MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-185D20
Chromosome	1 (Build37)
Map Location	135,625,001 - 135,625,309
singlet/doublet	singlet
Overlap gene	Atp2b4
Upstream gene	Nfasc, Lrrn2, Mdm4, LOC638636, Pik3c2b, Ppp1r15b, Plekha6, Golt1a, Kiss1, LOC100038824, Ren1, Etnk2, Sox13, LOC667371, Snrpe, Zc3h11a, LOC667118, Lax1
Downstream gene	Optc, Prelp, LOC100042352, LOC100042358, Fmod, Btg2, EG667414, Chit1, Chi3l1, Mybph, Adora1, Myog, Ppfia4, LOC100042382, Tmem183a, 4933406M09Rik, Cyb5r1, Adipor1, Klhl12, Rabif, 4931440L10Rik, Jarid1b, LOC100042418, Syt2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nfasc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269116 MGI:104753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16980 MGI:106037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17248 MGI:107934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 733 ESTs, 7 Proteins pseudo : _no_value

name	Pik3c2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240752 MGI:2685045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	Ppp1r15b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108954 MGI:2444211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekha6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240753 MGI:2388662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golt1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68338 MGI:1915588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kiss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280287 MGI:2663985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ren1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19701 MGI:97898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etnk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214253 MGI:2443760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20668 MGI:98361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Snrpe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20643 MGI:98346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70579 MGI:1917829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 1 Protein

name	Lax1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240754 MGI:2443362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381290 MGI:88111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Optc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269120 MGI:2151113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prelp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116847 MGI:2151110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Fmod (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14264 MGI:1328364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12227 MGI:108384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667414 MGI:3647540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 760 ESTs, 6 Proteins

name	Chit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71884 MGI:1919134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chi3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12654 MGI:1340899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53311 MGI:1858196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adora1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11539 MGI:99401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Myog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17928 MGI:97276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppfia4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68507 MGI:1915757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein

name	LOC100042382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs

name	Tmem183a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57439 MGI:1914729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933406M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240755 MGI:3045320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72017 MGI:1919267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adipor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72674 MGI:1919924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240756 MGI:2385619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98710 MGI:2138605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931440L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71001 MGI:1918251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Jarid1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75605 MGI:1922855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Syt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20980 MGI:99666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfasc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130561 GeneID:269116 MGI:104753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurofascin transcript_id : NM_182716.3

name	Lrrn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922709 GeneID:16980 MGI:106037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat protein 2, neuronal transcript_id : NM_010732.2

name	Mdm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802331 GeneID:17248 MGI:107934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformed mouse 3T3 cell double minute 4 transcript_id : NM_008575.3

name	Pik3c2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234310 GeneID:240752 MGI:2685045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : phosphoinositide-3-kinase, class 2, beta polypeptide transcript_id : XM_001479658.1

name	Ppp1r15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802693 GeneID:108954 MGI:2444211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 15b transcript_id : NM_133819.2

name	Plekha6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33636692 GeneID:240753 MGI:2388662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family A member 6 transcript_id : NM_182930.1

name	Golt1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388699 GeneID:68338 MGI:1915588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi transport 1 homolog A (S. cerevisiae) transcript_id : NM_026680.4

name	Kiss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226214 GeneID:280287 MGI:2663985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KiSS-1 metastasis-suppressor transcript_id : NM_178260.3

name	LOC100038824 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234179 GeneID:100038824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038824 transcript_id : XM_001471774.1

name	Ren1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886403 GeneID:19701 MGI:97898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : renin 1 structural transcript_id : NM_031192.2

name	Etnk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387127 GeneID:214253 MGI:2443760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ethanolamine kinase 2 transcript_id : NM_175443.3

name	Sox13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226240 GeneID:20668 MGI:98361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 13 transcript_id : NM_011439.2

name	Snrpe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801910 GeneID:20643 MGI:98346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein E transcript_id : NM_009227.2

name	Zc3h11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378001 GeneID:70579 MGI:1917829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 11A transcript_id : NM_144530.5

name	Lax1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982125 GeneID:240754 MGI:2443362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte transmembrane adaptor 1 transcript_id : NM_172842.2

name	Atp2b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54261792 GeneID:381290 MGI:88111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 4 transcript_id : NM_213616.1

name	Optc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905106 GeneID:269120 MGI:2151113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opticin transcript_id : NM_054076.1

name	Prelp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387274 GeneID:116847 MGI:2151110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline arginine-rich end leucine-rich repeat transcript_id : NM_054077.3

