MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-320B05
Chromosome	1 (Build37)
Map Location	181,519,857 - 181,689,766
singlet/doublet	doublet
Overlap gene	9630058J23Rik, Sccpdh, Gm1305, Ahctf1
Upstream gene	D230039L06Rik, Kif26b, Smyd3, LOC666354, LOC433941, Tfb2m, LOC100040874
Downstream gene	LOC100040914, LOC100042190, Cdc42bpa, Cabc1, Psen2, EG277333, Itpkb, 6330403A02Rik, Gm821, Parp1, Lin9, Mixl1, LOC666431, Acbd3
Link	Open Mouse BAC browser

Click to get alignment info.

name	D230039L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240945 MGI:3045335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif26b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269152 MGI:2447076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69726 MGI:1916976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC433941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 540 ESTs, 4 Proteins

name	Tfb2m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15278 MGI:107937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	9630058J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226744 MGI:2445141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sccpdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109232 MGI:1924486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383592 MGI:2686151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Ahctf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226747 MGI:1915033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100042190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 10 Proteins pseudo : _no_value

name	Cdc42bpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 122 ESTs, 12 Proteins

name	Cabc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67426 MGI:1914676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psen2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19165 MGI:109284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG277333 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277333 MGI:3644516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Itpkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320404 MGI:109235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330403A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381310 MGI:2138735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329305 MGI:2685667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Parp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11545 MGI:1340806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lin9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72568 MGI:1919818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mixl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27217 MGI:1351322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 84 ESTs, 2 Proteins pseudo : _no_value

name	Acbd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170760 MGI:2181074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230039L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803292 GeneID:240945 MGI:3045335
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230039L06 gene transcript_id : NM_177724.3

name	Kif26b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328422 GeneID:269152 MGI:2447076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 26B transcript_id : NM_177757.3

name	Smyd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130353 GeneID:69726 MGI:1916976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 3 transcript_id : NM_027188.3

name	LOC433941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245445 GeneID:433941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 540 ESTs, 4 Proteins product : similar to ribosomal protein transcript_id : XM_001478364.1

name	Tfb2m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378778 GeneID:15278 MGI:107937
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor B2, mitochondrial transcript_id : NM_008249.3

name	LOC100040874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245384 GeneID:100040874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040874 transcript_id : XM_001475424.1

name	9630058J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328475 GeneID:226744 MGI:2445141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630058J23 gene transcript_id : NM_146105.3

name	Sccpdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382199 GeneID:109232 MGI:1924486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : saccharopine dehydrogenase (putative) transcript_id : NM_178653.3

name	Gm1305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245388 GeneID:383592 MGI:2686151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : gene model 1305, (NCBI) transcript_id : XM_357140.6

name	Ahctf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006852 GeneID:226747 MGI:1915033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT hook containing transcription factor 1 transcript_id : NM_026375.1

name	LOC100040914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245392 GeneID:100040914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040914 transcript_id : XM_001475479.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364568 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 116 ESTs, 8 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 16 transcript_id : XM_991276.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364570 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 108 ESTs, 8 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 14 transcript_id : XM_991198.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364572 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 110 ESTs, 10 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 15 transcript_id : XM_991226.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364574 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 105 ESTs, 10 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 13 transcript_id : XM_991179.1

name	Cabc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778881 GeneID:67426 MGI:1914676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperone, ABC1 activity of bc1 complex like (S. pombe) transcript_id : NM_023341.2

name	Psen2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755187 GeneID:19165 MGI:109284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : presenilin 2 transcript_id : NM_011183.1

name	Itpkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487166 GeneID:320404 MGI:109235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase B transcript_id : NM_001081175.1

name	6330403A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487002 GeneID:381310 MGI:2138735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330403A02 gene transcript_id : NM_001081227.1

name	Gm821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364582 GeneID:329305 MGI:2685667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 821, (NCBI) transcript_id : XM_287066.3

name	Parp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20806108 GeneID:11545 MGI:1340806
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 1 transcript_id : NM_007415.2

name	Lin9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347560 GeneID:72568 MGI:1919818
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lin-9 homolog (C. elegans) transcript_id : NM_175186.3

name	Mixl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543252 GeneID:27217 MGI:1351322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mix1 homeobox-like 1 (Xenopus laevis) transcript_id : NM_013729.2

name	Acbd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364602 GeneID:170760 MGI:2181074
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 3 transcript_id : NM_133225.2

