MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-115C19
Chromosome	1 (Build37)
Map Location	89,594,427 - 89,594,929
singlet/doublet	singlet
Overlap gene	Inpp5d
Upstream gene	4930429A22Rik, EG620213, LOC208256, Akp5, Alpi, Akp3, Ecel1, 1700027L20Rik, Chrnd, Chrng, Eif4e2, Efhd1, Tnrc15, LOC100040600, LOC100040591, 3110079O15Rik, Ngef, LOC620454, Neu2
Downstream gene	Atg16l1, Sag, Usp40, LOC545344, LOC677561, Ugt1a@, Ugt1a10, Ugt1a9, Ugt1a7c, Ugt1a6a, Ugt1a6b, Ugt1a5, Ugt1a2, Dnajb3, Ugt1a1, LOC100040766, 6430706D22Rik, LOC100038822, Trpm8, Spp2, Glrp1, Arl4c
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930429A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208718 MGI:2442555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620213 MGI:3646897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1749 ESTs, 8 Proteins

name	LOC208256 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:208256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Akp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11650 MGI:108009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76768 MGI:1924018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11648 MGI:87984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13599 MGI:1343461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027L20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69453 MGI:1916703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 25 Proteins

name	Chrnd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11447 MGI:87893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11449 MGI:87895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4e2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Efhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98363 MGI:1921607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227331 MGI:2138584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040600 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100040591 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 23 Proteins

name	3110079O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73234 MGI:1920484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins

name	Ngef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53972 MGI:1858414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 201 ESTs

name	Neu2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23956 MGI:1344417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inpp5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16331 MGI:107357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg16l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77040 MGI:1924290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20215 MGI:98227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227334 MGI:2443184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs, 23 Proteins pseudo : _no_value

name	LOC677561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	Ugt1a@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:394431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 8 mRNAs

name	Ugt1a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394430 MGI:3580642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394434 MGI:3576092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a7c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394432 MGI:3032636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94284 MGI:2137698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394435 MGI:3580629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394433 MGI:3032634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22236 MGI:3576049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15504 MGI:1306822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394436 MGI:98898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 2 Proteins

name	6430706D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381280 MGI:2685821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpm8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171382 MGI:2181435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75396 MGI:1922646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14659 MGI:108038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320982 MGI:2445172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930429A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24233555 GeneID:208718 MGI:2442555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930429A22 gene transcript_id : NM_153530.1

name	EG620213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363805 GeneID:620213 MGI:3646897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1748 ESTs, 8 Proteins product : predicted gene, EG620213 transcript_id : XM_885296.2

name	Akp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244097 GeneID:11650 MGI:108009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 5 transcript_id : NM_007433.3

name	Alpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487322 GeneID:76768 MGI:1924018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase, intestinal transcript_id : NM_001081082.1

name	Akp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347478 GeneID:11648 MGI:87984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 3, intestine, not Mn requiring transcript_id : NM_007432.2

name	Ecel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254535 GeneID:13599 MGI:1343461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelin converting enzyme-like 1 transcript_id : NM_021306.2

name	1700027L20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234183 GeneID:69453 MGI:1916703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 25 Proteins product : RIKEN cDNA 1700027L20 gene transcript_id : XM_487606.5

name	Chrnd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225334 GeneID:11447 MGI:87893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, delta polypeptide transcript_id : NM_021600.2

name	Chrng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964695 GeneID:11449 MGI:87895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, gamma polypeptide transcript_id : NM_009604.3

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677505 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_023314.3

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677509 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_001039170.1

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677507 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_001039169.1

name	Efhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891752 GeneID:98363 MGI:1921607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF hand domain containing 1 transcript_id : NM_028889.2

name	Tnrc15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382552 GeneID:227331 MGI:2138584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 15 transcript_id : NM_146112.3

name	LOC100040600 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234202 GeneID:100040600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Tnrc15 protein transcript_id : XM_001475127.1

name	LOC100040591 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234200 GeneID:100040591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 23 Proteins product : similar to inward rectifier potassium channel Kir7.1 transcript_id : XM_001475110.1

name	3110079O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363811 GeneID:73234 MGI:1920484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins product : RIKEN cDNA 3110079O15 gene transcript_id : XM_978146.1

name	Ngef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845276 GeneID:53972 MGI:1858414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal guanine nucleotide exchange factor transcript_id : NM_019867.1

name	LOC620454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234206 GeneID:620454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 201 ESTs product : hypothetical LOC620454 transcript_id : XM_001475262.1

name	Neu2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361584 GeneID:23956 MGI:1344417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuraminidase 2 transcript_id : NM_015750.2

name	Inpp5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754355 GeneID:16331 MGI:107357
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase D transcript_id : NM_010566.1

name	Atg16l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350336 GeneID:77040 MGI:1924290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 16-like 1 (yeast) transcript_id : NM_029846.3

name	Sag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980544 GeneID:20215 MGI:98227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinal S-antigen transcript_id : NM_009118.2

name	Usp40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893155 GeneID:227334 MGI:2443184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 40 transcript_id : NM_001033291.2

