MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-346D21
Chromosome	1 (Build37)
Map Location	168,007,223 - 168,159,985
singlet/doublet	doublet
Overlap gene	Dusp27, Gpa33, Mael
Upstream gene	Tbx19, Sft2d2, Tiprl, Gpr161, Iqwd1, Brp44, Sacy, Ppia-ps1-1625, Mpzl1, Rcsd1, Creg1, Cd247, Pou2f1, LOC665409
Downstream gene	LOC100039795, Tada1l, Pogk, LOC100040287, EG226601, EG226604, 4831428F09Rik, LOC240895, LOC622102, C030014K22Rik, Uck2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tbx19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83993 MGI:1891158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sft2d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108735 MGI:1917362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tiprl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226591 MGI:1915087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240888 MGI:2685054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqwd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74106 MGI:1921356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 1 Protein

name	Brp44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70456 MGI:1917706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sacy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271639 MGI:2660854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps1-1625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606514
definition	note : peptidylprolyl isomerase A pseudogene 1_1625.1 pseudo : _no_value

name	Mpzl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68481 MGI:1915731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rcsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226594 MGI:2676394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Creg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433375 MGI:1344382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd247 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12503 MGI:88334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pou2f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18986 MGI:101898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC665409 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Dusp27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240892 MGI:2685055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpa33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59290 MGI:1891703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mael (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98558 MGI:2138453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein

name	Tada1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27878 MGI:1196415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pogk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71592 MGI:1918842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 180 ESTs, 2 Proteins

name	EG226601 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226601 MGI:3643319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	EG226604 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226604 MGI:3643320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 9 Proteins

name	4831428F09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240894 MGI:3606068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC240895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:240895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC622102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 487 ESTs, 13 Proteins pseudo : _no_value

name	C030014K22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226610 MGI:2443050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uck2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80914 MGI:1931744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbx19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363972 GeneID:83993 MGI:1891158
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 19 transcript_id : NM_032005.3

name	Sft2d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802343 GeneID:108735 MGI:1917362
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SFT2 domain containing 2 transcript_id : NM_145512.3

name	Tiprl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801998 GeneID:226591 MGI:1915087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TIP41, TOR signalling pathway regulator-like (S. cerevisiae) transcript_id : NM_145513.3

name	Gpr161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487462 GeneID:240888 MGI:2685054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 161 transcript_id : NM_001081126.1

name	Iqwd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245318 GeneID:74106 MGI:1921356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 1 Protein product : IQ motif and WD repeats 1 transcript_id : XM_976438.2

name	Brp44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803058 GeneID:70456 MGI:1917706
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain protein 44 transcript_id : NM_027430.2

name	Sacy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801853 GeneID:271639 MGI:2660854
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : soluble adenylyl cyclase transcript_id : NM_173029.2

name	Mpzl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970932 GeneID:68481 MGI:1915731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin protein zero-like 1 transcript_id : NM_001001880.2

name	Mpzl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140969904 GeneID:68481 MGI:1915731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin protein zero-like 1 transcript_id : NM_001083897.1

name	Rcsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781792 GeneID:226594 MGI:2676394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RCSD domain containing 1 transcript_id : NM_001038846.1

name	Rcsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781799 GeneID:226594 MGI:2676394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RCSD domain containing 1 transcript_id : NM_178593.3

name	Creg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542419 GeneID:433375 MGI:1344382
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular repressor of E1A-stimulated genes 1 transcript_id : NM_011804.2

name	Cd247 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13624302 GeneID:12503 MGI:88334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD247 antigen transcript_id : NM_031162.1

name	Pou2f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431253 GeneID:18986 MGI:101898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 1 transcript_id : NM_198932.2

name	Pou2f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431251 GeneID:18986 MGI:101898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 1 transcript_id : NM_011137.2

name	Pou2f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431255 GeneID:18986 MGI:101898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 1 transcript_id : NM_198933.2

