MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-327A16
Chromosome	1 (Build37)
Map Location	96,107,068 - 96,108,200
singlet/doublet	singlet
Overlap gene	none
Upstream gene	E030010N08Rik, Sned1, Mterfd2, LOC665966, Pask, Ppp1r7, Tmem16g, Hdlbp, Sept2, Farp2, Stk25, Bok, Thap4, Atg4b, Dtymk, Ing5, D2hgdh, Gal3st2, LOC100041596, EG666009, EG619597, Neu4, Pdcd1, LOC666012
Downstream gene	LOC666025, LOC100040685
Link	Open Mouse BAC browser

Click to get alignment info.

name	E030010N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381284 MGI:3045962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Sned1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208777 MGI:3045960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mterfd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69821 MGI:1918355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins pseudo : _no_value

name	Pask (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269224 MGI:2155936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66385 MGI:1913635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404545 MGI:3052714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdlbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110611 MGI:99256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18000 MGI:97298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Farp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227377 MGI:2385126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59041 MGI:1891699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bok (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51800 MGI:1858494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67026 MGI:1914276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66615 MGI:1913865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtymk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21915 MGI:108396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ing5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66262 MGI:1922816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2hgdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98314 MGI:2138209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381334 MGI:2685834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 83 ESTs, 9 Proteins

name	EG666009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666009 MGI:3648247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins

name	EG619597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619597 MGI:3646771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neu4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241159 MGI:2661364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18566 MGI:104879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC666025 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 130 ESTs, 30 Proteins pseudo : _no_value

name	LOC100040685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	E030010N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234197 GeneID:381284 MGI:3045962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA E030010N08 gene transcript_id : XM_001474855.1

name	Sned1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254324 GeneID:208777 MGI:3045960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi, nidogen and EGF-like domains 1 transcript_id : NM_172463.3

name	Mterfd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852399 GeneID:69821 MGI:1918355
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MTERF domain containing 2 transcript_id : NM_178051.3

name	Pask (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18497291 GeneID:269224 MGI:2155936
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PAS domain containing serine/threonine kinase transcript_id : NM_080850.1

name	Ppp1r7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892536 GeneID:66385 MGI:1913635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 7 transcript_id : NM_023200.2

name	Tmem16g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309608 GeneID:404545 MGI:3052714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16g transcript_id : NM_207031.1

name	Hdlbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801781 GeneID:110611 MGI:99256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high density lipoprotein (HDL) binding protein transcript_id : NM_133808.3

name	Sept2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754815 GeneID:18000 MGI:97298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 2 transcript_id : NM_010891.1

name	Farp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704021 GeneID:227377 MGI:2385126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM, RhoGEF and pleckstrin domain protein 2 transcript_id : NM_145519.1

name	Stk25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337276 GeneID:59041 MGI:1891699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 25 (yeast) transcript_id : NM_021537.3

name	Bok (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131154 GeneID:51800 MGI:1858494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl-2-related ovarian killer protein transcript_id : NM_016778.2

name	Thap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750224 GeneID:67026 MGI:1914276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing 4 transcript_id : NM_025920.3

name	Atg4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801870 GeneID:66615 MGI:1913865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 4B (yeast) transcript_id : NM_174874.2

name	Dtymk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963516 GeneID:21915 MGI:108396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxythymidylate kinase transcript_id : NM_023136.1

name	Ing5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037408 GeneID:66262 MGI:1922816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of growth family, member 5 transcript_id : NM_025454.2

name	D2hgdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341040 GeneID:98314 MGI:2138209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D-2-hydroxyglutarate dehydrogenase transcript_id : NM_178882.2

name	Gal3st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387728 GeneID:381334 MGI:2685834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 2 transcript_id : NM_199366.3

name	LOC100041596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234225 GeneID:100041596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 8 Proteins product : similar to galactose 3-O-sulfotransferase-2, transcript variant 2 transcript_id : XM_001477538.1

name	LOC100041596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234227 GeneID:100041596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 10 ESTs, 8 Proteins product : similar to galactose 3-O-sulfotransferase-2, transcript variant 1 transcript_id : XM_001477518.1