name	LOC100042352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234260 GeneID:100042352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042352 transcript_id : XM_001478016.1

name	Fmod (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348716 GeneID:14264 MGI:1328364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibromodulin transcript_id : NM_021355.3

name	Btg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875511 GeneID:12227 MGI:108384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell translocation gene 2, anti-proliferative transcript_id : NM_007570.2

name	EG667414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234317 GeneID:667414 MGI:3647540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 760 ESTs, 6 Proteins product : predicted gene, EG667414 transcript_id : XM_990438.2

name	Chit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037264 GeneID:71884 MGI:1919134
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chitinase 1 (chitotriosidase) transcript_id : NM_027979.1

name	Chi3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347793 GeneID:12654 MGI:1340899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chitinase 3-like 1 transcript_id : NM_007695.2

name	Mybph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56676317 GeneID:53311 MGI:1858196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein H transcript_id : NM_016749.2

name	Adora1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239993 GeneID:11539 MGI:99401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine A1 receptor transcript_id : NM_001039510.1

name	Adora1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239997 GeneID:11539 MGI:99401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine A1 receptor transcript_id : NM_001008533.2

name	Myog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13654246 GeneID:17928 MGI:97276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myogenin transcript_id : NM_031189.1

name	Ppfia4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363970 GeneID:68507 MGI:1915757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein product : protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4, transcript variant 1 transcript_id : XM_129443.7

name	LOC100042382 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234264 GeneID:100042382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs product : hypothetical protein LOC100042382 transcript_id : XM_001478086.1

name	Tmem183a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809744 GeneID:57439 MGI:1914729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 183A transcript_id : NM_001042485.1

name	Tmem183a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809748 GeneID:57439 MGI:1914729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 183A transcript_id : NM_020588.2

name	4933406M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362476 GeneID:240755 MGI:3045320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933406M09 gene transcript_id : NM_173771.3

name	Cyb5r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802562 GeneID:72017 MGI:1919267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 reductase 1 transcript_id : NM_028057.2

name	Adipor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853586 GeneID:72674 MGI:1919924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adiponectin receptor 1 transcript_id : NM_028320.3

name	Klhl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130142 GeneID:240756 MGI:2385619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 12 (Drosophila) transcript_id : NM_153128.2

name	Rabif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704003 GeneID:98710 MGI:2138605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB interacting factor transcript_id : NM_145510.1

name	Jarid1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23097247 GeneID:75605 MGI:1922855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji, AT rich interactive domain 1B (Rbp2 like) transcript_id : NM_152895.1

name	LOC100042418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234267 GeneID:100042418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042418 transcript_id : XM_001478154.1

name	Syt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801663 GeneID:20980 MGI:99666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin II transcript_id : NM_009307.3

name	Lrrn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47777289 CCDS:CCDS15289.1 GeneID:16980 MGI:106037
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat protein 2, neuronal protein_id : NP_034862.1

name	Mdm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543245 CCDS:CCDS15290.1 GeneID:17248 MGI:107934
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045023 - G0 to G1 transition [Evidence ISS]; GO:0042177 - negative regulation of protein catabolism [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP] codon_start : 1 product : transformed mouse 3T3 cell double minute 4 protein_id : NP_032601.2

name	Pik3c2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234311 GeneID:240752 MGI:2685045
definition	codon_start : 1 product : phosphoinositide-3-kinase, class 2, beta polypeptide protein_id : XP_001479708.1

name	Ppp1r15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27597067 CCDS:CCDS15291.1 GeneID:108954 MGI:2444211
definition	GO_component : GO:0000164 - protein phosphatase type 1 complex [Evidence IDA] GO_function : GO:0004722 - protein serine/threonine phosphatase activity [Evidence IDA]; GO:0045182 - translation regulator activity [Evidence IC] GO_process : GO:0006983 - ER overload response [Evidence IDA] [Evidence IMP]; GO:0006446 - regulation of translational initiation [Evidence IC]; GO:0042542 - response to hydrogen peroxide [Evidence IMP]; GO:0006979 - response to oxidative stress [Evidence IMP] [Evidence IDA]; GO:0006950 - response to stress [Evidence IMP] codon_start : 1 product : protein phosphatase 1, regulatory subunit 15B protein_id : NP_598580.1

name	Plekha6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33636693 CCDS:CCDS15292.1 GeneID:240753 MGI:2388662
definition	codon_start : 1 note : phosphoinositol 3-phosphate-binding protein-3 product : pleckstrin homology domain containing, family A member 6 protein_id : NP_891846.1