name	Pou2f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431257 GeneID:18986 MGI:101898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 1 transcript_id : NM_198934.2

name	Dusp27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368935 GeneID:240892 MGI:2685055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 27 (putative) transcript_id : NM_001033344.2

name	Gpa33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11037799 GeneID:59290 MGI:1891703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein A33 (transmembrane) transcript_id : NM_021610.1

name	Mael (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129866 GeneID:98558 MGI:2138453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : maelstrom homolog (Drosophila) transcript_id : NM_175296.4

name	LOC100039795 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245286 GeneID:100039795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein product : similar to C1orf32 putative protein transcript_id : XM_001473525.1

name	Tada1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981395 GeneID:27878 MGI:1196415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional adaptor 1 (HFI1 homolog, yeast) like transcript_id : NM_030245.2

name	Pogk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340927 GeneID:71592 MGI:1918842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pogo transposable element with KRAB domain transcript_id : NM_175170.2

name	LOC100040287 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245330 GeneID:100040287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 180 ESTs, 2 Proteins product : similar to ubiquinol-cytochrome c reductase subunit transcript_id : XM_001475048.1

name	EG226601 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245290 GeneID:226601 MGI:3643319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG226601 transcript_id : XM_136366.6

name	EG226604 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364498 GeneID:226604 MGI:3643320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 9 Proteins product : predicted gene, EG226604 transcript_id : XM_136368.7

name	4831428F09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351706 GeneID:240894 MGI:3606068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831428F09 gene transcript_id : NM_172844.2

name	C030014K22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63003924 GeneID:226610 MGI:2443050
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030014K22 gene transcript_id : NM_175461.3

name	Uck2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370725 GeneID:80914 MGI:1931744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uridine-cytidine kinase 2 transcript_id : NM_030724.2

name	Tbx19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14030783 CCDS:CCDS15439.1 GeneID:83993 MGI:1891158
definition	GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045165 - cell fate commitment [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : T-box 19 protein_id : NP_114394.1

name	Sft2d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704008 CCDS:CCDS15440.1 GeneID:108735 MGI:1917362
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : SFT2 domain containing 2 protein_id : NP_663487.1

name	Tiprl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704010 CCDS:CCDS15441.1 GeneID:226591 MGI:1915087
definition	codon_start : 1 product : TIP41, TOR signalling pathway regulator-like protein_id : NP_663488.1

name	Gpr161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487463 GeneID:240888 MGI:2685054
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 161 protein_id : NP_001074595.1

name	Iqwd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245319 GeneID:74106 MGI:1921356
definition	codon_start : 1 note : overriding stop codons product : IQ motif and WD repeats 1 protein_id : XP_981532.2 transl_except : (pos:complement(167281286),aa:OTHER) transl_except : (pos:complement(167281215..167281216),aa:OTHER)

name	Brp44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312594 CCDS:CCDS15442.1 GeneID:70456 MGI:1917706
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : brain protein 44 protein_id : NP_081706.1

name	Sacy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370546 GeneID:271639 MGI:2660854
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0005488 - binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : adenylate cyclase 10; testicular soluble adenylyl cyclase product : soluble adenylyl cyclase protein_id : NP_766617.1

name	Mpzl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140969905 GeneID:68481 MGI:1915731
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; protein zero-related product : myelin protein zero-like 1 isoform a protein_id : NP_001077366.1

name	Mpzl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457857 GeneID:68481 MGI:1915731
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protein zero-related product : myelin protein zero-like 1 isoform b protein_id : NP_001001880.1

name	Rcsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781793 GeneID:226594 MGI:2676394
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RCSD domain containing 1 isoform b protein_id : NP_001033935.1

name	Rcsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781800 GeneID:226594 MGI:2676394
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : RCSD domain containing 1 isoform a protein_id : NP_848708.2

