MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-097O08
Chromosome	10 (Build37)
Map Location	128,140,951 - 128,336,475
singlet/doublet	doublet
Overlap gene	Cdk2, Si, Dgka, LOC100043669, Wibg, LOC622655, Mmp19, 1110012D08Rik, Dnajc14, Ormdl2, 1110005A23Rik, Gdf11
Upstream gene	Myo1a, Tac2, Zbtb39, Admr, Rdh1, Rdh9, Rdh16, AY053573, Rdhs, BC089597, Rdh7, Sdro, LOC382468, Hsd17b6, LOC100043618, Prim1, LOC100043077, Naca, Ptges3, Atp5b, Baz2a, LOC100043085, Rbms2, LOC100043624, Gls2, Spryd4, Mip, Timeless, Apon, Apof, Stat2, Il23a, Usp52, Tmem4, Cs, Coq10a, Ankrd52, Slc39a5, Obfc2b, Rnf41, Smarcc2, Myl6, Myl6b, Mbc2, Zc3h10, Rpl41, LOC668453, Pa2g4, Erbb3, LOC100043114, LOC668459, Rps26, Ikzf4, Suox, EG622589, Rab5b
Downstream gene	Cd63, Rdh5, Bloc1s1, Itga7, Mettl7b, Olfr9, Olfr763, EG622733, EG546487, Olfr765, Olfr768, Olfr769, Olfr770, Olfr771, Olfr772, Olfr773-ps1, LOC624925, Olfr774, Olfr1518, Olfr776, Olfr777, Olfr778-ps1, LOC544749, Olfr780, Olfr781, Olfr782, Olfr783-ps1, Olfr784, EG546488, Olfr786, Olfr787, Olfr788, Olfr789-ps1, Olfr790, Olfr791, Olfr792, GA_x5J8B7W6HFP-3168293-3169194, Olfr794, GA_x5J8B7W6HFP-3198834-3199739, Olfr796, GA_x5J8B7W6HFP-3231749-3230798, Olfr798, Olfr799, Olfr800, Smt3h2-ps3, Olfr801, Olfr802, Olfr803, Olfr804, Olfr805, Olfr806, Olfr807, Olfr808, Olfr809, Olfr810, Olfr811, Olfr812, Olfr813, Olfr814
Link	Open Mouse BAC browser

Click to get alignment info.

name	Myo1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432516 MGI:107732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21334 MGI:98476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320080 MGI:2443316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Admr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11536 MGI:109545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107605 MGI:1195275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103142 MGI:2143528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19683 MGI:1201375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AY053573 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380674 MGI:2687008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdhs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216453 MGI:2678390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC089597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216454 MGI:3583955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54150 MGI:1860517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdro (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70061 MGI:1917311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Hsd17b6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27400 MGI:1351670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 219 ESTs, 4 Proteins

name	Prim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19075 MGI:97757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Naca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17938 MGI:106095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptges3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56351 MGI:1929282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11947 MGI:107801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Baz2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116848 MGI:2151152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Rbms2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56516 MGI:1861776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Gls2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216456 MGI:2143539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spryd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66701 MGI:1913951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17339 MGI:96990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timeless (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21853 MGI:1321393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apon (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28194 MGI:88931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apof (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103161 MGI:104539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20847 MGI:103039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il23a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83430 MGI:1932410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103135 MGI:1918984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56530 MGI:1928477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12974 MGI:88529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210582 MGI:2684847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237615 MGI:2444029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72002 MGI:1919336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Obfc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69917 MGI:1917167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67588 MGI:1914838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68094 MGI:1915344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17904 MGI:109318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216459 MGI:1917789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23943 MGI:1344426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103284 MGI:2143670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67945 MGI:1915195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668453 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein pseudo : _no_value

name	Pa2g4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18813 MGI:894684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erbb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13867 MGI:95411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins pseudo : _no_value

name	Rps26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27370 MGI:1351628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikzf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22781 MGI:1343139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211389 MGI:2446117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622589 MGI:3647630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 905 ESTs, 8 Proteins

name	Rab5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19344 MGI:105938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cdk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12566 MGI:104772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Si (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20431 MGI:98301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13139 MGI:102952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043669 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Wibg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78428 MGI:1925678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 2624 ESTs, 6 Proteins pseudo : _no_value

name	Mmp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58223 MGI:1927899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110012D08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73827 MGI:1921077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74330 MGI:1921580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ormdl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66844 MGI:1914094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110005A23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66118 MGI:1913368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14561 MGI:1338027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12512 MGI:99529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rdh5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19682 MGI:1201412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bloc1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14533 MGI:1195276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16404 MGI:102700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mettl7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71664 MGI:1918914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18373 MGI:107600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr763 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258861 MGI:3030597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622733 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622733 MGI:3648718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2403 Proteins

name	EG546487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546487 MGI:3647536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2453 Proteins