name	D230039L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244198 CCDS:CCDS15558.1 GeneID:240945 MGI:3045335
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC240945 protein_id : NP_808392.1

name	Kif26b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328423 CCDS:CCDS15559.1 GeneID:269152 MGI:2447076
definition	codon_start : 1 exception : mismatches in translation note : N-11 kinesin product : kinesin family member 26B protein_id : NP_808425.2

name	Smyd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312378 CCDS:CCDS15560.1 GeneID:69726 MGI:1916976
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 note : zinc finger, MYND domain containing 1 product : SET and MYND domain containing 3 protein_id : NP_081464.1

name	LOC433941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245446 GeneID:433941
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_001478414.1

name	Tfb2m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490373 CCDS:CCDS15561.1 GeneID:15278 MGI:107937
definition	codon_start : 1 note : house-keeping protein 1 product : transcription factor B2, mitochondrial protein_id : NP_032275.2

name	LOC100040874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245385 GeneID:100040874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475474.1

name	9630058J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559922 CCDS:CCDS15562.1 GeneID:226744 MGI:2445141
definition	codon_start : 1 product : hypothetical protein LOC226744 protein_id : NP_666217.2

name	Sccpdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520019 CCDS:CCDS15563.1 GeneID:109232 MGI:1924486
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0047131 - saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity [Evidence IEA] codon_start : 1 product : saccharopine dehydrogenase (putative) protein_id : NP_848768.1

name	Gm1305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245389 GeneID:383592 MGI:2686151
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357140.6

name	Ahctf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006853 CCDS:CCDS15564.1 GeneID:226747 MGI:1915033
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : embryonic large molecule derived from yolk sac; putative transcription factor; AT hook containing transciption factor 1 product : transcription factor ELYS protein_id : NP_080651.1

name	LOC100040914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245393 GeneID:100040914
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475529.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364569 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 16 protein_id : XP_996370.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364571 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 14 protein_id : XP_996292.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364573 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 15 protein_id : XP_996320.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364575 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 13 protein_id : XP_996273.1

name	Cabc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778882 CCDS:CCDS15566.1 GeneID:67426 MGI:1914676
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : chaperone, ABC1 activity of bc1 complex like protein_id : NP_075830.2

name	Psen2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755188 CCDS:CCDS15567.1 GeneID:19165 MGI:109284
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence ISS]; GO:0042640 - anagen [Evidence IGI]; GO:0001708 - cell fate specification [Evidence IGI]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0007220 - Notch receptor processing [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IGI]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS]; GO:0016485 - protein processing [Evidence ISS]; GO:0051605 - proteolysis during protein maturation [Evidence IGI] codon_start : 1 exception : mismatches in translation product : presenilin 2 protein_id : NP_035313.1

name	Itpkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487167 GeneID:320404 MGI:109235
definition	GO_function : GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IDA] [Evidence IEA] [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IMP]; GO:0046638 - positive regulation of alpha-beta T cell differentiation [Evidence IMP]; GO:0046579 - positive regulation of Ras protein signal transduction [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0030217 - T cell differentiation [Evidence IMP]; GO:0045061 - thymic T cell selection [Evidence IMP] codon_start : 1 product : inositol 1,4,5-trisphosphate 3-kinase B protein_id : NP_001074644.1

name	6330403A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487003 GeneID:381310 MGI:2138735
definition	codon_start : 1 product : hypothetical protein LOC381310 protein_id : NP_001074696.1

name	Gm821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28483679 GeneID:329305 MGI:2685667
definition	codon_start : 1 product : hypothetical protein protein_id : XP_287066.1

name	Parp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806109 CCDS:CCDS15569.1 GeneID:11545 MGI:1340806
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IMP]; GO:0006259 - DNA metabolism [Evidence IMP]; GO:0006281 - DNA repair [Evidence TAS]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA]; GO:0040009 - regulation of growth rate [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IMP] codon_start : 1 note : ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) 1; ADP-ribosyltransferase (NAD+, poly (ADP-ribose) polymerase) 1 product : poly (ADP-ribose) polymerase family, member 1 protein_id : NP_031441.2

name	Lin9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424802 CCDS:CCDS15570.1 GeneID:72568 MGI:1919818
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : type I interferon receptor beta chain-associated protein_id : NP_780395.1