name	Creg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753520 GeneID:433375 MGI:1344382
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0008134 - transcription factor binding [Evidence IDA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 product : cellular repressor of E1A-stimulated genes 1 protein_id : NP_035934.1

name	Cd247 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624303 CCDS:CCDS15443.1 GeneID:12503 MGI:88334
definition	GO_component : GO:0042105 - alpha-beta T cell receptor complex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : CD3-zeta/eta product : CD3 antigen, zeta polypeptide protein_id : NP_112439.1

name	Pou2f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431254 GeneID:18986 MGI:101898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform Z is encoded by transcript variant 2; ubiquitous transcription factor product : POU domain, class 2, transcription factor 1 isoform Z protein_id : NP_945150.2

name	Pou2f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431252 GeneID:18986 MGI:101898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant 1; ubiquitous transcription factor product : POU domain, class 2, transcription factor 1 isoform A protein_id : NP_035267.2

name	Pou2f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431256 CCDS:CCDS15444.1 GeneID:18986 MGI:101898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform L is encoded by transcript variant 3; ubiquitous transcription factor product : POU domain, class 2, transcription factor 1 isoform L protein_id : NP_945151.2

name	Pou2f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431258 GeneID:18986 MGI:101898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant 4; ubiquitous transcription factor product : POU domain, class 2, transcription factor 1 isoform B protein_id : NP_945152.2

name	Dusp27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370021 CCDS:CCDS15446.1 GeneID:240892 MGI:2685055
definition	GO_function : GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dual specificity phosphatase 27 (putative) protein_id : NP_001028516.1

name	Gpa33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11037800 CCDS:CCDS15447.1 GeneID:59290 MGI:1891703
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] codon_start : 1 note : A33 antigen product : glycoprotein A33 (transmembrane) protein_id : NP_067623.1

name	Mael (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424966 CCDS:CCDS15448.1 GeneID:98558 MGI:2138453
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : maelstrom homolog protein_id : NP_780505.1

name	LOC100039795 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245287 GeneID:100039795
definition	codon_start : 1 product : similar to C1orf32 putative protein protein_id : XP_001473575.1

name	Tada1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313610 CCDS:CCDS15450.1 GeneID:27878 MGI:1196415
definition	codon_start : 1 product : SPT3-associated factor 42 protein_id : NP_084521.1

name	Pogk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424772 GeneID:71592 MGI:1918842
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pogo transposable element with KRAB domain protein_id : NP_780379.1

name	LOC100040287 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245331 GeneID:100040287
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475098.1

name	EG226601 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245291 GeneID:226601 MGI:3643319
definition	codon_start : 1 product : flavin-containing monooxygenase 13 protein_id : XP_136366.6

name	EG226604 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883108 GeneID:226604 MGI:3643320
definition	codon_start : 1 product : flavin-containing monooxygenase 12 protein_id : XP_136368.5

name	4831428F09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370272 CCDS:CCDS15453.1 GeneID:240894 MGI:3606068
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0031227 - intrinsic to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0004499 - dimethylaniline monooxygenase (N-oxide-forming) activity [Evidence IEA]; GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0050661 - NADP binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240894 protein_id : NP_766432.1

name	C030014K22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63003925 GeneID:226610 MGI:2443050
definition	codon_start : 1 product : hypothetical protein LOC226610 protein_id : NP_780670.2

name	Uck2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507680 CCDS:CCDS15455.1 GeneID:80914 MGI:1931744
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004849 - uridine kinase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 function : phosphorylates uridine and cytidine to uridine monophosphate and cytidine monophosphate, respectively note : uridine monophosphate kinase 2; cytidine monophosphokinase 2 product : uridine-cytidine kinase 2 protein_id : NP_109649.1

name	LOC240895 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:240895
definition	number : 1 pseudo : _no_value

name	LOC240895 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:240895
definition	number : 2 pseudo : _no_value