name	Golt1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311983 GeneID:68338 MGI:1915588
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi transport 1 homolog A protein_id : NP_080956.1

name	Kiss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226215 GeneID:280287 MGI:2663985
definition	GO_function : GO:0001664 - G-protein-coupled receptor binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030336 - negative regulation of cell migration [Evidence IPI]; GO:0008285 - negative regulation of cell proliferation [Evidence IPI] codon_start : 1 note : metastin; 0610012C01Rik product : KiSS-1 metastasis-suppressor protein_id : NP_839991.2

name	LOC100038824 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234180 GeneID:100038824
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471824.1

name	Ren1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13676837 CCDS:CCDS15295.1 GeneID:19701 MGI:97898
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004195 - renin activity [Evidence IEA] GO_process : GO:0002003 - angiotensin maturation [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0042756 - drinking behavior [Evidence IMP]; GO:0008065 - establishment of blood-nerve barrier [Evidence IMP]; GO:0009755 - hormone-mediated signaling [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0002016 - renin-angiotensin regulation of body fluid levels [Evidence IMP] codon_start : 1 note : aspartyl-protease product : renin 1 structural protein_id : NP_112469.1

name	Etnk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425172 CCDS:CCDS15296.1 GeneID:214253 MGI:2443760
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 product : putative ethanolamine kinase protein_id : NP_780652.1

name	Sox13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226241 GeneID:20668 MGI:98361
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : SRY-box 13 protein_id : NP_035569.2

name	Snrpe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883844 GeneID:20643 MGI:98346
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein E protein_id : NP_033253.1

name	Zc3h11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270986 CCDS:CCDS15297.1 GeneID:70579 MGI:1917829
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger CCCH type containing 11A protein_id : NP_653113.4

name	Lax1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982126 GeneID:240754 MGI:2443362
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0050851 - antigen receptor-mediated signaling pathway [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0048305 - immunoglobulin secretion [Evidence IMP]; GO:0046649 - lymphocyte activation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : lymphocyte transmembrane adaptor 1 protein_id : NP_766430.2

name	Atp2b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261793 CCDS:CCDS15298.1 GeneID:381290 MGI:88111
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence TAS] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : plasma membrane calcium ATPase 4 protein_id : NP_998781.1

name	Optc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905107 CCDS:CCDS15299.1 GeneID:269120 MGI:2151113
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : opticin protein_id : NP_473417.1

name	Prelp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543506 CCDS:CCDS15300.1 GeneID:116847 MGI:2151110
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proline arginine-rich end leucine-rich repeat protein_id : NP_473418.2

name	LOC100042352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234261 GeneID:100042352
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478066.1

name	Fmod (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946680 CCDS:CCDS15301.1 GeneID:14264 MGI:1328364
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : fibromodulin protein_id : NP_067330.1

name	Btg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680814 CCDS:CCDS15302.1 GeneID:12227 MGI:108384
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0030182 - neuron differentiation [Evidence ISS]; GO:0006479 - protein amino acid methylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : B-cell translocation gene 2, anti-proliferative protein_id : NP_031596.1

name	EG667414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363969 GeneID:667414 MGI:3647540
definition	codon_start : 1 product : similar to yeast ribosomal protein S28 homologue protein_id : XP_995532.1

name	Chit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037265 CCDS:CCDS15304.1 GeneID:71884 MGI:1919134
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0043169 - cation binding [Evidence IEA]; GO:0008061 - chitin binding [Evidence IEA]; GO:0004568 - chitinase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA]; GO:0045735 - nutrient reservoir activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006032 - chitin catabolism [Evidence IEA]; GO:0006030 - chitin metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0000272 - polysaccharide catabolism [Evidence IEA] codon_start : 1 product : chitinase 1 (chitotriosidase) protein_id : NP_082255.1

name	Chi3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468847 GeneID:12654 MGI:1340899
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0004568 - chitinase activity [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006032 - chitin catabolism [Evidence IEA] codon_start : 1 product : chitinase 3-like 1 protein_id : NP_031721.1

name	Mybph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56676318 GeneID:53311 MGI:1858196
definition	GO_component : GO:0005863 - striated muscle thick filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006941 - striated muscle contraction [Evidence IEA] codon_start : 1 note : myosin-binding protein H product : myosin binding protein H protein_id : NP_058029.2

name	Adora1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699444 CCDS:CCDS15305.1 GeneID:11539 MGI:99401
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adenosine A1 receptor protein_id : NP_001008533.1

name	Adora1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239994 CCDS:CCDS15305.1 GeneID:11539 MGI:99401
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adenosine A1 receptor protein_id : NP_001034599.1