name	Mixl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305269 CCDS:CCDS15571.1 GeneID:27217 MGI:1351322
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007492 - endoderm development [Evidence IMP]; GO:0007369 - gastrulation [Evidence IMP]; GO:0048565 - gut development [Evidence IMP]; GO:0007507 - heart development [Evidence IMP] codon_start : 1 note : mouse Mix-like product : Mix1 homeobox-like 1 protein_id : NP_038757.1

name	Acbd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469029 CCDS:CCDS15572.1 GeneID:170760 MGI:2181074
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PBR associated protein; peripherial benzodiazepine receptor associated protein; golgi complex associated protein 1, 60 kDa product : acyl-Coenzyme A binding domain containing 3 protein_id : NP_573488.1

name	LOC666354 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666354
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:128767
definition	standard_name : D1Mit405

name	(CDS detail)
type	STS
link
xref	UniSTS:128674
definition	standard_name : D1Mit315

name	(CDS detail)
type	STS
link
xref	UniSTS:110016
definition	standard_name : AU047954

name	(CDS detail)
type	STS
link
xref	UniSTS:234276
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234157
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167290
definition	standard_name : D1Ertd704e

name	(CDS detail)
type	STS
link
xref	UniSTS:124622
definition	standard_name : 46.MMHAP31FLH4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:143348
definition	standard_name : Hkp1

name	(CDS detail)
type	STS
link
xref	UniSTS:178529
definition	standard_name : AW214504

name	(CDS detail)
type	STS
link
xref	UniSTS:165125
definition	standard_name : AV011447

name	(CDS detail)
type	STS
link
xref	UniSTS:234277
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165127
definition	standard_name : AI462003

name	(CDS detail)
type	STS
link
xref	UniSTS:234278
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207258
definition	standard_name : AI303601

name	(CDS detail)
type	STS
link
xref	UniSTS:178530
definition	standard_name : AI266870

name	(CDS detail)
type	STS
link
xref	UniSTS:273073
definition	standard_name : PMC317124P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273074
definition	standard_name : PMC317124P3

name	(CDS detail)
type	STS
link
xref	UniSTS:273072
definition	standard_name : PMC317124P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234290
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:222724
definition	standard_name : RH140655

name	(CDS detail)
type	STS
link
xref	UniSTS:119902
definition	standard_name : RH94655

name	(CDS detail)
type	STS
link
xref	UniSTS:128792
definition	standard_name : D1Mit426

name	(CDS detail)
type	STS
link
xref	UniSTS:162083
definition	standard_name : RH125261

name	(CDS detail)
type	STS
link
xref	UniSTS:125553
definition	standard_name : R75555

name	(CDS detail)
type	STS
link
xref	UniSTS:123704
definition	standard_name : 25.MMHAP90FRA10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:162836
definition	standard_name : RH126124

name	(CDS detail)
type	STS
link
xref	UniSTS:207259
definition	standard_name : RH126937

name	(CDS detail)
type	STS
link
xref	UniSTS:178531
definition	standard_name : AI893648

name	(CDS detail)
type	STS
link
xref	UniSTS:123546
definition	standard_name : 21.MMHAP97FRG9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234279
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161144
definition	standard_name : RH124322

name	(CDS detail)
type	STS
link
xref	UniSTS:234289
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161370
definition	standard_name : RH124548

name	(CDS detail)
type	STS
link
xref	UniSTS:162671
definition	standard_name : RH125959

name	(CDS detail)
type	STS
link
xref	UniSTS:250338
definition	standard_name : AI234525

name	(CDS detail)
type	STS
link
xref	UniSTS:207261
definition	standard_name : C76375

name	LOC100042190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245447 GeneID:100042190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033682.1

name	EG277333 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149245210 GeneID:277333 MGI:3644516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG277333 pseudo : _no_value transcript_id : XR_035074.1

name	LOC666431 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245456 GeneID:666431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 84 ESTs, 2 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033759.1