name	Olfr765 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258315 MGI:3030599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr768 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258863 MGI:3030602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr769 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257667 MGI:3030603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr770 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258862 MGI:3030604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr771 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258540 MGI:3030605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257666 MGI:3030606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr773-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257664 MGI:3030607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr774 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258232 MGI:3030608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258538 MGI:3031352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404321 MGI:3030610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr777 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258537 MGI:3030611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr778-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404426 MGI:3030612
definition	note : olfactory receptor 778, pseudogene 1 pseudo : _no_value

name	LOC544749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 961 Proteins

name	Olfr780 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258281 MGI:3030614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258723 MGI:3030615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257985 MGI:3030616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr783-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257983 MGI:3030617
definition	gene_synonym : MOR114-10P note : olfactory receptor 783, pseudogene 1 pseudo : _no_value

name	Olfr784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258724 MGI:3030618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546488 MGI:3647538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2326 Proteins

name	Olfr786 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258542 MGI:3030620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr787 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258069 MGI:3030621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr788 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258544 MGI:3030622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr789-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258148 MGI:3030623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2348 Proteins pseudo : _no_value

name	Olfr790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258935 MGI:3030624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr791 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258932 MGI:3030625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr792 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258150 MGI:3030626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6HFP-3168293-3169194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257720
definition	note : olfactory receptor GA_x5J8B7W6HFP-3168293-3169194 pseudo : _no_value

name	Olfr794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258375 MGI:3030628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6HFP-3198834-3199739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257771
definition	note : olfactory receptor GA_x5J8B7W6HFP-3198834-3199739 pseudo : _no_value

name	Olfr796 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258933 MGI:3030630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6HFP-3231749-3230798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257770
definition	note : olfactory receptor GA_x5J8B7W6HFP-3231749-3230798 pseudo : _no_value

name	Olfr798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258549 MGI:3030632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr799 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258929 MGI:3030633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr800 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258541 MGI:3030634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smt3h2-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108289 MGI:1926285
definition	note : SMT3 suppressor of mif two 3 homolog 2, pseudogene 3 (S. cerevisiae) pseudo : _no_value

name	Olfr801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258282 MGI:3030635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258934 MGI:3030636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr803 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258547 MGI:3030637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr804 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258068 MGI:3030638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr805 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258548 MGI:3030639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr806 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258546 MGI:3030640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr807 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258931 MGI:3030641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr808 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258930 MGI:3030642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258321 MGI:3030643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr810 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258543 MGI:3030644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr811 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258545 MGI:3030645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr812 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258791 MGI:3030646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr813 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258252 MGI:3030647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259165 MGI:3030648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487036 GeneID:432516 MGI:107732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IA transcript_id : NM_001081219.1

name	Tac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678208 GeneID:21334 MGI:98476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tachykinin 2 transcript_id : NM_009312.1

name	Zbtb39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574146 GeneID:320080 MGI:2443316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 39 transcript_id : NM_198035.1

name	Admr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606338 GeneID:11536 MGI:109545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenomedullin receptor transcript_id : NM_007412.2

name	Rdh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349108 GeneID:107605 MGI:1195275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 1 (all trans) transcript_id : NM_080436.2

name	Rdh9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130113 GeneID:103142 MGI:2143528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 9 transcript_id : NM_153133.2

name	Rdh16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363086 GeneID:19683 MGI:1201375
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 16 transcript_id : NM_009040.2

name	AY053573 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227084 GeneID:380674 MGI:2687008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY053573 transcript_id : NM_199313.1

name	Rdhs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117320519 GeneID:216453 MGI:2678390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase similar transcript_id : NM_147222.2

name	BC089597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703845 GeneID:216454 MGI:3583955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC089597 transcript_id : NM_145424.1

name	Rdh7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386947 GeneID:54150 MGI:1860517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 7 transcript_id : NM_017473.2

name	Sdro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789299 GeneID:70061 MGI:1917311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : orphan short chain dehydrogenase/reductase transcript_id : NM_027301.3

name	Hsd17b6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23680951 GeneID:27400 MGI:1351670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 6 transcript_id : NM_013786.2

name	LOC100043618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261212 GeneID:100043618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 146 ESTs, 4 Proteins product : similar to Sm D2, transcript variant 2 transcript_id : XM_001480921.1

name	LOC100043618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261210 GeneID:100043618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 218 ESTs, 4 Proteins product : similar to Sm D2, transcript variant 1 transcript_id : XM_001480919.1

name	Prim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130631 GeneID:19075 MGI:97757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA primase, p49 subunit transcript_id : NM_008921.2

name	Naca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41350311 GeneID:17938 MGI:106095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nascent polypeptide-associated complex alpha polypeptide transcript_id : NM_013608.2

name	Ptges3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370453 GeneID:56351 MGI:1929282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E synthase 3 (cytosolic) transcript_id : NM_019766.3

name	Atp5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892441 GeneID:11947 MGI:107801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit transcript_id : NM_016774.3