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:47059120 GeneID:394431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_201641.1

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:47059130 GeneID:394431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_201644.1

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:141803423 GeneID:394431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_201642.3

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:33186905 GeneID:394431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_145079.2

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:47059132 GeneID:394431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_201410.1

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:47059126 GeneID:394431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_201643.1

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142367713 GeneID:394431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_013701.2

name	Dnajb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362206 GeneID:15504 MGI:1306822
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 3 transcript_id : NM_008299.2

name	Ugt1a@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:47059134 GeneID:394431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glycosyltransferase 1 family, polypeptide A cluster transcript_id : NM_201645.1

name	LOC100040766 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234211 GeneID:100040766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 2 Proteins product : similar to hCG2012694 transcript_id : XM_001475729.1

name	6430706D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348539 GeneID:381280 MGI:2685821
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430706D22 gene transcript_id : NM_198652.1

name	LOC100038822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234177 GeneID:100038822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038822 transcript_id : XM_001471840.1

name	Trpm8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729789 GeneID:171382 MGI:2181435
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily M, member 8 transcript_id : NM_134252.2

name	Spp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368372 GeneID:75396 MGI:1922646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted phosphoprotein 2 transcript_id : NM_029269.2

name	Glrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709817 GeneID:14659 MGI:108038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine repeat protein 1 transcript_id : NM_008132.2

name	Arl4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461999 GeneID:320982 MGI:2445172
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 4C transcript_id : NM_177305.3

name	4930429A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233556 CCDS:CCDS15124.1 GeneID:208718 MGI:2442555
definition	GO_function : GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208718 protein_id : NP_705758.1

name	EG620213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880886 GeneID:620213 MGI:3646897
definition	codon_start : 1 product : similar to ribosomal protein L6 protein_id : XP_890389.1

name	Akp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244098 CCDS:CCDS15126.1 GeneID:11650 MGI:108009
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase 5 protein_id : NP_031459.3

name	Alpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487323 GeneID:76768 MGI:1924018
definition	GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase, intestinal protein_id : NP_001074551.1

name	Akp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347479 CCDS:CCDS15127.1 GeneID:11648 MGI:87984
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase 3, intestine, not Mn requiring protein_id : NP_031458.2

name	Ecel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254536 CCDS:CCDS15128.1 GeneID:13599 MGI:1343461
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IDA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : damage-induced neuronal endopeptidase protein_id : NP_067281.2

name	1700027L20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363810 GeneID:69453 MGI:1916703
definition	codon_start : 1 product : hypothetical protein LOC69453 protein_id : XP_487606.4

name	Chrnd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225335 CCDS:CCDS15129.1 GeneID:11447 MGI:87893
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor delta product : cholinergic receptor, nicotinic, delta polypeptide protein_id : NP_067611.2

name	Chrng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964696 GeneID:11449 MGI:87895
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor gamma product : cholinergic receptor, nicotinic, gamma polypeptide protein_id : NP_033734.3

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677506 CCDS:CCDS15130.1 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 3 protein_id : NP_075803.2

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677510 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 1 protein_id : NP_001034259.1

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677508 CCDS:CCDS15131.1 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 2 protein_id : NP_001034258.1

name	Efhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386360 CCDS:CCDS15132.1 GeneID:98363 MGI:1921607
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0031175 - neurite development [Evidence IMP] codon_start : 1 product : EF hand domain containing 1 protein_id : NP_083165.1

name	LOC100040600 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234203 GeneID:100040600
definition	codon_start : 1 product : similar to Tnrc15 protein protein_id : XP_001475177.1

name	Tnrc15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34365797 CCDS:CCDS15133.1 GeneID:227331 MGI:2138584
definition	codon_start : 1 exception : mismatches in translation product : Grb10 interacting GYF protein 2 protein_id : NP_666224.2