name	Myog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654247 CCDS:CCDS15306.1 GeneID:17928 MGI:97276
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007517 - muscle development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007519 - striated muscle development [Evidence TAS] [Evidence IDA] codon_start : 1 product : myogenin protein_id : NP_112466.1

name	Ppfia4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363971 GeneID:68507 MGI:1915757
definition	codon_start : 1 product : similar to mKIAA0897 protein isoform 1 protein_id : XP_129443.7

name	LOC100042382 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234265 GeneID:100042382
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478136.1

name	Tmem183a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809745 GeneID:57439 MGI:1914729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; clone MNCb-2755 product : hypothetical protein LOC57439 isoform b protein_id : NP_001035950.1

name	Tmem183a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181212 GeneID:57439 MGI:1914729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; clone MNCb-2755 product : hypothetical protein LOC57439 isoform a protein_id : NP_065613.1

name	4933406M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424635 CCDS:CCDS15307.1 GeneID:240755 MGI:3045320
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240755 protein_id : NP_776132.1

name	Cyb5r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312524 CCDS:CCDS15308.1 GeneID:72017 MGI:1919267
definition	GO_function : GO:0004128 - cytochrome-b5 reductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA] codon_start : 1 note : NAD(P)H:quinone oxidoreductase type 3, polypeptide A2 product : cytochrome b5 reductase 1 (B5R.1) protein_id : NP_082333.1

name	Adipor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259186 CCDS:CCDS15309.1 GeneID:72674 MGI:1919924
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042562 - hormone binding [Evidence ISS]; GO:0042802 - identical protein binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0019395 - fatty acid oxidation [Evidence ISS] [Evidence IDA]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : progestin and adipoQ receptor family member I product : adiponectin receptor 1 protein_id : NP_082596.2

name	Klhl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346565 GeneID:240756 MGI:2385619
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : kelch-like protein C3IP1 product : kelch-like 12 protein_id : NP_694768.1

name	Rabif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704004 CCDS:CCDS15310.1 GeneID:98710 MGI:2138605
definition	GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB-interacting factor protein_id : NP_663485.1

name	Jarid1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23097248 GeneID:75605 MGI:1922855
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative DNA/chromatin binding motif 1 product : PLU1 protein_id : NP_690855.1

name	LOC100042418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234268 GeneID:100042418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478204.1

name	LOC667371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667371
definition	number : 1 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 1 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 2 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:158851
definition	standard_name : MHAa21c6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:143908
definition	standard_name : Ms10j

name	(CDS detail)
type	STS
link
xref	UniSTS:224292
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:231620
definition	standard_name : RH142373

name	(CDS detail)
type	STS
link
xref	UniSTS:207208
definition	standard_name : AU021806

name	(CDS detail)
type	STS
link
xref	UniSTS:210253
definition	standard_name : RH136260

name	(CDS detail)
type	STS
link
xref	UniSTS:161088
definition	standard_name : RH124266

name	(CDS detail)
type	STS
link
xref	UniSTS:162267
definition	standard_name : RH125448

name	(CDS detail)
type	STS
link
xref	UniSTS:209802
definition	standard_name : RH127234

name	(CDS detail)
type	STS
link
xref	UniSTS:226177
definition	standard_name : Mdm4

name	(CDS detail)
type	STS
link
xref	UniSTS:270692
definition	standard_name : PMC133932P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234216
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224555
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164128
definition	standard_name : AI606441

name	(CDS detail)
type	STS
link
xref	UniSTS:234217
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164130
definition	standard_name : AU042621

name	(CDS detail)
type	STS
link
xref	UniSTS:128639
definition	standard_name : D1Mit287

name	(CDS detail)
type	STS
link
xref	UniSTS:128640
definition	standard_name : D1Mit287S

name	(CDS detail)
type	STS
link
xref	UniSTS:248631
definition	standard_name : AA998833

name	(CDS detail)
type	STS
link
xref	UniSTS:142248
definition	standard_name : D1Mit472

name	(CDS detail)
type	STS
link
xref	UniSTS:142085
definition	standard_name : D16Mit18

name	(CDS detail)
type	STS
link
xref	UniSTS:127811
definition	standard_name : D16Mit18

name	(CDS detail)
type	STS
link
xref	UniSTS:142086
definition	standard_name : D1Mit1012

name	(CDS detail)
type	STS
link
xref	UniSTS:128666
definition	standard_name : D1Mit31.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128665
definition	standard_name : D1Mit31

name	(CDS detail)
type	STS
link
xref	UniSTS:144345
definition	standard_name : Ren1