name	Baz2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205434 GeneID:116848 MGI:2151152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain adjacent to zinc finger domain, 2A transcript_id : NM_054078.2

name	LOC100043085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261116 GeneID:100043085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to proline-rich protein BstNI subfamily 2 transcript_id : XM_001479461.1

name	Rbms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872206 GeneID:56516 MGI:1861776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif, single stranded interacting protein 2 transcript_id : NM_001039080.1

name	Rbms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872202 GeneID:56516 MGI:1861776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif, single stranded interacting protein 2 transcript_id : NM_019711.2

name	Gls2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348692 GeneID:216456 MGI:2143539
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaminase 2 (liver, mitochondrial) transcript_id : NM_001033264.2

name	Spryd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130283 GeneID:66701 MGI:1913951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPRY domain containing 4 transcript_id : NM_025716.2

name	Mip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365201 GeneID:17339 MGI:96990
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major intrinsic protein of eye lens fiber transcript_id : NM_008600.3

name	Timeless (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755788 GeneID:21853 MGI:1321393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : timeless homolog (Drosophila) transcript_id : NM_011589.1

name	Apon (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60499026 GeneID:28194 MGI:88931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein N transcript_id : NM_133996.3

name	Apof (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892165 GeneID:103161 MGI:104539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein F transcript_id : NM_133997.2

name	Stat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910571 GeneID:20847 MGI:103039
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 2 transcript_id : NM_019963.1

name	Il23a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892789 GeneID:83430 MGI:1932410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 23, alpha subunit p19 transcript_id : NM_031252.2

name	Usp52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380546 GeneID:103135 MGI:1918984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 52 transcript_id : NM_133992.2

name	Tmem4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9903606 GeneID:56530 MGI:1928477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 4 transcript_id : NM_019953.1

name	Cs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129843 GeneID:12974 MGI:88529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : citrate synthase transcript_id : NM_026444.3

name	Coq10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486651 GeneID:210582 MGI:2684847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q10 homolog A (yeast) transcript_id : NM_001081040.1

name	Ankrd52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129954 GeneID:237615 MGI:2444029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 52 transcript_id : NM_172790.2

name	Slc39a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801371 GeneID:72002 MGI:1919336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (metal ion transporter), member 5 transcript_id : NM_028092.2

name	Slc39a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382758 GeneID:72002 MGI:1919336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (metal ion transporter), member 5 transcript_id : NM_028051.2

name	Obfc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076936 GeneID:69917 MGI:1917167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligonucleotide/oligosaccharide-binding fold containing 2B transcript_id : NM_027257.1

name	Rnf41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543596 GeneID:67588 MGI:1914838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 41 transcript_id : NM_026259.2

name	Smarcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718971 GeneID:68094 MGI:1915344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 transcript_id : NM_198160.1

name	Myl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357256 GeneID:17904 MGI:109318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 6, alkali, smooth muscle and non-muscle transcript_id : NM_010860.3

name	Myl6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986554 GeneID:216459 MGI:1917789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 6B transcript_id : NM_172259.1

name	Mbc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130020 GeneID:23943 MGI:1344426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane bound C2 domain containing protein transcript_id : NM_011843.2

name	Zc3h10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527225 GeneID:103284 MGI:2143670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 10 transcript_id : NM_134003.1

name	Rpl41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365971 GeneID:67945 MGI:1915195
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L41 transcript_id : NM_018860.3

name	Pa2g4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383894 GeneID:18813 MGI:894684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proliferation-associated 2G4 transcript_id : NM_011119.3

name	Erbb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098018 GeneID:13867 MGI:95411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) transcript_id : NM_010153.1

name	Rps26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305446 GeneID:27370 MGI:1351628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S26 transcript_id : NM_013765.1

name	Ikzf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114636 GeneID:22781 MGI:1343139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IKAROS family zinc finger 4 transcript_id : NM_011772.2

name	Suox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343458 GeneID:211389 MGI:2446117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfite oxidase transcript_id : NM_173733.2

name	EG622589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388730 GeneID:622589 MGI:3647630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 905 ESTs, 8 Proteins product : predicted gene, EG622589 transcript_id : XM_887027.2

name	Rab5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130364 GeneID:19344 MGI:105938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5B, member RAS oncogene family transcript_id : NM_177411.3

name	Rab5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755261 GeneID:19344 MGI:105938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5B, member RAS oncogene family transcript_id : NM_011229.1

name	Cdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803406 GeneID:12566 MGI:104772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 2 transcript_id : NM_016756.3

name	Cdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715990 GeneID:12566 MGI:104772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 2 transcript_id : NM_183417.2

name	Si (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353045 GeneID:20431 MGI:98301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : silver transcript_id : NM_021882.4

name	Dgka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560473 GeneID:13139 MGI:102952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, alpha transcript_id : NM_016811.2

name	LOC100043669 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261215 GeneID:100043669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100043669 transcript_id : XM_001480976.1