name	LOC100040591 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234201 GeneID:100040591
definition	codon_start : 1 product : similar to inward rectifier potassium channel Kir7.1 protein_id : XP_001475160.1

name	3110079O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363812 GeneID:73234 MGI:1920484
definition	codon_start : 1 product : hypothetical protein LOC73234 protein_id : XP_983240.1

name	Ngef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845277 GeneID:53972 MGI:1858414
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 function : guanine nucleotide exchange factor for Rho-type GTPases note : transforming immortalised mammary epithelial sequence 2 product : neuronal guanine nucleotide exchange factor protein_id : NP_063920.1

name	LOC620454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234207 GeneID:620454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475312.1

name	Neu2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657375 CCDS:CCDS15135.1 GeneID:23956 MGI:1344417
definition	GO_function : GO:0004308 - exo-alpha-sialidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : brain sialidase; cystolic sialidase product : neuraminidase 2 protein_id : NP_056565.1

name	Inpp5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754356 GeneID:16331 MGI:107357
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008340 - determination of adult life span [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IMP]; GO:0050869 - negative regulation of B cell activation [Evidence IMP]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0045779 - negative regulation of bone resorption [Evidence IMP]; GO:0030853 - negative regulation of granulocyte differentiation [Evidence IMP]; GO:0050777 - negative regulation of immune response [Evidence IMP]; GO:0045409 - negative regulation of interleukin-6 biosynthesis [Evidence IMP]; GO:0045656 - negative regulation of monocyte differentiation [Evidence IMP]; GO:0045659 - negative regulation of neutrophil differentiation [Evidence IMP]; GO:0045671 - negative regulation of osteoclast differentiation [Evidence IMP]; GO:0009968 - negative regulation of signal transduction [Evidence IMP]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0045579 - positive regulation of B cell differentiation [Evidence IMP]; GO:0045648 - positive regulation of erythrocyte differentiation [Evidence IMP]; GO:0045621 - positive regulation of lymphocyte differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : inositol polyphosphate-5-phosphatase, 145 kDa; Src homology 2 domain-containing inositol-5-phosphatase; SH2-containing inositol phosphatase SHIP; SH2 containing inositol phosphotase product : inositol polyphosphate-5-phosphatase D protein_id : NP_034696.1

name	Atg16l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777650 CCDS:CCDS15136.1 GeneID:77040 MGI:1924290
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000045 - autophagic vacuole formation [Evidence TAS]; GO:0006914 - autophagy [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta isoform is encoded by transcript variant b; autophagy 16-like; APG16 autophagy 16-like product : APG16L beta isoform protein_id : NP_084122.2

name	Sag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677845 GeneID:20215 MGI:98227
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0002046 - opsin binding [Evidence IDA]; GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : retinal S-antigen protein_id : NP_033144.1

name	Usp40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794623 CCDS:CCDS15137.1 GeneID:227334 MGI:2443184
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 40 product : ubiquitin specific peptidase 40 protein_id : NP_001028463.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:47059121 GeneID:394431
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP glycosyltransferase 1 family polypeptide A13 product : UDP glycosyltransferase 1 family, polypeptide A10 protein_id : NP_964003.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:47059131 CCDS:CCDS15138.1 GeneID:394431
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP glycosyltransferase 1 family polypeptide A12 product : UDP glucuronosyltransferase 1 family, polypeptide A9 protein_id : NP_964006.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:47059123 CCDS:CCDS15139.1 GeneID:394431
definition	GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : UDP glycosyltransferase 1 family, polypeptide A10; UDP glucuronosyltransferase 1 family, polypeptide A10 product : UDP glucuronosyltransferase 1 family, polypeptide A7C protein_id : NP_964004.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:33186906 GeneID:394431
definition	EC_number : 2.4.1.17 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0019585 - glucuronate metabolism [Evidence IDA] [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : UDP glycosyltransferase 1 family, polypeptide A6 product : UDP glucuronosyltransferase 1 family, polypeptide A6A protein_id : NP_659545.2