clone name	MSMg01-159D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492E19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-327D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-170H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349D19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-320B05.b	B6Ng01-320B05.g
ACC	GA109542	GA109543
length	1,185	1,132
definition	B6Ng01-320B05.b	B6Ng01-320B05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(181,688,575 - 181,689,766)	(181,519,857 - 181,520,991)
sequence	gaattcatagacctctgtatcaaaaaacaaaagacccaaacatgattttg atagtcattcaaaaatatgcataagaagtacccgcaaagcaaaggtgatg tccatcagtgcttgctgtctgaaacacggtctagtttaggtatggtgact cacagaggctgagagaggaatgtgagtttcaggtcaatcttggttattat agggagatactctccagcagtgaagagaacccccaggctagcagattggt tctagttcctaattatactcaagtgtaaggttaccttgaagtatacacta gcacactgcttcagttatagagccagttgtcctaatcaatcagtatgatc actggagccatccagcacctttcattcaacactttgattaacactgtgtg gaagataaacagtgataactttaatgctttgaggctctatgatcatttaa taaaactaacccacatagacttttaatttgtaaggcacagaatagctcat taccttatgagtgagcagtgggtctgatattaaaacctacccacaaaact tggatgatcatctttgtcaactcagtcaaatattttttgctgaggataaa aaatgtaataactggaatcttccagtacttcaacaaaaatagtaggaaaa ataaaggattttcctggagttttgttgttgttgttgttccttattttgta atttttcattttaataaaaaatgtttcgtaggtttgatggacatttgcaa caatcaagaagcaagtgattattcatattagaaaagttagtttcaatgaa aatctagatgaatgtcaatatttggaaagctagtttcttttttcatttgt tgtttgtttcctctgtgtagcctggctgacctggatctcattctgaaggc caggctgttctcagattcagagatctgcctgcttctgcctccctctgtca gcacctggacaagctgggttattgggcaagttgtgagattagttgttggg tattagtcatcagtactatagatactgtatctagatatctccacacaaca taagaaatctctgcaatgtttcagagactgctttcttgggagtatagtgt ttgtctattactttagtggaccttggagaaaaaggccagtggatgtatac tgcggaattctacagcttaccatgttaattctgag	gaattcagatttgccttcctctgcctctctaatgctgggattaaaggtgt gatccaccgtgtcaagctattttctactcttatattttgctttttttggg gggcgggggtctttttacttagtccaagatggctttaaagttcctacaaa ggatggcctggaaccgattctcctgcctctgttttaaagcgctgaggcac aggagagtgccactgtgtccggcttagttcttactcactgcaacataggg ctgtaagtaagctttattagtgtttgcctttgaaagtttttcttaaaagg ggggagtgcaggtttatctcaatgatctccctcacctggcagtgagggtc aggagcacaccttggtttttcccgtctccactgctttatatacggctagc gatcttagaaggtagatgcccagagaagccaaaacaaagctagaaatccg agtttaagtaacttggcaaaagtacaggagataagtgttggaagcaggcc tggcttctggattgtccattctctggttcttgggcaagaaaagttctctc ctcttctttctcttcctcctctttcttcttcctcctttcccttcctcctc ttcttcttcctctttttttcttccctcttcttcctcctctttttcttttt ttgctgtgcaaggaatatgatcccaggcctcataccattaagcaactccc actgcctcatattcctttcttttaaaacaatgttgttaattttgtgtatt tgtggaggtcagacctctgtgtcaggtgtcatcaattgcttgtccaccta attattttacatttgattgattgagactgaatttcagtcctgacttgttt tatgccaacttgtcccaagctagagtcatcagagaggtggaaaccctaat tgacaaaatgcctccgtaagatggggctgtaggcaggactgtggggttgt tctcgaaatgagtgattgaagtgagagggccagcctattgtgggtggtgc catccctgagctggtgatcctggttactataagaaaggcaggctggagca agacacgagaagcaccagttcagcaggcaccctcataggcctccatcact ctgctcaggttcctggccctgttagcttcctg
quality values	Open. Hide. 58 36 28 28 58 39 29 62 54 62 49 62 62 62 62 62 62 47 56 54 41 51 62 62 62 62 62 56 54 62 62 62 62 59 59 59 59 35 32 38 29 46 62 49 46 59 62 62 62 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 62 62 59 59 62 62 62 62 62 59 59 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 37 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 41 58 54 58 58 58 58 58 58 58 58 52 58 58 58 58 58 54 58 58 52 58 58 58 54 53 58 58 58 58 58 58 58 58 58 58 39 58 45 39 58 58 58 58 58 58 45 58 51 51 51 53 58 49 58 58 58 58 58 51 53 58 58 58 54 51 47 58 53 52 49 58 58 49 47 54 54 50 58 58 58 41 51 49 49 54 58 41 58 58 58 58 58 41 50 53 58 58 52 58 41 23 58 58 49 53 58 51 58 58 58 32 50 58 58 58 