name	Wibg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753956 GeneID:78428 MGI:1925678
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : within bgcn homolog (Drosophila) transcript_id : NM_030100.2

name	Mmp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946771 GeneID:58223 MGI:1927899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 19 transcript_id : NM_021412.1

name	1110012D08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342609 GeneID:73827 MGI:1921077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012D08 gene transcript_id : NM_178066.2

name	Dnajc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366323 GeneID:74330 MGI:1921580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 14 transcript_id : NM_028873.3

name	Ormdl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892143 GeneID:66844 MGI:1914094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ORM1-like 2 (S. cerevisiae) transcript_id : NM_024180.4

name	1110005A23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384729 GeneID:66118 MGI:1913368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110005A23 gene transcript_id : NM_025364.1

name	Gdf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807179 GeneID:14561 MGI:1338027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 11 transcript_id : NM_010272.1

name	Cd63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431343 GeneID:12512 MGI:99529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd63 antigen transcript_id : NM_001042580.1

name	Cd63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431342 GeneID:12512 MGI:99529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd63 antigen transcript_id : NM_007653.3

name	Rdh5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94421441 GeneID:19682 MGI:1201412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 5 transcript_id : NM_134006.4

name	Bloc1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373142 GeneID:14533 MGI:1195276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biogenesis of lysosome-related organelles complex-1, subunit 1 transcript_id : NM_015740.3

name	Itga7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293268 GeneID:16404 MGI:102700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 7 transcript_id : NM_008398.2

name	Mettl7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376702 GeneID:71664 MGI:1918914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase like 7B transcript_id : NM_027853.2

name	Olfr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203794 GeneID:18373 MGI:107600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 9 transcript_id : NM_146861.1

name	Olfr763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203798 GeneID:258861 MGI:3030597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 763 transcript_id : NM_146862.1

name	EG622733 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388732 GeneID:622733 MGI:3648718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2403 Proteins product : predicted gene, EG622733 transcript_id : XM_887185.2

name	EG546487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261120 GeneID:546487 MGI:3647536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2453 Proteins product : predicted gene, EG546487 transcript_id : XM_621234.3

name	Olfr765 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239321 GeneID:258315 MGI:3030599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 765 transcript_id : NM_146318.1

name	Olfr768 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129144 GeneID:258863 MGI:3030602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 768 transcript_id : NM_146864.1

name	Olfr769 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128632 GeneID:257667 MGI:3030603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 769 transcript_id : NM_146267.1

name	Olfr770 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129150 GeneID:258862 MGI:3030604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 770 transcript_id : NM_146863.1

name	Olfr771 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203778 GeneID:258540 MGI:3030605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 771 transcript_id : NM_146547.1

name	Olfr772 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170035 GeneID:257666 MGI:3030606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 772 transcript_id : NM_146266.1

name	Olfr773-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170073 GeneID:257664 MGI:3030607
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 773, pseudogene 1 transcript_id : NM_207008.1

name	Olfr774 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518529 GeneID:258232 MGI:3030608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 774 transcript_id : NM_207620.1

name	Olfr1518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125858742 GeneID:258538 MGI:3031352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1518 transcript_id : NM_146545.2

name	Olfr776 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430577 GeneID:404321 MGI:3030610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 776 transcript_id : NM_207559.1

name	Olfr777 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239327 GeneID:258537 MGI:3030611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 777 transcript_id : NM_146544.1

name	LOC544749 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261122 GeneID:544749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 961 Proteins product : similar to olfactory receptor Olfr779 transcript_id : XM_001479625.1

name	Olfr780 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203772 GeneID:258281 MGI:3030614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 780 transcript_id : NM_146284.1

name	Olfr781 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239325 GeneID:258723 MGI:3030615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 781 transcript_id : NM_146728.1

name	Olfr782 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801359 GeneID:257985 MGI:3030616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 782 transcript_id : NM_001011797.1

name	Olfr784 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129384 GeneID:258724 MGI:3030618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 784 transcript_id : NM_146729.1

name	EG546488 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261124 GeneID:546488 MGI:3647538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2326 Proteins product : predicted gene, EG546488 transcript_id : XM_621235.4

name	Olfr786 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544962 GeneID:258542 MGI:3030620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 786 transcript_id : NM_146549.1

name	Olfr787 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801407 GeneID:258069 MGI:3030621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 787 transcript_id : NM_001011822.1

name	Olfr788 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239343 GeneID:258544 MGI:3030622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 788 transcript_id : NM_146551.1

name	Olfr790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129042 GeneID:258935 MGI:3030624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 790 transcript_id : NM_146933.1

name	Olfr791 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129044 GeneID:258932 MGI:3030625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 791 transcript_id : NM_146930.1

name	Olfr792 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801455 GeneID:258150 MGI:3030626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 792 transcript_id : NM_001011849.1

name	Olfr794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129548 GeneID:258375 MGI:3030628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 794 transcript_id : NM_146378.1