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:47059133 GeneID:394431
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : UDP glycosyltransferase 1 family polypeptide A9 product : UDP glucuronosyltransferase 1 family, polypeptide A6B protein_id : NP_958812.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:47059127 GeneID:394431
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP glycosyltransferase 1 family, polypeptide A5 product : UDP glucuronosyltransferase 1 family, polypeptide A5 protein_id : NP_964005.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:32526871 CCDS:CCDS15141.1 GeneID:394431
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : UDP-glucuronosyltransferase 1 family, member 2; UDP-glucuronosyltransferase 1 family, polypeptide A2 product : UDP glucuronosyltransferase 1 family, polypeptide A2 protein_id : NP_038729.1

name	Dnajb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680299 CCDS:CCDS15142.1 GeneID:15504 MGI:1306822
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heat shock protein, DNAJ-like 3 product : DnaJ (Hsp40) homolog, subfamily B, member 3 protein_id : NP_032325.1

name	Ugt1a@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:47059135 CCDS:CCDS15143.1 GeneID:394431
definition	EC_number : 2.4.1.17 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP-glucuronosyltransferase 1 family, member 1; UDP-glucuronosyltransferase 1 family, polypeptide A1 product : UDP glucuronosyltransferase 1 family, polypeptide A1 protein_id : NP_964007.1

name	LOC100040766 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234212 GeneID:100040766
definition	codon_start : 1 product : similar to hCG2012694 protein_id : XP_001475779.1

name	LOC100038822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234178 GeneID:100038822
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471890.1

name	6430706D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348540 CCDS:CCDS15144.1 GeneID:381280 MGI:2685821
definition	codon_start : 1 exception : mismatches in translation note : fetal liver expressing gene 1 product : hypothetical protein LOC381280 protein_id : NP_941054.1

name	Trpm8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527416 GeneID:171382 MGI:2181435
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0009409 - response to cold [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0009266 - response to temperature stimulus [Evidence IDA]; GO:0050955 - thermoception [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRP ion channel TRPM8 product : transient receptor potential cation channel, subfamily M, member 8 protein_id : NP_599013.1

name	Spp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15082218 CCDS:CCDS15145.1 GeneID:75396 MGI:1922646
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0046849 - bone remodeling [Evidence IEA] codon_start : 1 note : secreted phosphoprotein 2, 24kDa product : secreted phosphoprotein 24 protein_id : NP_083545.1

name	Glrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119709818 GeneID:14659 MGI:108038
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IEA] codon_start : 1 product : glutamine repeat protein 1 protein_id : NP_032158.2

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 1 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 2 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 3 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 4 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 5 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 6 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 7 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 8 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 9 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 10 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 11 pseudo : _no_value

name	LOC677561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677561
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:167298
definition	standard_name : D1Ertd816e

name	(CDS detail)
type	STS
link
xref	UniSTS:210453
definition	standard_name : RH136468

name	(CDS detail)
type	STS
link
xref	UniSTS:178430
definition	standard_name : C77216

name	(CDS detail)
type	STS
link
xref	UniSTS:207187
definition	standard_name : BE199888

name	(CDS detail)
type	STS
link
xref	UniSTS:271950
definition	standard_name : PMC207564P2

name	(CDS detail)
type	STS
link
xref	UniSTS:271949
definition	standard_name : PMC207564P1

name	(CDS detail)
type	STS
link
xref	UniSTS:246003
definition	standard_name : AW527169

name	(CDS detail)
type	STS
link
xref	UniSTS:158824
definition	standard_name : L10076

name	(CDS detail)
type	STS
link
xref	UniSTS:141010
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:128857
definition	standard_name : D1Mit49

name	(CDS detail)
type	STS
link
xref	UniSTS:128880
definition	standard_name : D1Mit51.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128879
definition	standard_name : D1Mit51

name	(CDS detail)
type	STS
link
xref	UniSTS:141009
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:238129
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:141011
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:178431
definition	standard_name : AV129531

name	(CDS detail)
type	STS
link
xref	UniSTS:163257
definition	standard_name : AI036339

name	(CDS detail)
type	STS
link
xref	UniSTS:178429
definition	standard_name : AI452351

name	(CDS detail)
type	STS
link
xref	UniSTS:207188
definition	standard_name : AW822015

name	(CDS detail)
type	STS
link
xref	UniSTS:207189
definition	standard_name : AU024213

name	(CDS detail)
type	STS
link
xref	UniSTS:165993
definition	standard_name : AI852361

name	(CDS detail)
type	STS
link
xref	UniSTS:220713
definition	standard_name : RH138626

name	(CDS detail)
type	STS
link
xref	UniSTS:178428
definition	standard_name : AW259676

name	(CDS detail)
type	STS
link
xref	UniSTS:144630
definition	standard_name : Tims2

name	(CDS detail)
type	STS
link
xref	UniSTS:125527
definition	standard_name : R74947

name	(CDS detail)
type	STS
link
xref	UniSTS:144629
definition	standard_name : Tims2