name	(CDS detail)
type	STS
link
xref	UniSTS:128654
definition	standard_name : D1Mit30

name	(CDS detail)
type	STS
link
xref	UniSTS:209961
definition	standard_name : RH135965

name	(CDS detail)
type	STS
link
xref	UniSTS:128671
definition	standard_name : D1Mit312S

name	(CDS detail)
type	STS
link
xref	UniSTS:128670
definition	standard_name : D1Mit312

name	(CDS detail)
type	STS
link
xref	UniSTS:161471
definition	standard_name : RH124649

name	(CDS detail)
type	STS
link
xref	UniSTS:178465
definition	standard_name : AW259412

name	(CDS detail)
type	STS
link
xref	UniSTS:178464
definition	standard_name : AW540933

name	(CDS detail)
type	STS
link
xref	UniSTS:128707
definition	standard_name : D1Mit348

name	(CDS detail)
type	STS
link
xref	UniSTS:88876
definition	standard_name : RH39400

name	(CDS detail)
type	STS
link
xref	UniSTS:128503
definition	standard_name : D1Mit164

name	(CDS detail)
type	STS
link
xref	UniSTS:165104
definition	standard_name : C76690

name	(CDS detail)
type	STS
link
xref	UniSTS:219382
definition	standard_name : RH137294

name	(CDS detail)
type	STS
link
xref	UniSTS:207216
definition	standard_name : BB238747

name	(CDS detail)
type	STS
link
xref	UniSTS:224842
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224209
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:160918
definition	standard_name : RH118245

name	(CDS detail)
type	STS
link
xref	UniSTS:270674
definition	standard_name : PMC133870P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158854
definition	standard_name : AI131919

name	(CDS detail)
type	STS
link
xref	UniSTS:158853
definition	standard_name : AA959598

name	(CDS detail)
type	STS
link
xref	UniSTS:207207
definition	standard_name : AW822012

name	(CDS detail)
type	STS
link
xref	UniSTS:141196
definition	standard_name : Btg2

name	(CDS detail)
type	STS
link
xref	UniSTS:224482
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270445
definition	standard_name : PMC123230P1

name	(CDS detail)
type	STS
link
xref	UniSTS:261837
definition	standard_name : AA819837

name	(CDS detail)
type	STS
link
xref	UniSTS:271371
definition	standard_name : PMC156147P12

name	(CDS detail)
type	STS
link
xref	UniSTS:178467
definition	standard_name : AW208766

name	(CDS detail)
type	STS
link
xref	UniSTS:165102
definition	standard_name : AI848715

name	(CDS detail)
type	STS
link
xref	UniSTS:178466
definition	standard_name : AI385643

name	(CDS detail)
type	STS
link
xref	UniSTS:185452
definition	standard_name : BB176431

name	(CDS detail)
type	STS
link
xref	UniSTS:141040
definition	standard_name : Adora1

name	(CDS detail)
type	STS
link
xref	UniSTS:118308
definition	standard_name : D13Rat23

name	(CDS detail)
type	STS
link
xref	UniSTS:240089
definition	standard_name : D13Mco10

name	(CDS detail)
type	STS
link
xref	UniSTS:128477
definition	standard_name : D1Mit140

name	(CDS detail)
type	STS
link
xref	UniSTS:271960
definition	standard_name : PMC207566P7

name	(CDS detail)
type	STS
link
xref	UniSTS:143982
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:234220
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270678
definition	standard_name : PMC133893P1

name	(CDS detail)
type	STS
link
xref	UniSTS:205458
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:143983
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:463953
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:143980
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:265671
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:270709
definition	standard_name : PMC133998P4

name	(CDS detail)
type	STS
link
xref	UniSTS:271152
definition	standard_name : PMC151607P2

name	(CDS detail)
type	STS
link
xref	UniSTS:143981
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:165103
definition	standard_name : AI852265

name	(CDS detail)
type	STS
link
xref	UniSTS:158855
definition	standard_name : AI448359

name	(CDS detail)
type	STS
link
xref	UniSTS:207211
definition	standard_name : RH127096

name	(CDS detail)
type	STS
link
xref	UniSTS:247778
definition	standard_name : BF405092

name	(CDS detail)
type	STS
link
xref	UniSTS:186056
definition	standard_name : BB013868

name	(CDS detail)
type	STS
link
xref	UniSTS:207206
definition	standard_name : RH126815

name	(CDS detail)
type	STS
link
xref	UniSTS:46496
definition	standard_name : RH16184