name	Olfr796 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129046 GeneID:258933 MGI:3030630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 796 transcript_id : NM_146931.1

name	Olfr798 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582551 GeneID:258549 MGI:3030632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 798 transcript_id : NM_146556.2

name	Olfr799 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203802 GeneID:258929 MGI:3030633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 799 transcript_id : NM_146927.1

name	Olfr800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203788 GeneID:258541 MGI:3030634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 800 transcript_id : NM_146548.1

name	Olfr801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129718 GeneID:258282 MGI:3030635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 801 transcript_id : NM_146285.1

name	Olfr802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129040 GeneID:258934 MGI:3030636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 802 transcript_id : NM_146932.1

name	Olfr803 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129526 GeneID:258547 MGI:3030637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 803 transcript_id : NM_146554.1

name	Olfr804 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801405 GeneID:258068 MGI:3030638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 804 transcript_id : NM_001011821.1

name	Olfr805 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129528 GeneID:258548 MGI:3030639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 805 transcript_id : NM_146555.1

name	Olfr806 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129532 GeneID:258546 MGI:3030640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 806 transcript_id : NM_146553.1

name	Olfr807 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129050 GeneID:258931 MGI:3030641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 807 transcript_id : NM_146929.1

name	Olfr808 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203804 GeneID:258930 MGI:3030642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 808 transcript_id : NM_146928.1

name	Olfr809 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129644 GeneID:258321 MGI:3030643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 809 transcript_id : NM_146324.1

name	Olfr810 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239331 GeneID:258543 MGI:3030644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 810 transcript_id : NM_146550.1

name	Olfr811 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239341 GeneID:258545 MGI:3030645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 811 transcript_id : NM_146552.1

name	Olfr812 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129258 GeneID:258791 MGI:3030646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 812 transcript_id : NM_146795.1

name	Olfr813 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391054 GeneID:258252 MGI:3030647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 813 transcript_id : NM_207147.1

name	Olfr814 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391070 GeneID:259165 MGI:3030648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 814 transcript_id : NM_207159.1

name	Myo1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487037 GeneID:432516 MGI:107732
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin, heavy polypeptide-like (110kD); brush border myosin 1 product : myosin IA protein_id : NP_001074688.1

name	Tac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678209 CCDS:CCDS24248.1 GeneID:21334 MGI:98476
definition	GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007217 - tachykinin signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : substance K; neurokinin 2; neurokinin A; neuropeptide K; neuromedin L; neurokinin alpha product : tachykinin 2 protein_id : NP_033338.1

name	Zbtb39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574147 CCDS:CCDS24249.1 GeneID:320080 MGI:2443316
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 39 protein_id : NP_932152.1

name	Admr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606339 GeneID:11536 MGI:109545
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adrenomedullin receptor protein_id : NP_031438.2

name	Rdh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20147789 CCDS:CCDS24250.1 GeneID:107605 MGI:1195275
definition	GO_function : GO:0004745 - retinol dehydrogenase activity [Evidence IDA]; GO:0016229 - steroid dehydrogenase activity [Evidence IDA] GO_process : GO:0001523 - retinoid metabolism [Evidence IDA]; GO:0008202 - steroid metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation function : putative retinol (all-trans-retinol and 9-cis-retinol)dehydrogenase function : putative sterol 3-alpha-hydroxydehydrogenase note : retinol dehydrogenase 1 (11-cis) product : retinol dehydrogenase 1 (all trans) protein_id : NP_536684.1

name	Rdh9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23680945 CCDS:CCDS24251.1 GeneID:103142 MGI:2143528
definition	codon_start : 1 note : cis-retinol/androgen dehydrogenase type 3 product : retinol dehydrogenase 9 protein_id : NP_694773.1

name	Rdh16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677697 CCDS:CCDS24252.1 GeneID:19683 MGI:1201375
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : retinol dehydrogenase type 6; retinol dehydrogenase 6; cis-retinol/androgen dehydrogenase 1 product : retinol dehydrogenase 16 protein_id : NP_033066.1

name	AY053573 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227085 GeneID:380674 MGI:2687008
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : cis-retinol/3alpha-hydroxysterol short-chain dehydrogenasecis-retinol/3alpha-hydroxysterol short-chain dehydrogenasecis-retinol/3alpha-hydroxysterol short-chain dehydrogenase product : truncated cis-retinol/3alpha-hydroxysterol short-chain dehydrogenase protein_id : NP_955017.1

name	Rdhs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117320520 CCDS:CCDS24253.1 GeneID:216453 MGI:2678390
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004745 - retinol dehydrogenase activity [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : retinol dehydrogenase similar protein 2 protein_id : NP_671755.2

name	BC089597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703846 CCDS:CCDS24254.1 GeneID:216454 MGI:3583955
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cis-retinol/3alpha hydroxysterol short-chain dehydrogenase-like protein_id : NP_663399.1