51 41 51 58 52 54 58 29 58 58 53 58 46 39 52 53 58 41 52 51 39 58 58 58 58 37 51 52 40 58 58 58 50 41 38 39 58 58 50 40 44 50 50 49 31 41 49 50 42 54 39 54 50 50 49 39 41 10 54 47 54 54 52 41 28 54 50 28 23 27 51 54 49 46 47 27 37 40 30 41 52 49 26 54 42 54 54 32 53 45 54 41 54 51 31 30 37 30 27 44 40 32 45 36 46 44 41 33 54 54 54 53 35 26 42 42 42 45 54 53 40 33 47 42 52 47 52 53 32 32 31 39 43 32 41 31 32 39 32 32 53 30 32 32 32 45 35 32 53 47 33 41 52 49 47 37 37 43 37 32 45 53 42 42 25 47 51 51 51 31 31 28 31 51 34 31 20 43 38 23 47 33 46 31 51 43 39 42 31 31 28 51 31 51 31 32 31 31 42 29 26 27 9 29 30 29 16 37 31 31 33 22 31 31 31 31 30 33 43 31 30 30 31 18 10 13 31 30 30 21 25 28 36 41 29 28 31 32 26 14 11 32 19 31 25 21 23 41 21 25 26 31 30 27 31 27 33 31 23 26 17 30 29 31 26 26 31 21 47 27 30 32 30 33 26 31 28 24 37 25 21 25 33 25 19 22 17 13 38 24 31 21 22 44 22 30 18 21 8 25 14 43 30 24 27 22 26 24 17 29 22 17 29 6 16 11 24 15 23 28 21 31 17 11 32 39 26 13 14 10 32 22 16 31 33 31 32 31 24 19 21 27 32 32 18 13 12 9 29 20 24 32 16 7 3 6 14 18 19 28 8 16 6 7 6 19 16 22 14 11 11 8 6 6 5 9 15 11 8 6 5 23 38 17 10 11 11 16 27 28 8 9 6 6 22 15 34 21 24 17 7 13 5 6 16 18 17 27 21 47 14 6 5 18 11 22 6 16 5 8 7 7 6 7 5 9 7 27 5 3 6 15 4 6 4 4 5 9 8 27 17 6 3 3 2 8 24 5 5 20 15 12 7 5 5 4 12 28 25 25 6 4 17 6 6 5 4 6 7 20 7 18 4 14 8 21 7 4 3 4 2 4 2 1 2 10 6 6 4 5 16 11 10 11 7 13 6 17 4 2 2 3 3 5 10 21 6 7 5 18 5 7	Open. Hide. 62 44 51 59 62 59 59 51 59 59 59 56 43 59 59 59 54 43 48 56 56 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 59 54 54 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 59 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 47 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 49 49 58 58 58 58 58 58 58 58 58 58 58 58 54 53 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 46 58 58 58 58 52 58 58 58 58 58 58 58 49 54 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 50 58 58 49 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 43 58 58 58 58 58 58 58 58 58 58 58 49 50 54 49 58 58 51 51 58 58 51 50 48 58 58 49 50 58 51 58 50 58 58 58 46 51 50 43 58 58 58 58 58 51 50 53 58 53 58 46 36 50 52 58 54 41 42 40 41 50 39 44 44 58 50 32 40 58 51 51 54 52 45 51 52 40 31 28 49 52 53 53 35 49 44 44 50 54 53 54 42 42 41 49 49 49 54 51 50 44 49 41 52 51 53 53 51 54 51 46 39 54 54 28 30 54 54 47 45 33 53 41 54 52 52 51 54 34 33 52 45 54 54 54 46 47 54 39 29 20 49 35 35 35 45 53 37 16 47 33 32 32 32 35 19 51 53 40 32 52 42 51 37 36 22 6 49 31 53 39 37 37 45 43 24 41 39 31 31 31 46 32 34 30 43 21 26 31 51 43 33 38 33 38 31 32 51 51 45 36 39 35 45 51 42 36 37 23 46 41 26 13 46 31 38 31 30 22 32 42 42 36 37 48 38 18 17 29 37 32 42 31 32 33 28 14 42 31 16 47 46 29 13 23 31 36 31 23 22 30 31 29 28 32 32 37 18 8 19 38 30 30 23 31 38 24 31 32 33 36 34 38 27 38 18 25 12 31 27 31 24 24 44 31 22 41 29 32 25 21 25 28 31 24 13 30 41 41 26 17 33 31 30 25 12 25 16 21 14 27 24 31 15 23 32 48 32 27 32 29 30 17 14 21 7 16 5 10 31 18 12 8 11 28 43 32 18 11 5 4 5 25 23 20 19 15 12 48 34 17 19 30 17 19 28 29 26 21 20 21 21 18 18 23 23 13 19 7 30 19 5 10 5 9 21 19 27 17 12 7 27 5 7 34 25 10 18 19 3 7 10 7 15 20 26 47 25 9 12 21 9 26 21 19 13 14 20 29 23 11 15 14 12 22 4 7 13 18 21 16 11 12 21 5 17 29 22 6 9 22 16 16 11 11 8 7 8 20 4 13 6 11 13 7 6 7 18 7 6 3 3 9 4 4 10 17 24 9 8 6 7 10 18 15 11 8 8 4 12 9 20 25 12 3 3 2 5 13 8 3 5 1 3 8 13 17 14 6 9 3 3 3 1 3 8 22 8 5 7 8 4 2 3 16 4 10 4 12 29 17 4 6 1 3 2 3 3 11 5 10 16 4 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_181688575_181689766
seq2: B6Ng01-320B05.b_43_1227 (reverse)