name	(CDS detail)
type	STS
link
xref	UniSTS:164895
definition	standard_name : Ngef

name	(CDS detail)
type	STS
link
xref	UniSTS:234169
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178427
definition	standard_name : AI323613

name	(CDS detail)
type	STS
link
xref	UniSTS:211834
definition	standard_name : RH128526

name	(CDS detail)
type	STS
link
xref	UniSTS:234167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158821
definition	standard_name : AA960512

name	(CDS detail)
type	STS
link
xref	UniSTS:161592
definition	standard_name : RH124770

name	(CDS detail)
type	STS
link
xref	UniSTS:162566
definition	standard_name : RH125821

name	(CDS detail)
type	STS
link
xref	UniSTS:268029
definition	standard_name : MARC_16423-16424:1018632150:1

name	(CDS detail)
type	STS
link
xref	UniSTS:209981
definition	standard_name : RH135985

name	(CDS detail)
type	STS
link
xref	UniSTS:159352
definition	standard_name : AI035639

name	(CDS detail)
type	STS
link
xref	UniSTS:163169
definition	standard_name : RH126461

name	(CDS detail)
type	STS
link
xref	UniSTS:158822
definition	standard_name : M24086

name	(CDS detail)
type	STS
link
xref	UniSTS:124943
definition	standard_name : M24086

name	(CDS detail)
type	STS
link
xref	UniSTS:498517
definition	standard_name : Dgkd

name	(CDS detail)
type	STS
link
xref	UniSTS:165086
definition	standard_name : AI841987

name	(CDS detail)
type	STS
link
xref	UniSTS:271249
definition	standard_name : PMC153064P1

name	(CDS detail)
type	STS
link
xref	UniSTS:123784
definition	standard_name : 27.MMHAP42FLA6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128853
definition	standard_name : D1Mit486

name	(CDS detail)
type	STS
link
xref	UniSTS:143223
definition	standard_name : Glrp1

name	(CDS detail)
type	STS
link
xref	UniSTS:125754
definition	standard_name : U46463

name	(CDS detail)
type	STS
link
xref	UniSTS:128845
definition	standard_name : D1Mit48

name	LOC545344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234210 GeneID:545344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs, 23 Proteins product : similar to karyopherin (importin) alpha 2 pseudo : _no_value transcript_id : XR_032285.1