name	Rdh7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567342 CCDS:CCDS24255.1 GeneID:54150 MGI:1860517
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence ISS]; GO:0004745 - retinol dehydrogenase activity [Evidence IEA] codon_start : 1 note : cis-Retinol/3alpha-hydroxysterol short-chain dehydrogenase product : retinol dehydrogenase 7 protein_id : NP_059501.1

name	Sdro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076941 CCDS:CCDS24256.1 GeneID:70061 MGI:1917311
definition	codon_start : 1 product : retinol dehydrogenase similar protein protein_id : NP_081577.1

name	Hsd17b6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305165 CCDS:CCDS24257.1 GeneID:27400 MGI:1351670
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : hydroxysteroid 17-beta dehydrogenase 9 product : hydroxysteroid (17-beta) dehydrogenase 9 protein_id : NP_038814.1

name	LOC100043618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261211 GeneID:100043618
definition	codon_start : 1 product : similar to Sm D2 isoform 1 protein_id : XP_001480969.1

name	LOC100043618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261213 GeneID:100043618
definition	codon_start : 1 product : similar to Sm D2 isoform 2 protein_id : XP_001480971.1

name	Prim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679459 GeneID:19075 MGI:97757
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IEA] GO_function : GO:0003896 - DNA primase activity [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006269 - DNA replication, synthesis of RNA primer [Evidence IEA] codon_start : 1 product : DNA primase small subunit, 49kDa protein_id : NP_032947.1

name	Naca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41350312 CCDS:CCDS24258.1 GeneID:17938 MGI:106095
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0017025 - TATA-binding protein binding [Evidence IDA]; GO:0003713 - transcription coactivator activity [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nascent polypeptide-associated complex alpha polypeptide protein_id : NP_038636.2

name	Ptges3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790017 GeneID:56351 MGI:1929282
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0050220 - prostaglandin-E synthase activity [Evidence IEA] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : telomerase binding protein, p23 product : prostaglandin E synthase 3 (cytosolic) protein_id : NP_062740.1

name	Atp5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980648 CCDS:CCDS24259.1 GeneID:11947 MGI:107801
definition	EC_number : 3.6.3.14 GO_component : GO:0045255 - hydrogen-translocating F-type ATPase complex [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATP synthase, H+ transporting mitochondrial F1 complex, alpha subunit; mitochondrial ATP synthase, H+ transporting F1 complex beta subunit product : ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit protein_id : NP_058054.2

name	LOC100043085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261117 GeneID:100043085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479511.1

name	Baz2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205435 GeneID:116848 MGI:2151152
definition	GO_component : GO:0005731 - nucleolus organizer complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence ISS] [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : bromodomain adjacent to zinc finger domain, 2A protein_id : NP_473419.2

name	Rbms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872203 CCDS:CCDS24261.1 GeneID:56516 MGI:1861776
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : RNA binding motif, single stranded interacting protein 2 isoform a protein_id : NP_062685.2

name	Rbms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872207 CCDS:CCDS24262.1 GeneID:56516 MGI:1861776
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RNA binding motif, single stranded interacting protein 2 isoform b protein_id : NP_001034169.1

name	Gls2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677498 CCDS:CCDS24263.1 GeneID:216456 MGI:2143539
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006541 - glutamine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : liver mitochondrial glutaminase product : glutaminase 2 (liver, mitochondrial) protein_id : NP_001028436.1

name	Spryd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037095 CCDS:CCDS24264.1 GeneID:66701 MGI:1913951
definition	codon_start : 1 product : SPRY domain containing 4 protein_id : NP_079992.1

name	Mip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543250 CCDS:CCDS24265.1 GeneID:17339 MGI:96990
definition	GO_component : GO:0005921 - gap junction [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015267 - channel or pore class transporter activity [Evidence NAS]; GO:0005212 - structural constituent of eye lens [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence IMP] GO_process : GO:0007154 - cell communication [Evidence NAS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP]; GO:0006833 - water transport [Evidence IMP] codon_start : 1 note : hydropic fibers; lens opacity; dominant cataract product : major intrinsic protein of eye lens fiber protein_id : NP_032626.2

name	Timeless (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755789 CCDS:CCDS24266.1 GeneID:21853 MGI:1321393
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence IDA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0007623 - circadian rhythm [Evidence IEP]; GO:0007275 - development [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0002009 - morphogenesis of an epithelium [Evidence IEP]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : timeless homolog protein_id : NP_035719.1

name	Apon (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527214 CCDS:CCDS24267.1 GeneID:28194 MGI:88931
definition	codon_start : 1 note : apolipoprotein F-like product : apolipoprotein N protein_id : NP_598757.1

name	Apof (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527216 CCDS:CCDS24268.1 GeneID:103161 MGI:104539
definition	GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : apolipoprotein F protein_id : NP_598758.1

name	Stat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910572 CCDS:CCDS24269.1 GeneID:20847 MGI:103039
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : signal transducer and activator of transcription 2 protein_id : NP_064347.1