name	(CDS detail)
type	STS
link
xref	UniSTS:495948
definition	standard_name : Adipor1

name	(CDS detail)
type	STS
link
xref	UniSTS:178468
definition	standard_name : AW549708

name	(CDS detail)
type	STS
link
xref	UniSTS:164129
definition	standard_name : AI842864

name	(CDS detail)
type	STS
link
xref	UniSTS:185453
definition	standard_name : AW556288

name	(CDS detail)
type	STS
link
xref	UniSTS:163174
definition	standard_name : RH126466

name	(CDS detail)
type	STS
link
xref	UniSTS:123710
definition	standard_name : 25.mHAa9h1.seq

name	LOC638636 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234258 GeneID:638636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 733 ESTs, 7 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_033420.1

name	LOC667118 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234316 GeneID:667118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 1 Protein product : similar to Zinc finger BED domain containing protein 4 transcript_id : XR_035411.1

name	4931440L10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149234266 GeneID:71001 MGI:1918251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : RIKEN cDNA 4931440L10 gene transcript_id : XR_033559.1

clone name	MSMg01-047D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-185D20.T7 (MSMg01no185_d20.b1)	MSMg01-185D20.TJ (MSMg01no185_d20.g1)
ACC	AG377291	AG377292
length	783	799
length of high quality (start - end)	316 (60 - 375)	123 (77 - 199)
definition	CHROMAT_FILE: MSMg01no185_d20.b1 PHD_FILE: MSMg01no185_d20.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:59:53 2005	CHROMAT_FILE: MSMg01no185_d20.g1 PHD_FILE: MSMg01no185_d20.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:59:53 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ACACAGAAACCCTTCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXCGCGGAATTCAACAGTCTTATCCGAAATGAGAAGGGTGAGG TGAGTTGGTGGAGGGAGCAGGGAGGGGAGGGTTCGACCTTCAAGGGCATG AAGAGCTAGGTCTAGTGTGCAGCATCTGGGGCTTGCAGGAGCACATGGCT GGCTTCTAAAGGAAAATCAATCCATCATGAGACATCCCTTCCCCCCACAG CTGCTCGTACAGTGAGCAGGGTGTCCTCTTATCTTTGTTCAGTTTGTCTC TATGGGAGACAGAATCACTAACTTCATTATCTCTCTGTTTCTTTAACTCA AAGAATAATTTTTTTAGCCGGGTTTTTGGTTGCGCTTGAANCCAAAATCC CGTATTTTGTTATGTTTATGTTGGTGTTTTTTCCCCCCCCAAAAACTACC AAGAACTTCTGGGTGGGTGGGGGGTTCCGCCCAGGCTACACAGAGTAACC CTGTCTCCTTAAACAAATATTCATCCACTATATCTTTGTGTGCTGGTTTC CCTTCCTCTCCCCTCCATTGTTCCCTCCCTATCTATGGGTGCTTTGTGAT ACTCTTTTGTGTTTGTACCGTTTCATTCGAAGACACACTTCCCCATCTTT TCCTGTTTCGCTCTGCCTCACACCTACATTCCCATGCTTCTTTCCGTTTC TCATTCCCGTACCCCGTATATATCCTGACACCTTGTCTTGTTCACTATTA TTCAATCTCTTTCTATTCTCCCTCTTTTTATCG	NCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXACTACGTAGTTGAGGATGACTAAA TTCCTAATCTTCCTTCTACCTTCCAAATTCCAAAATTACAGCTATGCACC ACCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNNAN AAAANNAAANNNNAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAANNAA AAAAAAAAAAAATTAAAANNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAANNNAAATAAAAAAAAAAAANATTTTTTTTTTTTTTATAAATTTTTTT TNTATAATATTATTTTTTTTTTCCCCCCCCCCCCCACTTTATTATTTATT AAACTCTTTCATTTATATCCCCCCCCCCCCAAAAAAAAAAAAAATTTTTT TTTCTACCCCATTAATTCCCTCTTCTCATTTTAACTACATCCCCTATCTT TTTTTACTTCTTCTTCTTTCTCTCTAACTTTTTCCTATTTTTTTTTACCC ACTCCCTTTACTTTTTTCTTCTACTTCTCTAACTTTAATCTCCCACTCCA AATACCCTCACTACTCTCTTACTTTATATACTCATCTTTCTCATCTACAT TTAATATCCATCTCCCTCTCACTACACATACCTCCTCTCACTTTACTTTA ATATTATTTATTCTCCACTCATCATTCAATTTTCCTTTCTCATCCACCTT TCTATATATATTCCTCTCACCTTTAATTTTACCCTTTTANCTCTTCGTT