name	EG666009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234204 GeneID:666009 MGI:3648247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : predicted gene, EG666009 transcript_id : XM_980899.2

name	EG619597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350327 GeneID:619597 MGI:3646771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG619597 transcript_id : NM_001039219.2

name	Neu4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271519 GeneID:241159 MGI:2661364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialidase 4 transcript_id : NM_173772.3

name	Pdcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679238 GeneID:18566 MGI:104879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death 1 transcript_id : NM_008798.1

name	LOC100040685 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234208 GeneID:100040685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to retinitis pigmentosa GTPase regulator interacting protein 1 transcript_id : XM_001475076.1

name	E030010N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234198 GeneID:381284 MGI:3045962
definition	codon_start : 1 product : similar to ciliary rootlet coiled-coil, rootletin protein_id : XP_001474905.1

name	Sned1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254325 GeneID:208777 MGI:3045960
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation function : extracellular matrix component note : secreted protein SST3 product : secreted nidogen domain protein protein_id : NP_766051.3

name	Mterfd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017341 GeneID:69821 MGI:1918355
definition	codon_start : 1 product : MTERF domain containing 2 protein_id : NP_835152.1

name	Pask (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18497292 CCDS:CCDS15186.1 GeneID:269224 MGI:2155936
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : putative sensor protein note : paskin product : PAS domain containing serine/threonine kinase protein_id : NP_543126.1

name	Ppp1r7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963569 CCDS:CCDS15187.1 GeneID:66385 MGI:1913635
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : protein phosphatase-1 regulatory subunit 7 protein_id : NP_075689.1

name	Tmem16g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309609 CCDS:CCDS15188.1 GeneID:404545 MGI:3052714
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] codon_start : 1 note : new gene expressed in prostate; prostate cancer associated protein 5 product : transmembrane protein 16g protein_id : NP_996914.1

name	Hdlbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527028 CCDS:CCDS15189.1 GeneID:110611 MGI:99256
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vigilin product : high density lipoprotein binding protein protein_id : NP_598569.1

name	Sept2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754816 CCDS:CCDS15190.1 GeneID:18000 MGI:97298
definition	GO_component : GO:0005826 - contractile ring [Evidence NAS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence NAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence NAS] codon_start : 1 function : cytoskeletal component interacting with actin-based structures note : neural precursor cell expressed, developmentally down-regulated gene 5 product : septin 2 protein_id : NP_035021.1

name	Farp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704022 CCDS:CCDS15191.1 GeneID:227377 MGI:2385126
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016322 - neuron remodeling [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : FERM, RhoGEF and pleckstrin domain protein 2 protein_id : NP_663494.1

name	Stk25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89337277 CCDS:CCDS15192.1 GeneID:59041 MGI:1891699
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Ste20-like kinase; serine/threonine kinase 25 (Ste20, yeast homolog); Yeast Sps1/Ste20-related kinase 1 product : serine/threonine kinase 25 protein_id : NP_067512.3

name	Bok (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949082 CCDS:CCDS15193.1 GeneID:51800 MGI:1858494
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : apoptosis activator product : Bcl-2-related ovarian killer protein-like protein_id : NP_058058.1

name	Thap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750225 CCDS:CCDS15194.1 GeneID:67026 MGI:1914276
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : THAP domain containing 4 protein_id : NP_080196.3

name	Atg4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883848 CCDS:CCDS15195.1 GeneID:66615 MGI:1913865
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0005875 - microtubule associated complex [Evidence ISS] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence ISS]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0000045 - autophagic vacuole formation [Evidence ISS]; GO:0006914 - autophagy [Evidence ISS]; GO:0006612 - protein targeting to membrane [Evidence ISS]; GO:0006623 - protein targeting to vacuole [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : cysteine protease involved in autophagy APG4-B; autophagy-related 4B-like; AUT-like 1, cysteine endopeptidase; APG4 (ATG4) autophagy-related homolog B product : autophagin 1 protein_id : NP_777363.1

