAGTTGCTTTCAGATAATTATTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTTTTTAACCTTTGAAATTCTTTAGTTGCTTTCAGATAATTATTAA  200

seq1  CTGACAAGATAAAAATTTCTTTTTTTTTCTTTTTTTTTTTTGTCTTTTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAAGATAAAAATTTCTTTTTTTTTCTTTTTTTTTTTTGTCTTTTTC  250

seq1  TTTCTTTCTTTTTTTTCCGAGACAGGGTTTTTCTGTATAGCCCTGGCTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTCTTTTTTTTCCGAGACAGGGTTTTTCTGTATAGCCCTGGCTGT  300

seq1  CCTGGAACTCGCTTTGTCGACCAGGCTGGCCTCGAACTCAGAAGTCCACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAACTCGCTTTGTCGACCAGGCTGGCCTCGAACTCAGAAGTCCACC  350

seq1  TACCTCTGCCTGGGAGTAAAGGCGTGCGCCACCACCACCCGGCTAAGATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTCTGCCTGGGAGTAAAGGCGTGCGCCACCACCACCCGGCTAAGATA  400

seq1  AAAGTTTCTTTCTTTTTCTTTTTTTTAGAACCTTTGCTCTCTCTGGTCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTTCTTTCTTTTTCTTTTTTTTAGAACCTTTGCTCTCTCTGGTCCA  450

seq1  CTCTGTCCGCCATGTCCCGAAGATTTATTTATTATTGTACATAAGTACAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTCCGCCATGTCCCGAAGATTTATTTATTATTGTACATAAGTACAC  500

seq1  TGTAGCTGAGTCCAGATGCACCAGAAGAGGGAGTCTGATCTCATTATGGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGCTGAGTCCAGATGCACCAGAAGAGGGAGTCTGATCTCATTATGGA  550

seq1  TTGTTGCTGTGATTTGAACTCAGGACCTTTGGAAGAGCAGTCAGTGCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGCTGTGATTTGAACTCAGGACCTTTGGAAGAGCAGTCAGTGCTCT  600

seq1  TAACTGCTGAGCCATCTCGCCAGCCCAAGATAAAAGTGGCAATCCTAAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTGCTGAGCCATCTCGCCAGCCCAAGATAAAAGTGGCAATCCTAAGG  650

seq1  TGTTTTAAAGAACATTGTCTATTCATAAGGCAATTAGATACTCTCCATTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTAAAGAACATTGTCTATTCATAAGGCAATTAGATACTCTCCATTT  700

seq1  CATTCTTAAAACATATACTGATCATTAGGAGGCCAGGCATGGTGACACAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTTAAAACATATACTGATCATTAGGAGGCCAGGCATGGTGACACAG  750

seq1  GCCTTTAATCCCAGCACCAGGGAGGCAGAGGAAGGCGAATCTCTGTTAGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTTAATCCCAGCACCAGGGAGGCAGAGGAAGGCGAATCTCTGTTAGT  800

seq1  TCAAGGCCAGCCTAGTCTACTGAGTGAGTTCCAAGACAGCCAGAGCTCTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGCCAGCCTAGTCTACTGAGTGAGTTCCAAGACAGCCAGAGCTCTG  850

seq1  TAGAGAGACGCTGTCTCAAAAAACAAACAAGATTAAGTTCAGGAGGTGGA  900
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TAGAGAGACGCTGTCTCAAAAAACAAACAAGATTAAGTTCAGGA-GTGGA  899

seq1  GAGAGAGCTCAGGTTAAGGGCACT-AATAA-GGACTAGGAGTGTGATACC  948
      ||||||||||| |||||||||||| ||||| |||||| ||||||||||||
seq2  GAGAGAGCTCA-GTTAAGGGCACTAAATAAGGGACTA-GAGTGTGATACC  947

seq1  CAGCACCCACAGCTGGGCATGGC-AGCTCACACCGATTCACAACTCCAGT  997
      ||||| ||||||||||||||||| ||||||||||||||||||||||||| 
seq2  CAGCA-CCACAGCTGGGCATGGCAAGCTCACACCGATTCACAACTCCAG-  995

seq1  TCTAGGAGATCCAACAGCTTCTTCTGACCTTGGGCACTAAAGTTCGAGCA  1047
      |||||||||| |||||||||||||||||| |||||||||| || ||||||
seq2  TCTAGGAGAT-CAACAGCTTCTTCTGACC-TGGGCACTAAGGTCCGAGCA  1043

seq1  CAG-ATGTATATGCA-GACCAAACACTCACACACATAAAATAAAATTTAA  1095
      ||| ||||||||||| ||| ||||  |||||| ||| |||||||  ||  
seq2  CAGAATGTATATGCAGGACTAAAC-TTCACAC-CAT-AAATAAACGTT--  1088

seq1  AACGATTAGCATGAATATTAACACTGAAGTTGCAGATACTCTGCCTTGAT  1145
      ||||||||||||||| ||||   |||||  |||   ||   |||  ||||
seq2  AACGATTAGCATGAA-ATTACACCTGAA--TGC---TATCTTGC--TGAT  1130

seq1  GAATGAATCCCAGCTGAAAGTG  1167
      |||||||| | |||||||||||
seq2  GAATGAATTCAAGCTGAAAGTG  1152

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information