name	LOC240895 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:240895
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:108989
definition	standard_name : G49233

name	(CDS detail)
type	STS
link
xref	UniSTS:210530
definition	standard_name : RH136548

name	(CDS detail)
type	STS
link
xref	UniSTS:167292
definition	standard_name : D1Ertd754e

name	(CDS detail)
type	STS
link
xref	UniSTS:165116
definition	standard_name : AI506168

name	(CDS detail)
type	STS
link
xref	UniSTS:128824
definition	standard_name : D1Mit453

name	(CDS detail)
type	STS
link
xref	UniSTS:128923
definition	standard_name : D1Mit63

name	(CDS detail)
type	STS
link
xref	UniSTS:92704
definition	standard_name : D1S2526

name	(CDS detail)
type	STS
link
xref	UniSTS:235276
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234256
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128907
definition	standard_name : D1Mit539.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128906
definition	standard_name : D1Mit539

name	(CDS detail)
type	STS
link
xref	UniSTS:142258
definition	standard_name : D1Mit539.2

name	(CDS detail)
type	STS
link
xref	UniSTS:165119
definition	standard_name : AI844869

name	(CDS detail)
type	STS
link
xref	UniSTS:158880
definition	standard_name : AA755314

name	(CDS detail)
type	STS
link
xref	UniSTS:128481
definition	standard_name : D1Mit144

name	(CDS detail)
type	STS
link
xref	UniSTS:124852
definition	standard_name : J03297

name	(CDS detail)
type	STS
link
xref	UniSTS:271854
definition	standard_name : PMC197251P5

name	(CDS detail)
type	STS
link
xref	UniSTS:178503
definition	standard_name : J04967

name	(CDS detail)
type	STS
link
xref	UniSTS:119905
definition	standard_name : RH94658

name	(CDS detail)
type	STS
link
xref	UniSTS:178499
definition	standard_name : AW552088

name	(CDS detail)
type	STS
link
xref	UniSTS:141281
definition	standard_name : Cd3z

name	(CDS detail)
type	STS
link
xref	UniSTS:163269
definition	standard_name : L03353

name	(CDS detail)
type	STS
link
xref	UniSTS:158879
definition	standard_name : X68362

name	(CDS detail)
type	STS
link
xref	UniSTS:108991
definition	standard_name : Pou2f1

name	(CDS detail)
type	STS
link
xref	UniSTS:273111
definition	standard_name : PMC321444P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234259
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:185456
definition	standard_name : BB116197

name	(CDS detail)
type	STS
link
xref	UniSTS:178504
definition	standard_name : AU019877

name	(CDS detail)
type	STS
link
xref	UniSTS:128763
definition	standard_name : D1Mit401

name	(CDS detail)
type	STS
link
xref	UniSTS:108988
definition	standard_name : G49232

name	(CDS detail)
type	STS
link
xref	UniSTS:167275
definition	standard_name : C86954

name	(CDS detail)
type	STS
link
xref	UniSTS:234261
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164137
definition	standard_name : AI852300

name	(CDS detail)
type	STS
link
xref	UniSTS:234258
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:108987
definition	standard_name : G49231

name	(CDS detail)
type	STS
link
xref	UniSTS:158881
definition	standard_name : C79449

name	(CDS detail)
type	STS
link
xref	UniSTS:167262
definition	standard_name : RH126668

name	(CDS detail)
type	STS
link
xref	UniSTS:125080
definition	standard_name : MHAa21c1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128915
definition	standard_name : D1Mit57.1

name	(CDS detail)
type	STS
link
xref	UniSTS:116691
definition	standard_name : D1Mit57

name	(CDS detail)
type	STS
link
xref	UniSTS:124377
definition	standard_name : 40.MMHAP67FLF4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128710
definition	standard_name : D1Mit351

name	(CDS detail)
type	STS
link
xref	UniSTS:178500
definition	standard_name : AU018180