name	Dtymk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963517 GeneID:21915 MGI:108396
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004798 - thymidylate kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006233 - dTDP biosynthesis [Evidence IEA]; GO:0006235 - dTTP biosynthesis [Evidence IEA]; GO:0009165 - nucleotide biosynthesis [Evidence IEA] codon_start : 1 note : thymidylate kinase product : deoxythymidylate kinase protein_id : NP_075625.1

name	Ing5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313552 GeneID:66262 MGI:1922816
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : inhibitor of growth family, member 5 protein_id : NP_079730.1

name	D2hgdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725722 CCDS:CCDS15196.1 GeneID:98314 MGI:2138209
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : D-2-hydroxyglutarate dehydrogenase protein_id : NP_849213.1

name	Gal3st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861156 CCDS:CCDS15197.1 GeneID:381334 MGI:2685834
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoprotein beta-Gal 3-sulfotransferase-like; galactose 3-O-sulfotransferase 2 product : galactose-3-O-sulfotransferase 2 protein_id : NP_955398.2

name	LOC100041596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234226 GeneID:100041596
definition	codon_start : 1 product : similar to galactose 3-O-sulfotransferase-2 isoform 2 protein_id : XP_001477588.1

name	LOC100041596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234228 GeneID:100041596
definition	codon_start : 1 product : similar to galactose 3-O-sulfotransferase-2 isoform 1 protein_id : XP_001477568.1

name	EG666009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234205 GeneID:666009 MGI:3648247
definition	codon_start : 1 product : similar to D2hgdh protein protein_id : XP_985993.2

name	EG619597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986609 GeneID:619597 MGI:3646771
definition	codon_start : 1 product : hypothetical protein LOC619597 protein_id : NP_001034308.1

name	Neu4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424629 CCDS:CCDS15199.1 GeneID:241159 MGI:2661364
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0019866 - organelle inner membrane [Evidence ISS] GO_function : GO:0004308 - exo-alpha-sialidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : sialidase 4 protein_id : NP_776133.1

name	Pdcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679239 CCDS:CCDS15200.1 GeneID:18566 MGI:104879
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : programmed cell death 1 protein_id : NP_032824.1

name	LOC100040685 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234209 GeneID:100040685
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475126.1

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 1 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 2 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 3 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 4 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 5 pseudo : _no_value

name	LOC666012 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666012
definition	number : 6 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:94223
definition	standard_name : G42365

name	(CDS detail)
type	STS
link
xref	UniSTS:163078
definition	standard_name : RH126370

name	(CDS detail)
type	STS
link
xref	UniSTS:123372
definition	standard_name : 18.MMHAP23FLF3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:209949
definition	standard_name : RH135953

name	(CDS detail)
type	STS
link
xref	UniSTS:178438
definition	standard_name : AI642697

name	(CDS detail)
type	STS
link
xref	UniSTS:271769
definition	standard_name : PMC193927P1

name	(CDS detail)
type	STS
link
xref	UniSTS:124152
definition	standard_name : 35.MMHAP65FRD11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158833
definition	standard_name : AI118566

name	(CDS detail)
type	STS
link
xref	UniSTS:243391
definition	standard_name : AI009079

name	(CDS detail)
type	STS
link
xref	UniSTS:158832
definition	standard_name : AA960365

name	(CDS detail)
type	STS
link
xref	UniSTS:167260
definition	standard_name : D1Ertd101e

name	(CDS detail)
type	STS
link
xref	UniSTS:185447
definition	standard_name : BB136667

name	(CDS detail)
type	STS
link
xref	UniSTS:122757
definition	standard_name : 03.MMHAP94FRA9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128901
definition	standard_name : D1Mit534

name	(CDS detail)
type	STS
link
xref	UniSTS:234178
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128920
definition	standard_name : D1Mit60

name	(CDS detail)
type	STS
link
xref	UniSTS:210452
definition	standard_name : RH136467

name	(CDS detail)
type	STS
link
xref	UniSTS:207193
definition	standard_name : C86992

name	(CDS detail)
type	STS
link
xref	UniSTS:158836
definition	standard_name : C86992

name	(CDS detail)
type	STS
link
xref	UniSTS:178442
definition	standard_name : AI042849