seq1  CTCAGAATAAACAATGGTAAGCTGTAGAATACTCCGGCAGTTATCCAT-C  49
      |||||||| ||| |||||||||||||||||  ||| |||| ||| ||| |
seq2  CTCAGAATTAAC-ATGGTAAGCTGTAGAAT--TCC-GCAG-TATACATCC  45

seq1  ACTTGGGCTTTTCTCCAAGTTCCAACTAAAGTATAGGACAAACACTATAC  99
      ||| |   ||||||||||| ||| |||||||||   ||||||||||||||
seq2  ACTGGCCTTTTTCTCCAAGGTCC-ACTAAAGTAATAGACAAACACTATAC  94

seq1  TCCCAAGAAAGCAGTCTCTGAAACATTTGCAGAGATTTC-TATG-TGTGT  147
      ||||||||||||||||||||||||| ||||||||||||| |||| |||||
seq2  TCCCAAGAAAGCAGTCTCTGAAACA-TTGCAGAGATTTCTTATGTTGTGT  143

seq1  GGAGATTATCTAGATAACAGTATCTATAGTACTGATGACTAATACCCAAC  197
      ||||| ||||||||| ||||||||||||||||||||||||||||||||||
seq2  GGAGA-TATCTAGAT-ACAGTATCTATAGTACTGATGACTAATACCCAAC  191

seq1  AACTAAATCTTCACAACTTGCCCAATAA-CCAGCTTGTCCAGGTGCTGAC  246
      |||| |||| |||||||||||||||||| |||||||||||||||||||||
seq2  AACT-AATC-TCACAACTTGCCCAATAACCCAGCTTGTCCAGGTGCTGAC  239

seq1  AGAGGGAGGCAGAAGCAGGCAGATCTCTGAATCTGAGAACAGCCTGGCCT  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGGAGGCAGAAGCAGGCAGATCTCTGAATCTGAGAACAGCCTGGCCT  289

seq1  TCAGAATGAGATCCAGGTCAGCCAGGCTACACAGAGGAAACAAACAACAA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAATGAGATCCAGGTCAGCCAGGCTACACAGAGGAAACAAACAACAA  339

seq1  ATGAAAAAAGAAACTAGCTTTCCAAATATTGACATTCATCTAGATTTTCA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAAAAAGAAACTAGCTTTCCAAATATTGACATTCATCTAGATTTTCA  389

seq1  TTGAAACTAACTTTTCTAATATGAATAATCACTTGCTTCTTGATTGTTGC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAACTAACTTTTCTAATATGAATAATCACTTGCTTCTTGATTGTTGC  439

seq1  AAATGTCCATCAAACCTACGAAACATTTTTTATTAAAATGAAAAATTACA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTCCATCAAACCTACGAAACATTTTTTATTAAAATGAAAAATTACA  489

seq1  AAATAAGGAACAACAACAACAACAAAACTCCAGGAAAATCCTTTATTTTT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGGAACAACAACAACAACAAAACTCCAGGAAAATCCTTTATTTTT  539

seq1  CCTACTATTTTTGTTGAAGTACTGGAAGATTCCAGTTATTACATTTTTTA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTACTATTTTTGTTGAAGTACTGGAAGATTCCAGTTATTACATTTTTTA  589