clone name	MSMg01-502C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376J03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-157O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-511H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-474H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-135O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355N21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-173O24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-115C19.T7 (MSMg01no115_c19.b1)	MSMg01-115C19.TJ (MSMg01no115_c19.g1)
ACC	AG326870	AG326871
length	1,084	713
length of high quality (start - end)	---	513 (81 - 593)
definition	CHROMAT_FILE: MSMg01no115_c19.b1 PHD_FILE: MSMg01no115_c19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:21:03 2005	CHROMAT_FILE: MSMg01no115_c19.g1 PHD_FILE: MSMg01no115_c19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:21:03 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TGCTGACTTTGGGTTATGGGGGCATGTAGTGATATTATAGACGAAGGATG TGAGCGACCGATGAAACGAATACCGCCCGTCGGGAACGCGTTGGCTCGCT TATGGCAGCAGTAACAATAAATGAGGAACGGTTTACGCAAGTGGATCAAT ATCTTTGAAGCGACTGTAAATAATACACGGCGAACTGGAAGAAGGGAGAC GACCCACATCGTAGGTGTTTATCTTTCCCTCGACATAGCGCTTATTCACC CCCTCCAACCTTGACCCCCTCGTTGAATCTCCATTGCCCCCCGCCGCCTT CCGAACTTAACCCACGATATAACCCTTATTTTATATGCGCCGCCCGACGA TATGCTGATATTACACGATTCCCTTGTGTTTGCGTGACCTGCACAATGAC ACCCACTTCTTTTATGCGCTGATTGCGGGCAATACTTAACGCAAGCCACG GGGGATACGGTATCGGAACACGAGACCGCTTATAACCAATTCTACACGCT TATTACCCTTATACCAATACCGTCGAAATCGTTTTTTCGTTACCCTTACC CTCCGTGCCCCCCTTCATCGCACCCTATCATGTTTTGTGCGGACCCCATT ACCCGATTTGATTCTTATAGACTGTACGCTCCGCGCGAACATAAGTCGTC CGTTGGTTCCCCGACGTACCCGGCCCACATTTTTTACGCTACGACCGCAA TGGCATCGCGCGAATAAACGAACGCCGCAAATTCTCACGTAATAAATATA GTATTTTATTCGCGCCTCCGCCCCTACTAACCATACCGCCTGACTCGGAA TATATCGCGGGGCCGAATAACGCGCGCCCCTTTTCTTTCCGGCCGCTTTT TTTCCGCATTGGTTTTTCCGTCCCGTATATATCGCTTAACGGCGGCCAGC ATAATGGGATATTAATAGCGCCGTTATTTATCCGCCCTCAAATGCACAGT TTCGGCATGTGATCTATTTAGCCCCTCCGCGCCTATCTGAACAACGTTTT TCGTATTTACACCGCCCGGAATATACCGCGGGGATGAACAAGGTGGATAA TCGTAGGCGCCCATATATATAGGCGGGTTATTTG	CCTTTCCTCGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGGGCAGCCAGGGCTATACA GAGAAAAAAACCAAAAAGAAAAAAAAAGAAAAGAAAAAGAATAATATTTA CTTCCTAGATGCATTTTCAGTCCCAGTTCTCATCTCTGAGGTGCTTTGTC TCATTTCTAGGCATTGTTGGAAGTTCCCCCTGAAAGCTAGGAAATACAGA CAGGGTGTCTTACTCCCAGGGTGGAACCGGGGTGCATGTTCAGGGTTCCA AAGGTGTACCTCAGTCCTGTGTTGCAACACCATCTCCCACCACCACCACC AGGTTGCCATCCACACCCTCTGGAACATTCGCATAGTGGTGCTTGCCAAG CCAGAGCATGAGAATCGGATCAGCCATATCTGCACTGACAACGTGAAGAC AGGCATCGCCAACACCCTGGGTGAGCATAGAGGGAAAGCCATTCCTGTGC ATGCTCTCCTCTTCCTCCTTTTGGCAATGTCCCAGGATAAACCATGAGAG TCCTGTCTTGGGATCCCTTCGTCTCTAGCAAATCCAGATGGTTTTCCTTG CTAAAACTCATCCAGGGTCTTATCCAGCTCTGGCAATCTGGCTAAAATGC GGGTTCTGTCTCAGTAAGTCTCAAATGGTTTCCATTCTGGCAAGCCTTCC TGTGACATAATGC
quality values	Open. Hide. 8 10 8 8 8 8 8 11 11 12 12 11 11 11 11 11 11 11 10 10 15 12 12 12 9 9 9 9 9 10 10 10 15 8 8 6 6 8 8 8 8 8 8 8 8 6 8 8 8 8 8 6 6 6 6 6 6 11 10 10 11 8 8 8 8 8 8 8 10 8 8 8 11 12 12 11 10 11 8 15 11 10 9 8 8 8 8 8 8 9 9 9 8 8 8 8 8 8 11 11 11 11 11 10 10 8 8 8 6 8 8 8 8 8 8 8 8 11 11 11 11 15 10 8 8 6 6 8 8 8 8 8 8 8 10 8 8 6 6 6 6 8 8 6 6 8 6 6 8 8 8 8 8 8 8 6 6 8 6 8 9 8 8 8 8 8 8 8 8 8 8 10 9 8 8 8 8 8 8 8 8 8 8 8 9 9 9 8 8 6 6 6 10 8 11 11 11 8 8 7 7 7 8 8 8 8 8 8 10 8 8 6 6 8 8 11 11 11 10 6 7 7 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 10 10 8 8 8 8 8 8 10 8 9 12 12 12 8 8 8 8 8 8 8 8 6 8 8 8 13 10 10 9 9 10 9 9 9 10 8 8 8 6 8 6 9 10 10 14 19 16 15 10 6 6 6 6 6 10 10 10 10 8 8 9 9 9 8 8 6 6 8 8 10 6 6 6 6 6 6 8 8 8 8 6 6 8 8 8 10 13 15 13 11 12 12 9 8 8 8 8 8 11 12 12 8 6 8 6 6 8 6 6 8 8 10 9 9 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 10 8 8 8 6 6 12 10 8 8 8 8 8 8 8 8 8 8 8 9 9 11 11 12 15 10 8 8 6 6 8 10 12 9 8 8 8 8 9 9 9 12 13 10 10 8 8 8 8 6 8 