name	(CDS detail)
type	STS
link
xref	UniSTS:47827
definition	standard_name : D1S2869

name	(CDS detail)
type	STS
link
xref	UniSTS:165092
definition	standard_name : AI847676

name	(CDS detail)
type	STS
link
xref	UniSTS:210437
definition	standard_name : RH136451

name	(CDS detail)
type	STS
link
xref	UniSTS:248145
definition	standard_name : AA924144

name	(CDS detail)
type	STS
link
xref	UniSTS:207192
definition	standard_name : BB130418

name	(CDS detail)
type	STS
link
xref	UniSTS:234179
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165093
definition	standard_name : AW048066

name	(CDS detail)
type	STS
link
xref	UniSTS:163134
definition	standard_name : RH126426

name	(CDS detail)
type	STS
link
xref	UniSTS:158837
definition	standard_name : AU044245

name	(CDS detail)
type	STS
link
xref	UniSTS:209965
definition	standard_name : RH135969

name	(CDS detail)
type	STS
link
xref	UniSTS:165090
definition	standard_name : AI325464

name	(CDS detail)
type	STS
link
xref	UniSTS:165090
definition	standard_name : AI325464

name	(CDS detail)
type	STS
link
xref	UniSTS:163259
definition	standard_name : X67914

name	(CDS detail)
type	STS
link
xref	UniSTS:128856
definition	standard_name : D1Mit489

name	(CDS detail)
type	STS
link
xref	UniSTS:186239
definition	standard_name : 25.MMHAP15FRA10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:167271
definition	standard_name : RH127146

name	LOC665966 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234199 GeneID:665966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : similar to hCG1641837 pseudo : _no_value transcript_id : XR_031959.1

name	LOC666025 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234229 GeneID:666025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 130 ESTs, 30 Proteins product : similar to magnesium dependent protein phosphatase beta-1 pseudo : _no_value transcript_id : XR_033301.1