name	Il23a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752579 CCDS:CCDS24270.1 GeneID:83430 MGI:1932410
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005138 - interleukin-6 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : interleukin 23, alpha subunit p19 protein_id : NP_112542.1

name	Usp52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789349 CCDS:CCDS24271.1 GeneID:103135 MGI:1918984
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0000175 - 3'-5'-exoribonuclease activity [Evidence ISS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0000291 - mRNA catabolism, exonucleolytic [Evidence ISS]; GO:0000289 - poly(A) tail shortening [Evidence ISS]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 52 protein_id : NP_598753.1

name	Tmem4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9903607 CCDS:CCDS24272.1 GeneID:56530 MGI:1928477
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : putative secreted protein ZSIG9 product : transmembrane protein 4 protein_id : NP_064337.1

name	Cs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385942 CCDS:CCDS24273.1 GeneID:12974 MGI:88529
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0004108 - citrate (Si)-synthase activity [Evidence ISS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0046912 - transferase activity, transferring acyl groups, acyl groups converted into alkyl on transfer [Evidence IEA] GO_process : GO:0006092 - main pathways of carbohydrate metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 product : citrate synthase protein_id : NP_080720.1

name	Coq10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486652 GeneID:210582 MGI:2684847
definition	codon_start : 1 product : coenzyme Q10 homolog A protein_id : NP_001074509.1

name	Ankrd52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370168 CCDS:CCDS24274.1 GeneID:237615 MGI:2444029
definition	codon_start : 1 product : ankyrin repeat domain 52 protein_id : NP_766378.1

name	Slc39a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312540 CCDS:CCDS24275.1 GeneID:72002 MGI:1919336
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence TAS] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence TAS]; GO:0006829 - zinc ion transport [Evidence TAS] codon_start : 1 exception : mismatches in translation product : solute carrier family 39 (metal ion transporter), member 5 protein_id : NP_082327.1

name	Slc39a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312454 CCDS:CCDS24275.1 GeneID:72002 MGI:1919336
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence TAS] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence TAS]; GO:0006829 - zinc ion transport [Evidence TAS] codon_start : 1 product : solute carrier family 39 (metal ion transporter), member 5 protein_id : NP_082368.1

name	Obfc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076937 CCDS:CCDS24276.1 GeneID:69917 MGI:1917167
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : nucleic acid binding protein 2 product : oligonucleotide/oligosaccharide-binding fold containing 2B protein_id : NP_081533.1

name	Rnf41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543597 CCDS:CCDS24277.1 GeneID:67588 MGI:1914838
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ring finger protein 41 protein_id : NP_080535.2

name	Smarcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718972 CCDS:CCDS24278.1 GeneID:68094 MGI:1915344
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SWI/SNF-related matrix-associated actin-dependent regulator of chromatin c2 protein_id : NP_937803.1

name	Myl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33620739 GeneID:17904 MGI:109318
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA]; GO:0016461 - unconventional myosin [Evidence IEP] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] [Evidence TAS]; GO:0008307 - structural constituent of muscle [Evidence TAS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030049 - muscle filament sliding [Evidence TAS]; GO:0007519 - striated muscle development [Evidence TAS] codon_start : 1 note : myosin light chain, alkali, nonmuscle product : myosin, light polypeptide 6, alkali, smooth muscle and non-muscle protein_id : NP_034990.1

name	Myl6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986555 CCDS:CCDS24279.1 GeneID:216459 MGI:1917789
definition	GO_component : GO:0016459 - myosin [Evidence IEA]; GO:0016461 - unconventional myosin [Evidence IEP] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] [Evidence TAS]; GO:0008307 - structural constituent of muscle [Evidence TAS] GO_process : GO:0030049 - muscle filament sliding [Evidence TAS]; GO:0007519 - striated muscle development [Evidence TAS] codon_start : 1 product : myosin light chain 1 slow a protein_id : NP_758463.1

name	Mbc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859650 CCDS:CCDS24280.1 GeneID:23943 MGI:1344426
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : membrane bound C2 domain containing protein protein_id : NP_035973.1

name	Zc3h10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527226 CCDS:CCDS24281.1 GeneID:103284 MGI:2143670
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger CCCH type containing 10 protein_id : NP_598764.1

name	Rpl41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256636 GeneID:67945 MGI:1915195
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L41 protein_id : NP_061348.1

name	Pa2g4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755100 CCDS:CCDS24282.1 GeneID:18813 MGI:894684
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0050897 - cobalt ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004239 - methionyl aminopeptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : proliferation-associated protein 1; proliferation-associated 2G4, 38kD product : ErbB3-binding protein 1 protein_id : NP_035249.1

name	Erbb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098019 CCDS:CCDS24283.1 GeneID:13867 MGI:95411
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016328 - lateral plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005006 - epidermal growth factor receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : avian erythroblastosis oncogene B 3 receptor; receptor tyrosine kinase; glial growth factor receptor product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 protein_id : NP_034283.1