quality values	Open. Hide. 7 10 8 8 8 6 6 6 6 6 6 6 6 8 19 19 12 10 10 10 12 15 29 34 42 42 33 33 33 47 47 36 36 42 34 34 37 43 48 42 37 33 33 36 42 57 57 53 50 50 50 48 50 50 42 42 32 41 41 42 44 54 54 40 40 40 40 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 50 36 36 31 31 31 37 37 37 23 22 9 9 9 9 9 9 12 12 11 11 11 23 23 37 40 40 48 41 47 47 47 48 48 48 48 39 43 40 43 43 43 43 57 48 48 48 59 59 59 59 54 54 54 57 54 54 54 59 54 54 48 57 48 59 47 47 43 43 43 57 46 48 48 48 57 57 48 48 48 48 48 48 48 59 59 59 46 43 43 42 42 42 42 37 39 42 46 44 41 57 57 57 54 54 54 59 57 57 57 50 48 48 50 57 54 57 57 59 59 68 68 68 68 57 57 57 57 57 57 57 57 59 57 57 57 57 57 50 42 37 37 42 44 44 44 42 42 35 35 35 41 41 42 42 43 57 57 57 57 57 57 57 57 57 57 59 54 54 48 54 54 54 54 54 57 54 54 54 59 59 59 48 47 43 43 43 42 42 48 47 42 42 48 59 48 48 48 48 48 48 59 59 59 59 57 57 57 57 48 50 50 50 42 28 28 13 18 18 28 13 13 12 27 22 35 35 39 34 28 25 25 28 32 33 39 39 39 35 35 37 43 47 48 34 34 25 34 34 37 22 14 10 8 8 7 7 6 6 6 6 6 6 6 6 6 6 6 6 3 3 0 3 6 6 6 6 9 9 10 12 9 6 6 6 8 8 17 19 13 13 8 8 8 10 10 10 16 11 11 11 13 12 11 11 10 10 13 9 12 15 13 14 11 10 13 10 9 13 11 18 17 9 10 10 6 6 6 9 9 6 8 6 6 6 8 11 10 12 12 10 9 12 9 10 10 12 9 9 9 16 12 8 8 8 8 8 8 11 12 12 11 11 12 12 13 19 19 21 12 19 15 15 12 12 11 11 12 12 19 26 29 39 39 39 32 17 21 16 13 11 11 9 11 12 12 12 12 12 13 21 10 10 10 10 10 10 11 11 11 13 13 13 11 11 13 21 14 15 15 18 14 9 9 9 9 9 10 13 13 13 8 8 10 10 10 10 8 10 6 6 10 10 15 17 10 10 10 10 10 13 10 10 10 12 11 10 12 12 12 15 19 15 10 10 10 13 11 9 9 9 11 11 10 11 6 6 8 8 8 8 10 8 12 9 9 9 13 15 15 15 13 11 10 8 8 8 8 8 8 8 10 10 9 9 9 10 14 12 12 11 11 10 11 8 8 6 6 8 8 10 8 9 10 10 13 10 10 10 10 11 10 10 8 8 6 6 8 8 8 8 8 9 8 8 8 8 10 10 10 10 9 8 10 13 10 10 10 8 8 8 8 8 8 8 10 10 10 8 10 8 8 8 10 11 11 21 12 10 10 10 10 8 8 8 8 8 8 6 6 8 6 11 10 10 10 8 8 8 10 10 10 10 10 9 9 8 8 8 6 6 6 7 8 8 8 9 12 20 15 13 13 10 10 7 6 8 8 8 8 10 8 8 9 9 9 13 13 12 10 8 8 8 8 8 8 8 8 8 11 9 9 10 10 12 12 15 18 18 8 8 8 6 6	Open. Hide. 0 3 6 7 11 8 8 8 9 15 17 30 30 30 37 37 37 50 50 50 50 50 50 57 57 57 53 59 50 50 50 41 33 28 18 18 16 11 12 15 21 21 33 28 41 41 48 50 53 53 50 50 50 50 53 53 53 53 53 53 53 42 29 28 21 28 20 24 21 14 10 23 26 41 48 50 50 50 51 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 47 47 42 42 32 26 33 28 28 43 43 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 54 54 54 54 54 54 54 54 54 48 48 48 48 48 48 48 48 48 48 48 48 48 48 48 48 48 59 48 59 48 47 47 47 34 59 25 25 3 0 0 3 0 3 11 9 3 0 0 3 8 3 0 0 0 0 3 8 8 3 0 0 3 10 10 10 10 9 9 9 9 10 9 9 9 9 11 12 8 8 6 7 8 6 7 6 6 6 3 0 0 3 6 6 9 6 6 6 6 6 6 6 6 6 6 6 6 6 6 9 3 0 0 3 6 6 6 6 6 9 6 6 6 6 6 8 8 8 8 9 9 9 9 11 8 6 6 6 6 6 8 6 6 6 6 3 0 0 0 3 9 9 8 8 8 8 9 9 9 9 9 9 9 9 3 0 3 6 7 9 9 17 19 19 17 17 16 24 13 13 10 13 11 8 8 10 8 8 8 9 13 13 11 3 0 3 9 9 8 8 6 6 10 6 6 8 8 18 23 28 29 21 12 9 9 9 14 19 23 10 10 10 19 19 24 22 15 8 6 6 8 8 10 16 13 10 9 9 6 6 6 6 8 8 8 8 8 8 8 13 8 8 8 8 8 8 10 8 8 8 8 11 6 13 17 30 34 30 26 14 11 11 11 11 11 18 24 37 39 39 34 25 22 14 12 9 9 10 10 12 12 13 19 10 8 6 6 6 6 8 8 8 6 6 8 6 8 8 8 13 13 12 10 10 8 8 8 10 10 13 11 11 11 11 11 12 12 10 9 9 8 10 10 12 10 10 15 10 10 12 10 10 13 9 9 8 8 8 8 8 8 12 8 8 8 12 9 10 10 10 9 8 8 7 6 8 8 8 8 6 6 8 8 10 10 12 10 10 11 10 10 12 23 15 19 11 10 8 8 8 8 10 10 10 8 10 8 10 12 10 8 8 8 8 8 12 10 10 10 10 10 10 8 8 6 8 8 11 11 10 10 10 8 8 6 6 6 6 10 10 11 10 10 10 9 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 9 9 10 13 13 11 11 11 11 11 9 9 9 9 8 8 8 10 8 8 8 8 11 11 15 11 11 13 9 9 9 8 8 8 6 6 6 8 8 8 9 8 9 9 9 9 9 9 9 13 8 8 8 8 10 12 10 10 10 10 12 8 8 6 6 8 8 10 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 9 9 8 8 8 10 8 9 10 9 8 8 8 8 8 8 8 6 6 8 10 10 10 10 10 10 12 16 16 15 10 8 8 8 8 7 11 12 18 19 23 19 14 6 8 6 6 8 8 10 10 12 11 8 8 6 6 8 8 11 8 9 10 9 11 11 18 8 8 6 6 10 8 8 8 8 8 8 8 8 10 8 8 8 8 9 10 10 11 9 9 13 16 14 15 10 3 0 3 10 10 8 8 8 8 7 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no185_d20.b1 MSMg01no185_d20.b1 CHROMAT_FILE:
MSMg01no185_d20.b1 PHD_FILE: MSMg01no185_d20.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 19:59:53 2005
         (316 letters)