clone name	MSMg01-535D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-104J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-376B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496C24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-327A16.b	B6Ng01-327A16.g
ACC	GA114690	GA114691
length	1,163	1,120
definition	B6Ng01-327A16.b	B6Ng01-327A16.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcctaaacctcataaacagcttcagtgaagtagctggatataaaat taactcaaacaagtcaatggcctttctgtacacaaaggacaaacaggctg agaaagaaattagggaaacaacacccttctcaatagtcacaaataatata aaatatcttggcatgactctaactaaggaagtgaaagatctgtatgataa gaacttcaagtctctgaagaaagaaattaaagaagatctcagaagatgga aagatctcccatgctcttggattggcaggatcaatatagtaaaaatggct atcttgccaaaagcaatctacagattcaatgcaacctccatcaaaattcc aactcaattcttcaacgaattagaaagagcaatctgcaaattcatctgga ataacaaaaaacctaggatagcaaacactcttctcaaggataaaagaaac tctggtggaatcaccatgcctgacctaaagctttactacagagcaattgt gataaaaactgcatggtactggtatagtgagagacaagtagaccaatgga atagaattgaagacccagaaatgaacccacacacctatggtcacttgatc tttgacaagggagctaaaaaccatccaatggaagaaagacagcattttca acaattggtgctggcataactggttgttatcatgtagaagaatgcgaatc gatccattcctatctccttgtactaaggtcagatctaagtggatcaagga actccacataaaaccagagacactgaaacttatagaggagaatgtgggga aaagcctcgaagatatgggtacagggggaaaattcccgaatagaacagca atggcttgtgctgtaaaatcgagaattgacaatgggacttcatgaaactg caaagcttctgcaaagcaaaagacaccgtcataagacaaaaaggccatca acagattgggaaaggatctttacctatcctaatcagataggggactaata tccaacatatataaagactcaagaggtggactcagaaaatcaaataccca taaaaatgtgctcagagcttaacagatctcactgaggatacgattgctga cagcacctgaaaatgtcagcatcctaatcatcagtatgcgatatgcacct cttgagaatccaa	gaattccattattgcatttttatgaagccaatttgtgctcatgatttaca atgcaagataattctatgcttcagacagaaactagaaatctgttcttcct atttccgaattgatctctgtataaggtacccaacctttagctattcctgt tggtatttacctctagatttcaaaatactatgctagcttttcagtttctc acaccgagataggtagattaactgtctccaaatacatgtactttctcatg cttaggatttgtgaatatcttttgctgcatggtaagttaataggtgaact tatagctcccaatcagcatttcttaagagaaggaggtgagctgaggttat ctatctgtagattctggagagctcatgagcttcctttaaacccagaagaa tcagaataaaaatagtagcagaactattcaaagaataagaactaagctaa gaactggtggcagtcttagaagctggaaaaagctagagcatagcacggcc ctggtgtgtatcttggacttttcccagtgagacacatttatttttcggat gcctagagccataagatactcagtttgcttttatagcaccctcatgcttt gcaagtattttactgagtacagaaatctatgctgttaagtgcattttaca taattgtgatttcactggtccagcgtcgtctaattcatgacctgtacaca ctggtaggtgttatcactttggttctgagaacctgccttttactgtaaat acatctcatctgatgatttatttgccaatatcaacttgtctgccttttta taatttgtgtatttgaaataattttgttcagatgtttgaagtcctcaagt ggcccaatttattttccttaccatctttagtttttttatgctttgttttg ctatctgggagattccaacttttatattacattttatcgtcaactatttc tgtaagttaattttaccaatcacttattttaaagacccttactgaagtat ttatgcaaaatctatcccctgtgtcaatgaatatctctctctttctctga aatacagactgcagatgtacaatttctcctgattttgtctaagttctttc tctgttcaggattctctagg
quality values	Open. Hide. 46 31 22 32 62 62 52 48 52 47 41 56 56 62 41 39 56 56 56 56 42 37 56 56 62 56 47 39 51 56 59 59 56 38 44 51 39 46 59 62 62 59 59 59 59 51 59 59 59 59 62 59 62 62 62 59 59 59 62 59 59 59 59 59 51 51 51 59 62 62 59 62 62 62 62 59 59 59 59 51 56 51 59 51 59 59 54 49 59 59 59 59 59 62 59 59 62 59 62 54 59 59 59 62 62 56 62 62 62 62 59 59 46 54 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 54 49 54 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 49 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 46 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 54 58 58 54 58 58 54 58 54 58 54 58 58 58 58 58 48 58 58 54 58 45 45 58 58 58 58 54 54 46 58 58 54 54 58 58 58 54 58 58 58 54 58 58 52 58 54 58 54 58 58 58 58 58 58 58 58 54 52 51 58 58 58 38 58 58 58 58 58 58 51 49 49 58 54 58 58 58 50 58 58 53 58 58 54 48 45 39 45 58 58 46 35 58 54 58 58 58 58 46 58 58 58 53 51 40 54 58 58 50 54 58 58 58 49 35 51 52 53 53 51 54 58 39 48 58 50 58 58 58 46 50 51 51 49 58 58 58 49 52 58 58 50 49 37 50 50 50 51 58 47 50 39 58 47 39 58 49 39 58 50 50 58 52 53 53 49 31 54 53 47 27 44 39 40 49 49 52 52 54 53 49 49 49 51 51 51 32 41 42 43 39 50 54 35 44 40 38 49 53 39 37 32 49 40 52 51 33 34 37 37 39 40 45 51 51 47 40 53 37 51 25 51 40 54 37 54 54 37 37 51 27 51 39 37 34 32 31 41 47 45 51 51 40 34 33 53 40 52 33 32 53 33 32 44 29 51 32 31 53 33 53 51 52 51 33 51 49 46 28 40 31 39 37 21 31 34 25 32 23 34 45 31 46 30 31 33 42 31 31 46 37 33 41 51 51 51 30 31 37 27 42 40 