name	(CDS detail)
type	STS
link
xref	UniSTS:158877
definition	standard_name : AI481316

name	(CDS detail)
type	STS
link
xref	UniSTS:234260
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162488
definition	standard_name : RH125730

name	(CDS detail)
type	STS
link
xref	UniSTS:210538
definition	standard_name : RH136556

name	LOC665409 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245283 GeneID:665409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to RNA polymerase II transcription factor SIII p18 subunit pseudo : _no_value transcript_id : XR_031258.1

name	LOC622102 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245341 GeneID:622102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 487 ESTs, 13 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_032092.1

clone name	MSMg01-534L01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-067J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518G13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-504P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-273P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105K16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-346D21.b	B6Ng01-346D21.g
ACC	GA128194	GA128195
length	548	1,084
definition	B6Ng01-346D21.b	B6Ng01-346D21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(168,159,434 - 168,159,985)	(168,007,223 - 168,008,303)
sequence	attagctacttaccaacttaaagactaccaactggtaacgtgttttgtgt cctgggtagtggtggctcacacctttaatcctgatgcagaggtagaggca gaagcagaaggatctctgatttcaaggccagcctggtttacagagtgagt tccagagtaaccaaggctacgacagagaaccctgtctcaaaacaaaaaca aaaacaaaacaggcgacaaaacttgtttttgcactctagagaaaagccaa catggtaaccataggcctcttaattgttgtttggcttgctcatgctttgt cctagcgtctgtacgtttatgatgctgttgacgtcttacttggttgccag gtttactttctatgacgaaagatgatggaaatgggttgggatatgttttg ttttgttttgttttttaagtttgttttctggttctgcagaaggtatttaa taaaattgttatttctttgaacaggagttacctagttgtttaaagacttg tgttagtaattgtagtataattatgttttattttggagaggtcccacc	gaattctttccttggaaaacaatgtatttttcctcactaaagtctcaaca ataaactcagatatgatgctatcaaagtccatttactggtgtgccagtaa gtttattgggcttacttacagagtataggtgagtggctatttacagaggt gtgggtgaggtcccttgtaaaatactacactgcaaagtctttagtcagta ggaatgatggttctcctataactgcatagagaatgtcccttcttttatga gagagagagagagagagagagagagagagagagagagagagattcccacg acgcttcccaccctttgcccttccttctaggaagtcagcaagtctggcta ggatgaccttttacagtcaggaacagctgaactcccaaagatggctgttg tttggcttagaggattgtcctgtacaacagctaggctaactggactgaac actgacacaagctgttatcgaagcattggcacagcgtcagtacacggcag ttactgacctcagtgttgctctattgagtgtgttttatagtagcaggcac agtaagagtatggggcagtaagtgctgttgctgacgctgaatttgcacag gctttctagaaggcaatttggcttgtattaaaggaaggtgttcttgtttt taaggtgtctatgcaccgaaattgtaactttctaatttgttctgaagaca taactggacagatgtatgttgtagccacactctcctactagggatgttga caatcaggtgtttataagtcggtgattcatctcagtgttgtttgtaacaa gcacgatgcaaaaaagaaaattaaattgtttcaataatagagattggtta aaaaacaaacaaaccagtttcagcctgaagatggactaccataaggccat tgaaattttataaacagaaaaaaaatcaacagcaactattcttccagtaa tatgctacagatagctttactaaatagcgttacttaaatatttttcttga gagacagagacagagagagacagagacagatagagacagagacagaaaga gctgagagacgagactgagaagactgagagagac