seq1  TCCTCAGCAAAAAATATTTGACTGAGTTGACAAAGATGATCATCCAAGTT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCAGCAAAAAATATTTGACTGAGTTGACAAAGATGATCATCCAAGTT  639

seq1  TTGTGGGTAGGTTTTAATATCAGACCCACTGCTCACTCATAAGGTAATGA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGGGTAGGTTTTAATATCAGACCCACTGCTCACTCATAAGGTAATGA  689

seq1  GCTATTCTGTGCCTTACAAATTAAAAGTCTATGTGGGTTAGTTTTATTAA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATTCTGTGCCTTACAAATTAAAAGTCTATGTGGGTTAGTTTTATTAA  739

seq1  ATGATCATAGAGCCTCAAAGCATTAAAGTTATCACTGTTTATCTTCCACA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATCATAGAGCCTCAAAGCATTAAAGTTATCACTGTTTATCTTCCACA  789

seq1  CAGTGTTAATCAAAGTGTTGAATGAAAGGTGCTGGATGGCTCCAGTGATC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTTAATCAAAGTGTTGAATGAAAGGTGCTGGATGGCTCCAGTGATC  839

seq1  ATACTGATTGATTAGGACAACTGGCTCTATAACTGAAGCAGTGTGCTAGT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTGATTGATTAGGACAACTGGCTCTATAACTGAAGCAGTGTGCTAGT  889

seq1  GTATACTTCAAGGTAACCTTACACTTGAGTATAATTAGGAACTAGAACCA  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATACTTCAAGGTAACCTTACACTTGAGTATAATTAGGAACTAGAACCA  939

seq1  ATCTGCTAGCCTGGGGGTTCTCTTCACTGCTGGAGAGTATCTCCCTATAA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGCTAGCCTGGGGGTTCTCTTCACTGCTGGAGAGTATCTCCCTATAA  989

seq1  TAACCAAGATTGACCTGAAACTCACATTCCTCTCTCAGCCTCTGTGAGTC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCAAGATTGACCTGAAACTCACATTCCTCTCTCAGCCTCTGTGAGTC  1039

seq1  ACCATACCTAAACTAGACCGTGTTTCAGACAGCAAGCACTGATGGACATC  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATACCTAAACTAGACCGTGTTTCAGACAGCAAGCACTGATGGACATC  1089

seq1  ACCTTTGCTTTGCGGGTACTTCTTATGCATATTTTTGAATGACTATCAAA  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTTGCTTTGCGGGTACTTCTTATGCATATTTTTGAATGACTATCAAA  1139

seq1  ATCATGTTTGGGTCTTTTGTTTTTTGATACAGAGGTCTATGAATTC  1192
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATGTTTGGGTCTTTTGTTTTTTGATACAGAGGTCTATGAATTC  1185

seq1: chr1_181519857_181520991
seq2: B6Ng01-320B05.g_67_1198

seq1  GAATTCAGATTTGCCTTCCTCTGCCTCTCTAATGCTGGGATTAAAGGTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGATTTGCCTTCCTCTGCCTCTCTAATGCTGGGATTAAAGGTGT  50

seq1  GATCCACCGTGTCAAGCTATTTTCTACTCTTATATTTTGCTTTTTTTGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCACCGTGTCAAGCTATTTTCTACTCTTATATTTTGCTTTTTTTGGG  100

seq1  GGGCGGGGGTCTTTTTACTTAGTCCAAGATGGCTTTAAAGTTCCTACAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCGGGGGTCTTTTTACTTAGTCCAAGATGGCTTTAAAGTTCCTACAAA  150

seq1  GGATGGCCTGGAACCGATTCTCCTGCCTCTGTTTTAAAGCGCTGAGGCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGCCTGGAACCGATTCTCCTGCCTCTGTTTTAAAGCGCTGAGGCAC  200

seq1  AGGAGAGTGCCACTGTGTCCGGCTTAGTTCTTACTCACTGCAACATAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAGTGCCACTGTGTCCGGCTTAGTTCTTACTCACTGCAACATAGGG  250

seq1  CTGTAAGTAAGCTTTATTAGTGTTTGCCTTTGAAAGTTTTTCTTAAAAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAAGTAAGCTTTATTAGTGTTTGCCTTTGAAAGTTTTTCTTAAAAGG  300