19 34 31 31 31 23 42 42 31 31 31 32 34 21 29 33 36 16 21 33 36 27 33 28 42 36 30 31 48 46 26 29 30 26 38 23 33 25 27 23 28 31 17 32 16 16 31 46 24 37 29 29 23 31 35 31 31 32 48 33 21 29 31 31 22 41 26 21 32 30 36 31 31 31 23 22 43 22 21 31 26 44 44 33 25 26 16 20 15 13 24 24 14 23 8 15 24 29 34 29 25 33 34 34 24 21 14 12 23 23 30 27 17 16 13 11 25 32 17 19 32 43 24 17 36 17 25 15 25 31 21 32 48 32 27 31 25 32 27 29 30 28 32 27 13 8 18 20 10 14 16 20 20 47 47 25 9 16 28 13 20 15 16 24 12 18 17 9 21 18 28 20 28 21 27 13 34 13 8 8 6 12 21 10 10 11 5 5 6 11 8 15 3 9 18 28 9 8 21 21 21 10 11 9 11 28 19 11 18 16 22 23 14 15 3 18 28 29 18 6 15 7 13 8 21 20 10 5 22 8 15 7 9 17 12 5 5 3 3 3 5 8 6 5 12 4 6 4 4 8 6 4 4 4 2 6 4 4 13 8 10 16 5 2 3 8 18 4 12 14 10 8 27 19 14 13 5 6 11 3 9 15 21 8 15 8 4 3 2 6 7 10 4 8 12 5 5 3 5 1 2 2 1 3 18 3 3 1 2 14 7 20 4 7 1 5 4 9 5 8 13 3 3 6 4 4	Open. Hide. 46 47 51 47 62 56 44 33 51 44 50 43 38 38 34 30 44 59 59 56 46 56 59 62 62 59 50 51 59 49 59 56 59 62 62 59 62 62 62 59 59 62 59 59 59 62 59 51 56 51 51 56 62 59 51 49 50 59 50 56 56 51 59 59 46 56 59 62 59 59 48 33 40 39 59 56 51 59 62 62 62 62 62 59 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 62 62 62 62 62 54 62 59 59 59 59 62 59 51 56 48 35 50 62 50 59 62 59 59 59 59 59 62 49 49 62 59 49 59 59 59 59 59 62 62 59 62 59 59 62 62 54 59 62 62 62 62 62 62 62 62 59 62 59 59 59 59 56 54 59 59 62 62 59 62 62 62 62 62 62 59 59 51 49 56 48 56 51 62 62 59 59 59 59 59 62 59 62 59 62 56 59 59 46 59 59 54 62 62 62 62 56 62 59 62 59 59 59 59 62 62 62 59 62 59 62 62 51 56 56 56 50 59 50 59 59 56 56 56 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 56 62 62 62 62 59 59 56 56 56 59 62 62 62 62 62 62 59 62 62 62 56 62 62 62 62 59 59 59 59 59 51 62 56 62 62 62 62 62 59 59 59 59 50 59 62 51 59 51 50 50 51 62 59 51 59 59 62 56 56 56 59 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 44 62 59 59 62 62 62 62 62 62 62 62 62 59 59 51 59 59 56 56 56 62 62 62 51 62 62 56 56 56 56 56 62 62 51 62 62 56 56 56 56 56 47 56 56 56 56 56 56 56 42 62 56 56 62 56 54 56 56 50 62 62 56 62 56 56 62 62 62 62 56 56 62 56 62 56 51 62 56 56 56 56 56 56 62 56 62 62 56 62 62 62 62 62 56 62 62 62 56 54 62 56 62 62 56 62 50 62 62 62 62 62 46 56 62 62 56 56 52 52 62 62 62 52 33 48 52 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 50 62 52 54 52 52 46 52 52 48 46 52 52 58 54 54 52 52 48 52 52 46 52 41 45 49 54 54 52 51 52 52 53 53 52 48 48 54 52 58 54 52 54 52 54 58 54 52 54 54 52 52 52 52 38 38 58 33 54 46 54 49 54 49 54 52 54 54 42 58 52 52 47 54 43 49 54 54 54 53 52 51 54 49 58 58 58 58 54 48 52 51 51 50 49 48 40 58 51 51 51 48 58 58 58 58 54 47 58 51 50 54 51 58 47 45 58 58 58 42 54 49 54 51 50 52 42 52 39 50 51 48 50 53 53 51 50 51 54 51 51 54 49 41 50 50 51 54 51 52 39 38 51 51 49 51 52 39 52 54 58 50 49 54 50 51 37 28 51 51 51 41 51 51 58 58 39 47 40 32 53 47 46 41 58 40 40 51 39 41 50 39 54 43 32 39 54 50 44 50 50 51 42 40 47 38 52 52 54 44 54 54 37 42 37 54 42 53 45 51 32 53 52 44 41 51 50 20 39 31 32 53 38 41 46 46 26 51 45 27 51 37 52 33 42 37 54 54 40 32 37 40 52 33 33 32 35 42 38 39 32 51 45 51 39 52 43 42 32 36 53 31 38 26 13 52 52 39 28 52 46 20 14 40 22 33 41 42 42 34 34 40 32 33 33 47 19 45 32 34 30 32 31 45 51 40 45 31 34 34 31 30 40 38 34 33 42 31 35 32 51 42 30 31 51 36 43 31 18 15 51 51 32 36 26 42 26 34 24 36 28 33 22 46 16 23 33 33 30 28 42 33 31 32 31 34 37 31 29 36 19 46 31 23 33 29 46 31 27 31 46 46 37 31 31 27 28 25 29 38 31 35 29 29 36 31 27 21 38 44 46 46 46 46 36 32 19 26 31 25 46 30 32 26 28 41 20 19 25 32 35 25 38 24 44 43 31 31 11 28 22 38 35 30 25 18 33 17 41 36 26 33 25 28 28 25 27 32 18 32 36 36 30 13 23 32 22 21 32 18 22 34 34 32 20 36 30 20 26 34 31 30 15 20 43 16 4 20 22 48 39 14 21 19 24 13 11 16 11 21 29 12 14 32 30 40 34 27 27 40 27 10 16 8 40 20 7 10 14 19 19 20 18 14 13 6 7 19 34 6 7 10 20 24 15 21 47 15 6 3 6 18 18 26 38 40 14 7 4 5 16 9 11 6 5 5 9 11 17 9 16 22 7 3 3 5 7 4 9 23 28 5 9 15 15 10 9 18 14 14 10 4 5 3 5 12 21 16 20 15 9 9 25 5 6 12 8 15 4 3 3 2 16 9 8 11 21 6 7 23 17 28 17 12 9 6 15 23 4 14 4 9 4 9 6 25 3 4 4 5 6 21 10 6 20 8 8 2 1 3 6 5 4 5 6 6 4 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_96107068_96108200
seq2: B6Ng01-327A16.g_66_1185