8 6 6 6 6 8 8 6 6 8 8 10 10 10 9 9 9 10 10 10 10 11 8 8 8 8 8 8 12 11 10 8 8 8 10 10 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 10 8 8 8 13 13 10 8 8 8 8 8 8 8 8 10 10 10 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 6 6 6 6 8 8 8 8 8 8 8 8 8 8 9 9 9 8 8 8 8 8 8 10 15 10 8 8 11 8 8 10 10 8 8 10 9 9 9 11 10 8 8 10 10 10 9 10 10 12 9 9 10 8 8 8 8 8 10 8 8 8 8 10 10 9 9 9 9 9 10 10 10 9 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 10 10 8 8 6 6 8 8 8 8 8 8 6 8 9 12 9 9 9 10 9 12 9 8 8 8 8 6 7 8 8 6 8 8 8 8 8 8 8 8 8 10 8 8 6 6 8 8 8 8 8 6 6 6 6 10 8 8 8 8 9 10 10 8 8 8 8 8 8 6 6 6 6 6 8 10 10 10 10 6 6 8 8 10 12 8 8 8 8 8 8 8 8 8 8 9 9 11 11 8 8 8 8 8 8 8 8 8 10 8 8 10 8 8 8 10 8 8 8 6 6 8 8 8 8 8 10 8 10 8 8 8 8 8 8 8 10 8 8 9 9 9 9 8 6 6 6 6 6 6 8 8 10 10 15 17 15 10 10 10 13 10 9 11 11 8 8 8 8 10 8 8 8 8 8 8 8 8 10 10 11 9 8 10 8 8 8 8 10 8 6 6 8 8 8 8 6 6 8 8 6 6 8 6 8 8 8 8 8 8 10 10 8 6 6 6 6 6 6 6 8 6 9 9 8 8 8 8 8 8 10 10 14 12 10 10 10 10 9 8 8 8 8 8 8 10 8 8 10 19 17 20 24 10 10 8 8 8 6 6 6 6 8 8 10 8 8 8 8 9 9 11 8 8 8 8 8 8 9 11 9 7 7 8 10 10 8 8 8 8 8 8 8 8 8 8 8 9 9 8 8 8 8 9 14 9 8 8 8 8 8 6 6 6 6 8 8 8 10 8 8 8 8 8 8 6 6 8 8 6 6 6 8 8 8 8 8 8 9 9 9 9 8 10 8 8 8 8 9 8 8 8 8 8 8 8 9 9 8 8 8 8 8 12 13 6 6 8 8 6 6 8 8 8 8 8 8 8 8 10 8 8 8 8 8 9 8 6 6 6 8 8 10 8 8 7 8 10 11 22 10 10 9 9 10 8 8 11 11 11 11 8 6 6 6 6 6 6 6 8 8 8 8 8 8 6 10 6 6 8 8 11 15 12 8 8 8 8 9 8 8 8 8 8 8 12 12 12 11 13 15 8 8 8 8 8 8 8 8 8 12 10 9 9 9 9 10 11 9 9 9 9 8 8 6 6 8 6 6 8 8 8 8 8 7	Open. Hide. 9 9 9 9 9 15 10 6 7 9 11 10 12 11 9 9 23 12 14 16 17 30 30 33 28 28 28 43 43 39 37 48 40 40 47 47 30 19 8 6 6 6 10 9 12 11 15 10 15 19 19 28 29 23 22 8 8 8 23 21 36 33 33 27 27 19 19 22 15 17 11 11 11 23 19 19 19 8 8 8 15 19 28 33 39 39 34 34 35 37 37 37 39 43 43 57 43 42 37 37 37 42 42 48 48 57 57 59 59 47 39 32 32 32 32 39 39 46 46 48 43 43 43 46 47 47 47 46 39 37 35 35 39 39 42 57 57 48 42 47 47 47 47 47 47 47 57 57 57 57 57 57 57 57 57 57 57 50 50 50 50 50 57 57 57 50 50 50 50 47 47 50 50 50 50 50 50 57 57 57 57 57 54 54 54 57 50 57 50 50 50 50 37 37 52 57 57 57 52 52 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 57 57 57 57 52 52 52 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 62 62 52 52 62 62 62 62 39 39 39 62 43 52 62 62 62 62 52 52 43 43 43 62 62 62 62 62 62 62 62 62 43 43 35 43 43 43 23 26 26 44 44 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 39 39 43 43 35 35 35 35 27 35 35 43 39 43 43 52 52 52 52 52 57 57 57 68 57 57 59 57 57 52 43 52 52 45 45 57 57 52 52 52 57 52 52 57 57 59 59 59 59 57 57 57 57 57 57 57 57 57 59 59 57 59 57 57 52 52 52 57 57 57 52 52 57 57 59 50 43 43 43 43 43 31 31 31 43 43 35 43 24 38 24 32 23 44 44 57 57 54 54 57 50 50 43 44 50 50 44 37 35 35 42 44 57 42 42 32 32 37 44 44 47 57 44 43 42 42 35 32 30 32 32 42 42 37 37 30 24 24 20 20 23 36 36 36 28 28 32 39 42 43 43 43 37 30 19 18 18 28 24 32 28 33 33 42 42 39 39 39 39 39 30 30 28 32 35 59 59 57 48 48 48 48 47 46 47 47 39 39 39 34 34 35 41 41 41 39 39 34 23 18 20 27 30 33 34 36 36 32 31 28 20 20 24 28 34 33 21 17 13 15 15 21 11 11 12 18 21 28 37 34 36 47 37 37 27 14 14 14 19 23 26 30 33 18 17 11 25 25 37 41 39 39 15 13 8 8 8 8 9 12 17 22 30 30 32 18 18 17 17 10 10 12 15 19 15 10 8 8 8 12 24 29 30 22 15 11 16 16 12 10 10 11 8 8 8 8 8 8 10 10 21 13 11 11 11 18 18 17 17 17 9 10 9 9 9 8 8 10 10 15 9 9 10 10 8 8 8 10 10 10 9 11 21 20 21 22 21 16 15 10 8 8 8 8 8 8 8 13 11 11 10 9 9 10 10 10 11 12 13 16 15 17 21 22 15 11 13 10 10 10 10 10 10 13 10 9 9 11 11 11 13 10 16 11 9 9 10 10 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no115_c19.g1 MSMg01no115_c19.g1 CHROMAT_FILE:
MSMg01no115_c19.g1 PHD_FILE: MSMg01no115_c19.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:21:03 2005
         (513 letters)