quality values	Open. Hide. 32 47 62 59 59 62 59 62 62 62 59 62 62 49 43 62 62 62 62 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 54 54 54 62 62 62 62 62 56 59 49 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 62 59 56 46 44 44 51 59 44 35 44 44 18 30 30 14 12 39 43 41 59 34 43 44 44 43 30 34 32 24 28 44 28 28 43 56 35 42 32 44 16 14 14 15 14 32 56 32 15 32 18 16 36 44 24 14 11 14 7 13 10 10 10 20 33 18 10 10 6 10 14 38 38 56 39 31 29 30 32 33 24 22 17 24 17 22 38 33 40 56 15 20 14 19 20 34 27 14 17 17 9 21 20 21 14 21 12 21 24 9 17 9 8 10 18 22 22 17 20 12 23 19 13 5 8 10	Open. Hide. 62 47 37 43 62 62 62 62 62 59 62 59 59 43 33 37 43 54 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 59 54 49 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 56 59 59 56 43 56 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 59 62 59 62 62 49 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 47 62 62 62 62 56 56 62 56 62 56 56 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 54 54 58 58 58 58 58 52 58 58 58 58 58 54 58 54 58 58 58 54 54 58 54 58 58 52 54 58 52 58 58 54 54 48 58 58 54 58 54 54 54 54 54 52 49 54 52 47 58 41 52 54 58 52 58 54 52 54 54 23 41 33 52 46 58 58 54 54 52 52 54 54 58 52 29 47 52 48 39 47 42 45 58 40 30 58 52 58 49 49 40 42 58 58 37 58 58 58 49 37 51 49 58 37 51 49 47 52 41 51 40 41 37 50 47 35 50 58 42 48 58 58 52 40 52 50 44 50 51 50 50 32 42 53 58 58 30 25 38 32 52 50 50 49 42 37 39 31 51 32 53 53 53 51 58 31 49 52 49 39 31 58 50 50 42 58 33 43 58 50 53 32 43 49 31 54 40 51 49 50 53 34 53 53 52 49 37 40 12 25 44 32 27 49 41 45 52 49 32 41 38 39 42 24 6 10 28 51 25 54 52 42 28 10 46 44 45 39 33 33 21 37 39 23 54 40 34 53 52 54 40 37 28 15 38 35 40 52 31 54 51 35 34 53 42 45 37 41 47 40 26 40 32 42 37 32 22 18 45 49 49 40 30 14 31 47 49 14 16 52 7 46 6 9 33 31 18 45 11 26 23 31 29 32 15 29 30 31 51 24 32 29 30 43 20 24 27 18 51 51 51 51 28 16 32 32 29 30 31 42 31 36 24 31 26 36 48 32 34 22 29 30 27 19 31 30 33 32 43 28 41 46 31 28 30 32 22 28 25 31 26 8 8 18 13 18 19 13 17 19 17 38 19 25 46 44 31 17 32 26 37 29 30 29 31 27 46 41 44 44 41 44 33 26 22 19 32 31 31 32 32 29 14 25 22 11 9 19 20 10 34 11 21 19 31 30 31 22 21 19 23 32 34 32 26 28 16 18 32 31 31 26 17 17 43 31 20 21 32 19 43 22 4 9 27 26 32 19 22 16 21 10 14 32 43 22 32 9 7 43 43 48 21 21 14 30 20 21 13 20 10 11 18 17 13 21 9 10 16 5 10 9 7 21 7 16 11 18 14 5 6 9 4 4 7 9 17 8 17 17 13 21 6 5 11 8 27 14 5 8 9 5 9 7 6 3 4 6 27 5 3 3 22 10 21 17 14 7 2 4 12 8 22 5 17 12 4 4 1 3 4 9 6 9 9 4 5 4 5 6 6 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_168159434_168159985
seq2: B6Ng01-346D21.b_45_598 (reverse)

seq1  GGTGGGACCTCTCCAAA--TAAACATAATTATACTACAATTACTAACACA  48
      |||||||||||||||||   ||||||||||||||||||||||||||||||
seq2  GGTGGGACCTCTCCAAAATAAAACATAATTATACTACAATTACTAACACA  50