seq1  GAATTCCATTATTGCATTTTTATGAAGCCAATTTGTGCTCATGATTTACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATTATTGCATTTTTATGAAGCCAATTTGTGCTCATGATTTACA  50

seq1  ATGCAAGATAATTCTATGCTTCAGACAGAAACTAGAAATCTGTTCTTCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCAAGATAATTCTATGCTTCAGACAGAAACTAGAAATCTGTTCTTCCT  100

seq1  ATTTCCGAATTGATCTCTGTATAAGGTACCCAACCTTTAGCTATTCCTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCGAATTGATCTCTGTATAAGGTACCCAACCTTTAGCTATTCCTGT  150

seq1  TGGTATTTACCTCTAGATTTCAAAATACTATGCTAGCTTTTCAGTTTCTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTATTTACCTCTAGATTTCAAAATACTATGCTAGCTTTTCAGTTTCTC  200

seq1  ACACCGAGATAGGTAGATTAACTGTCTCCAAATACATGTACTTTCTCATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCGAGATAGGTAGATTAACTGTCTCCAAATACATGTACTTTCTCATG  250

seq1  CTTAGGATTTGTGAATATCTTTTGCTGCATGGTAAGTTAATAGGTGAACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGGATTTGTGAATATCTTTTGCTGCATGGTAAGTTAATAGGTGAACT  300

seq1  TATAGCTCCCAATCAGCATTTCTTAAGAGAAGGAGGTGAGCTGAGGTTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGCTCCCAATCAGCATTTCTTAAGAGAAGGAGGTGAGCTGAGGTTAT  350