>mm_chr1_89594216_89595129
          Length = 914

 Score =  897 bits (464), Expect = 0.0
 Identities = 497/514 (96%), Gaps = 12/514 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   agggcagccagggctatacagagaaaaaaaccaaaaagaaaaaaaaagaaaagaaaaaga 60
           ||||||||||||||||||||||||||||| ||||||||||||          ||||||||
Sbjct: 212 agggcagccagggctatacagagaaaaaa-ccaaaaagaaaa----------gaaaaaga 260

                                                                       
Query: 61  ataatatttacttcctagatgcattttcagtcccagttctcatctctgaggtgctttgtc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 ataatatttacttcctagatgcattttcagtcccagttctcatctctgaggtgctttgtc 320

                                                                       
Query: 121 tcatttctaggcattgttggaagttccccctgaaagctaggaaatacagacagggtgtct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tcatttctaggcattgttggaagttccccctgaaagctaggaaatacagacagggtgtct 380

                                                                       
Query: 181 tactcccagggtggaaccggggtgcatgttcagggttccaaaggtgtacctcagtcctgt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tactcccagggtggaaccggggtgcatgttcagggttccaaaggtgtacctcagtcctgt 440

                                                                       
Query: 241 gttgcaacaccatctcccaccaccaccaccaggttgccatccacaccctctggaacattc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 gttgcaacaccatctcccaccaccaccaccaggttgccatccacaccctctggaacattc 500

                                                                       
Query: 301 gcatagtggtgcttgccaagccagagcatgagaatcggatcagccatatctgcactgaca 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 gcatagtggtgcttgccaagccagagcatgagaatcggatcagccatatctgcactgaca 560

                                                                       
Query: 361 acgtgaagacaggcatcgccaacaccctgggtgagcatagagggaaagccattcctgtgc 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 acgtgaagacaggcatcgccaacaccctgggtgagcatagagggaaagccattcctgtgc 620

                                                                       
Query: 421 atgctc-tcctcttcctccttttggcaatgtcccaggataaaccatgagagtcctgtctt 479
           |||||| ||||| ||||||||||||||||||||||||||||||  ||||||||||||| |
Sbjct: 621 atgctcctcctcctcctccttttggcaatgtcccaggataaactgtgagagtcctgtcct 680

                                             
Query: 480 gggatcccttcgtctctagcaaatccagatggtt 513
           ||||||||||||||||||||||||||||| ||||
Sbjct: 681 gggatcccttcgtctctagcaaatccagaaggtt 714


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 24
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 513
Length of database: 914
Length adjustment: 10
Effective length of query: 503
Effective length of database: 904
Effective search space:   454712
Effective search space used:   454712
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information