>mm_chr1_135624797_135625512
          Length = 716

 Score =  574 bits (297), Expect = e-168
 Identities = 306/309 (99%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattcaacagtcttatccgaaatgagaagggtgaggtgagttggtggagggagcaggga 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 513 gaattcaacagtcttatccgaaatgagaagggtgaggtgagttggtggagggagcaggga 454

                                                                       
Query: 65  ggggagggttcgaccttcaagggcatgaagagctaggtctagtgtgcagcatctggggct 124
           ||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 453 ggggagggcacgactttcaagggcatgaagagctaggtctagtgtgcagcatctggggct 394

                                                                       
Query: 125 tgcaggagcacatggctggcttctaaaggaaaatcaatccatcatgagacatcccttccc 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 tgcaggagcacatggctggcttctaaaggaaaatcaatccatcatgagacatcccttccc 334

                                                                       
Query: 185 cccacagctgctcgtacagtgagcagggtgtcctcttatctttgttcagtttgtctctat 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 cccacagctgctcgtacagtgagcagggtgtcctcttatctttgttcagtttgtctctat 274

                                                                       
Query: 245 gggagacagaatcactaacttcattatctctctgtttctttaactcaaagaataattttt 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 273 gggagacagaatcactaacttcattatctctctgtttctttaactcaaagaataattttt 214

                    
Query: 305 ttagccggg 313
           |||||||||
Sbjct: 213 ttagccggg 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 316
Length of database: 716
Length adjustment: 9
Effective length of query: 307
Effective length of database: 707
Effective search space:   217049
Effective search space used:   217049
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information