seq1  CTATCTGTAGATTCTGGAGAGCTCATGAGCTTCCTTTAAACCCAGAAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTGTAGATTCTGGAGAGCTCATGAGCTTCCTTTAAACCCAGAAGAA  400

seq1  TCAGAATAAAAATAGTAGCAGAACTATTCAAAGAATAAGAACTAAGCTAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAATAAAAATAGTAGCAGAACTATTCAAAGAATAAGAACTAAGCTAA  450

seq1  GAACTGGTGGCAGTCTTAGAAGCTGGAAAAAGCTAGAGCATAGCACGGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTGGTGGCAGTCTTAGAAGCTGGAAAAAGCTAGAGCATAGCACGGCC  500

seq1  CTGGTGTGTATCTTGGACTTTTCCCAGTGAGACACATTTATTTTTCGGAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTGTGTATCTTGGACTTTTCCCAGTGAGACACATTTATTTTTCGGAT  550

seq1  GCCTAGAGCCATAAGATACTCAGTTTGCTTTTATAGCACCCTCATGCTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTAGAGCCATAAGATACTCAGTTTGCTTTTATAGCACCCTCATGCTTT  600

seq1  GCAAGTATTTTACTGAGTACAGAAATCTATGCTGTTAAGTGCATTTTACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGTATTTTACTGAGTACAGAAATCTATGCTGTTAAGTGCATTTTACA  650

seq1  TAATTGTGATTTCACTGGTCCAGCGTCGTCTAATTCATGACCTGTACACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTGTGATTTCACTGGTCCAGCGTCGTCTAATTCATGACCTGTACACA  700

seq1  CTGGTAGGTGTTATCACTTTGGTTCTGAGAACCTGCCTTTTACTGTAAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTAGGTGTTATCACTTTGGTTCTGAGAACCTGCCTTTTACTGTAAAT  750

seq1  ACATCTCATCTGATGATTTATTTGCCAATATCAACTTGTCTGCCTTTTTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTCATCTGATGATTTATTTGCCAATATCAACTTGTCTGCCTTTTTA  800

seq1  TAATTTGTGTATTTGAAATAATTTTGTTCAGATGTTTGAAGTCCTCAAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTGTGTATTTGAAATAATTTTGTTCAGATGTTTGAAGTCCTCAAGT  850

seq1  GGCCCAATTTATTTTCCTTACCATCTTTAGTTTTTTTATGCTTTGTTTTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCAATTTATTTTCCTTACCATCTTTAGTTTTTTTATGCTTTGTTTTG  900

seq1  CTATCTGGGAGATTCCAACTTTTATATTACATTTTATCGTCAACTATTTC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTGGGAGATTCCAACTTTTATATTACATTTTATCGTCAACTATTTC  950

seq1  TGTAAGTTTAATTTTACCAATCACTTATTTTTAAAAGACCCTTACTGAAG  1000
      |||||| ||||||||||||||||||||||||  |||||||||||||||||
seq2  TGTAAG-TTAATTTTACCAATCACTTATTTT--AAAGACCCTTACTGAAG  997

seq1  TATTTATGCAAAAATTCTATCCCCTTGTGTCATATGAATATTCTTCTCTC  1050
      |||||||||||||  ||||||||| ||||||| ||||||||   ||||||
seq2  TATTTATGCAAAA--TCTATCCCC-TGTGTCA-ATGAATAT--CTCTCTC  1041

seq1  TTTCTCTGAAAATACAGACTGCAGATGTTACAATTTTCTCCTGATTTTTG  1100
      |||||||| |||||||||||||||||| ||||| |||||||||| |||||
seq2  TTTCTCTG-AAATACAGACTGCAGATG-TACAA-TTTCTCCTGA-TTTTG  1087

seq1  TCTTAGTTTCTTTCTCTG-TCAGGTTTCTCTAGG  1133
      ||| || ||||||||||| ||||| |||||||||
seq2  TCTAAG-TTCTTTCTCTGTTCAGGATTCTCTAGG  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information