seq1  AGTCTTTAAACAACTAGGTAACTCCTGTTCAAAGAAATAACAATTTTATT  98
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTTAAACAACTAGGTAACTCCTGTTCAAAGAAATAACAATTTTATT  100

seq1  AAATACCTTCTGCAGAACCAGAAAACAAACTTAAAAAACAAAACAAAACA  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACCTTCTGCAGAACCAGAAAACAAACTTAAAAAACAAAACAAAACA  150

seq1  AAACATATCCCAACCCATTTCCATCATCTTTCGTCATAGAAAGTAAACCT  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATATCCCAACCCATTTCCATCATCTTTCGTCATAGAAAGTAAACCT  200

seq1  GGCAACCAAGTAAGACGTCAACAGCATCATAAACGTACAGACGCTAGGAC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAACCAAGTAAGACGTCAACAGCATCATAAACGTACAGACGCTAGGAC  250

seq1  AAAGCATGAGCAAGCCAAACAACAATTAAGAGGCCTATGGTTACCATGTT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCATGAGCAAGCCAAACAACAATTAAGAGGCCTATGGTTACCATGTT  300

seq1  GGCTTTTCTCTAGAGTGCAAAAACAAGTTTTGTCGCCTGTTTTGTTTTTG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTTCTCTAGAGTGCAAAAACAAGTTTTGTCGCCTGTTTTGTTTTTG  350

seq1  TTTTTGTTTTGAGACAGGGTTCTCTGTCGTAGCCTTGGTTACTCTGGAAC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTGTTTTGAGACAGGGTTCTCTGTCGTAGCCTTGGTTACTCTGGAAC  400

seq1  TCACTCTGTAAACCAGGCTGGCCTTGAAATCAGAGATCCTTCTGCTTCTG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCTGTAAACCAGGCTGGCCTTGAAATCAGAGATCCTTCTGCTTCTG  450

seq1  CCTCTACCTCTGCATCAGGATTAAAGGTGTGAGCCACCACTACCCAGGAC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTACCTCTGCATCAGGATTAAAGGTGTGAGCCACCACTACCCAGGAC  500

seq1  ACAAAACACGTTACCAGTTGGTAGTCTTTAAGTTGGTAAGTAGCTAATGA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAACACGTTACCAGTTGGTAGTCTTTAAGTTGGTAAGTAGCTAATGA  550

seq1  ATTC  552
      ||||
seq2  ATTC  554

seq1: chr1_168007223_168008303
seq2: B6Ng01-346D21.g_68_1151

seq1  GAATTCTTTCCTTGGAAAACAATGTATTTTTCCTCACTAAAGTCTCAACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCCTTGGAAAACAATGTATTTTTCCTCACTAAAGTCTCAACA  50

seq1  ATAAACTCAGATATGATGCTATCAAAGTCCATTTACTGGTGTGCCAGTAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAACTCAGATATGATGCTATCAAAGTCCATTTACTGGTGTGCCAGTAA  100

seq1  GTTTATTGGGCTTACTTACAGAGTATAGGTGAGTGGCTATTTACAGAGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTATTGGGCTTACTTACAGAGTATAGGTGAGTGGCTATTTACAGAGGT  150

seq1  GTGGGTGAGGTCCCTTGTAAAATACTACACTGCAAAGTCTTTAGTCAGTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGTGAGGTCCCTTGTAAAATACTACACTGCAAAGTCTTTAGTCAGTA  200

seq1  GGAATGATGGTTCTCCTATAACTGCATAGAGAATGTCCCTTCTTTTATGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATGATGGTTCTCCTATAACTGCATAGAGAATGTCCCTTCTTTTATGA  250

seq1  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGATTCCCACG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGATTCCCACG  300

seq1  ACGCTTCCCACCCTTTGCCCTTCCTTCTAGGAAGTCAGCAAGTCTGGCTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCTTCCCACCCTTTGCCCTTCCTTCTAGGAAGTCAGCAAGTCTGGCTA  350