seq1  GGGGAGTGCAGGTTTATCTCAATGATCTCCCTCACCTGGCAGTGAGGGTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAGTGCAGGTTTATCTCAATGATCTCCCTCACCTGGCAGTGAGGGTC  350

seq1  AGGAGCACACCTTGGTTTTTCCCGTCTCCACTGCTTTATATACGGCTAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGCACACCTTGGTTTTTCCCGTCTCCACTGCTTTATATACGGCTAGC  400

seq1  GATCTTAGAAGGTAGATGCCCAGAGAAGCCAAAACAAAGCTAGAAATCCG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTTAGAAGGTAGATGCCCAGAGAAGCCAAAACAAAGCTAGAAATCCG  450

seq1  AGTTTAAGTAACTTGGCAAAAGTACAGGAGATAAGTGTTGGAAGCAGGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTAAGTAACTTGGCAAAAGTACAGGAGATAAGTGTTGGAAGCAGGCC  500

seq1  TGGCTTCTGGATTGTCCATTCTCTGGTTCTTGGGCAAGAAAAGTTCTCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTTCTGGATTGTCCATTCTCTGGTTCTTGGGCAAGAAAAGTTCTCTC  550

seq1  CTCTTCTTTCTCTTCCTCCTCTTTCTTCTTCCTCCTTTCCCTTCCTCCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCTTTCTCTTCCTCCTCTTTCTTCTTCCTCCTTTCCCTTCCTCCTC  600

seq1  TTCTTCTTCCTCTTTTTTTCTTCCCTCTTCTTCCTCCTCTTTTTCTTTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCTTCCTCTTTTTTTCTTCCCTCTTCTTCCTCCTCTTTTTCTTTTT  650

seq1  TTGCTGTGCAAGGAATATGATCCCAGGCCTCATACCATTAAGCAACTCCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTGTGCAAGGAATATGATCCCAGGCCTCATACCATTAAGCAACTCCC  700

seq1  ACTGCCTCATATTCCTTTCTTTTAAAACAATGTTGTTAATTTTGTGTATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCCTCATATTCCTTTCTTTTAAAACAATGTTGTTAATTTTGTGTATT  750

seq1  TGTGGAGGTCAGACCTCTGTGTCAGGTGTCATCAATTGCTTGTCCACCTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGAGGTCAGACCTCTGTGTCAGGTGTCATCAATTGCTTGTCCACCTA  800

seq1  ATTATTTTACATTTGATTGATTGAGACTGAATTTCAGTCCTGACTTGTTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATTTTACATTTGATTGATTGAGACTGAATTTCAGTCCTGACTTGTTT  850

seq1  TATGCCAACTTGTCCCAAGCTAGAGTCATCAGAGAGGTGGAAACCCTAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCCAACTTGTCCCAAGCTAGAGTCATCAGAGAGGTGGAAACCCTAAT  900

seq1  TGACAAAATGCCTCCGTAAGATGGGGCTGTAGGCAAGACTGTGGGG-TGT  949
      ||||||||||||||||||||||||||||||||||| |||||||||| |||
seq2  TGACAAAATGCCTCCGTAAGATGGGGCTGTAGGCAGGACTGTGGGGTTGT  950

seq1  TCTCGAAATGAGTGATTGAAGTGAGAGGGCCCAGCCTATTGTGGGTGGTG  999
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  TCTCGAAATGAGTGATTGAAGTGAGAGGG-CCAGCCTATTGTGGGTGGTG  999

seq1  CCATCCCTGAGCTGGTGATCCTGGGTACTATAAGAAA-GCAGGCT-GAGC  1047
      |||||||||||||||||||||||| |||||||||||| ||||||| ||||
seq2  CCATCCCTGAGCTGGTGATCCTGGTTACTATAAGAAAGGCAGGCTGGAGC  1049

seq1  AAGACACGAGGAGCAACCCAG-TCAGCAGCACCCCTCCATAGCCCTCCAT  1096
      |||||||||| ||||  |||| |||||||   |||| ||||| |||||||
seq2  AAGACACGAGAAGCA--CCAGTTCAGCAGGCACCCT-CATAGGCCTCCAT  1096

seq1  CAACTCCTGCTTCCAGGTTCCT-GCCCTGTTTAGTTCCTG  1135
      | ||| |||||  ||||||||| ||||||||   ||||||
seq2  C-ACT-CTGCT--CAGGTTCCTGGCCCTGTTAGCTTCCTG  1132

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information