seq1  GGATGACCTTTTACAGTCAGGAACAGCTGAACTCCCAAAGATGGCTGTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGACCTTTTACAGTCAGGAACAGCTGAACTCCCAAAGATGGCTGTTG  400

seq1  TTTGGCTTAGAGGATTGTCCTGTACAACAGCTAGGCTAACTGGACTGAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGCTTAGAGGATTGTCCTGTACAACAGCTAGGCTAACTGGACTGAAC  450

seq1  ACTGACACAAGCTGTTATCGAAGCATTGGCACAGCGTCAGTACACGGCAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACACAAGCTGTTATCGAAGCATTGGCACAGCGTCAGTACACGGCAG  500

seq1  TTACTGACCTCAGTGTTGCTCTATTGAGTGTGTTTTATAGTAGCAGGCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTGACCTCAGTGTTGCTCTATTGAGTGTGTTTTATAGTAGCAGGCAC  550

seq1  AGTAAGAGTATGGGGCAGTAAGTGCTGTTGCTGACGCTGAATTTGCACAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAGAGTATGGGGCAGTAAGTGCTGTTGCTGACGCTGAATTTGCACAG  600

seq1  GCTTTCTAGAAGGCAATTTGGCTTGTATTAAAGGAAGGTGTTCTTGTTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTCTAGAAGGCAATTTGGCTTGTATTAAAGGAAGGTGTTCTTGTTTT  650

seq1  TAAGGTGTCTATGCACCGAAATTGTAACTTTCTAATTTGTTCTGAAGACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGTGTCTATGCACCGAAATTGTAACTTTCTAATTTGTTCTGAAGACA  700

seq1  TAACTGGACAGATGTATGTTGTAGCCACACTCTCCTACTAGGGATGTTGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTGGACAGATGTATGTTGTAGCCACACTCTCCTACTAGGGATGTTGA  750

seq1  CAATCAGGTGTTTATAAGTCGGTGATTCATCTCAGTGTTGTTTGTAACAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATCAGGTGTTTATAAGTCGGTGATTCATCTCAGTGTTGTTTGTAACAA  800

seq1  GCACGATGCAAAAAAGAAAATT-AATTG-TTCAATAATAGAGATTGGTTA  848
      |||||||||||||||||||||| ||||| |||||||||||||||||||||
seq2  GCACGATGCAAAAAAGAAAATTAAATTGTTTCAATAATAGAGATTGGTTA  850

seq1  AAAAACAAACAAACCAGTTTCAGCCTGAAGATGGACTACCATAAGGCCAT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACAAACAAACCAGTTTCAGCCTGAAGATGGACTACCATAAGGCCAT  900

seq1  TGAAATTTTATAAACAG-AAAAAAATCAACAGCAACTA-TCTTCCAGTAA  946
      ||||||||||||||||| |||||||||||||||||||| |||||||||||
seq2  TGAAATTTTATAAACAGAAAAAAAATCAACAGCAACTATTCTTCCAGTAA  950

seq1  TATGCTACAGATAGCTTTACTAAATAGCGTTAC-TAAATA-TTTTCTTGA  994
      ||||||||||||||||||||||||||||||||| |||||| |||||||||
seq2  TATGCTACAGATAGCTTTACTAAATAGCGTTACTTAAATATTTTTCTTGA  1000

seq1  GAGACAGAGACAGAGAGAGACAGAGACAGATAGAGACAGAGACAGATAGA  1044
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GAGACAGAGACAGAGAGAGACAGAGACAGATAGAGACAGAGACAGAAAGA  1050

seq1  GGCAGAGAGACAGAGACAGAGAGAGACAGAGAGAGAC  1081
       || ||||||| ||||| |||| |||| |||||||||
seq2  -GCTGAGAGAC-GAGACTGAGA-AGACTGAGAGAGAC  1084

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information