name	Rps26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305447 GeneID:27370 MGI:1351628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribosomal protein S26 protein_id : NP_038793.1

name	Ikzf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114637 CCDS:CCDS24284.1 GeneID:22781 MGI:1343139
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IPI] codon_start : 1 note : zinc finger protein, subfamily 1A, 4 (Eos) product : zinc finger protein, subfamily 1A, 4 protein_id : NP_035902.2

name	Suox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74024924 CCDS:CCDS24285.1 GeneID:211389 MGI:2446117
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030151 - molybdenum ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008482 - sulfite oxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : sulfite oxidase protein_id : NP_776094.2

name	EG622589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028352 GeneID:622589 MGI:3647630
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892120.1

name	Rab5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755262 CCDS:CCDS24287.1 GeneID:19344 MGI:105938
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5B, member RAS oncogene family protein_id : NP_035359.1

name	Rab5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916687 CCDS:CCDS24287.1 GeneID:19344 MGI:105938
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5B, member RAS oncogene family protein_id : NP_803130.1

name	Cdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949020 CCDS:CCDS24288.1 GeneID:12566 MGI:104772
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cyclin-dependent kinase 2 isoform 2 protein_id : NP_058036.1

name	Cdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556205 CCDS:CCDS24289.1 GeneID:12566 MGI:104772
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cyclin-dependent kinase 2 isoform 1 protein_id : NP_904326.1

name	Si (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981217 GeneID:20431 MGI:98301
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006583 - melanin biosynthesis from tyrosine [Evidence IEA] codon_start : 1 note : melanocyte protein pmel 17 product : silver protein_id : NP_068682.2

name	Dgka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560474 CCDS:CCDS24290.1 GeneID:13139 MGI:102952
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : diacylglycerol kinase, alpha (80 kDa) product : diacylglycerol kinase, alpha protein_id : NP_058091.2

name	LOC100043669 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261216 GeneID:100043669
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481026.1

name	Wibg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821033 GeneID:78428 MGI:1925678
definition	codon_start : 1 exception : unclassified translation discrepancy product : within bgcn homolog protein_id : NP_084376.1

name	Mmp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946772 CCDS:CCDS24292.1 GeneID:58223 MGI:1927899
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA] [Evidence ISS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0030574 - collagen catabolism [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : matrix metalloproteinase 19 protein_id : NP_067387.1

name	1110012D08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017375 CCDS:CCDS24293.1 GeneID:73827 MGI:1921077
definition	codon_start : 1 product : hypothetical protein LOC73827 protein_id : NP_835167.1

name	Dnajc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542012 CCDS:CCDS24294.1 GeneID:74330 MGI:1921580
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DnaJ (Hsp40) homolog, subfamily C, member 14 protein_id : NP_083149.2

name	Ormdl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313282 CCDS:CCDS24295.1 GeneID:66844 MGI:1914094
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : ORM1-like 2 protein_id : NP_077142.1

name	1110005A23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384730 GeneID:66118 MGI:1913368
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cytokine induced protein 29 kDa protein_id : NP_079640.1

name	Gdf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807180 CCDS:CCDS24296.1 GeneID:14561 MGI:1338027
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0048469 - cell maturation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0040007 - growth [Evidence IEA]; GO:0001656 - metanephros development [Evidence IDA]; GO:0045596 - negative regulation of cell differentiation [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0031016 - pancreas development [Evidence IMP]; GO:0001657 - ureteric bud development [Evidence IMP] codon_start : 1 product : growth differentiation factor 11 protein_id : NP_034402.1

name	Cd63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431344 GeneID:12512 MGI:99529
definition	GO_component : GO:0010008 - endosome membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : melanoma 1 antigen product : Cd63 antigen protein_id : NP_001036045.1

name	Cd63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680888 CCDS:CCDS24297.1 GeneID:12512 MGI:99529
definition	GO_component : GO:0010008 - endosome membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : melanoma 1 antigen product : Cd63 antigen protein_id : NP_031679.1

name	Rdh5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549323 CCDS:CCDS24298.1 GeneID:19682 MGI:1201412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : 9-cis-retinol dehydrogenase; 11-cis retinol dehydrogenase; retinol dehydrogenase type 5 product : retinol dehydrogenase 5 protein_id : NP_598767.1

name	Bloc1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980697 CCDS:CCDS24299.1 GeneID:14533 MGI:1195276
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : general control of amino acid synthesis, yeast homolog-like 1; GCN5 general control of amino acid synthesis-like 1 product : general control of amino acid synthesis-like 1 protein_id : NP_056555.2

name	Itga7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293269 CCDS:CCDS24300.1 GeneID:16404 MGI:102700
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 product : integrin alpha 7 protein_id : NP_032424.2

name	Mettl7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229118 CCDS:CCDS24301.1 GeneID:71664 MGI:1918914
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : methyltransferase like 7B protein_id : NP_082129.2

name	Olfr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203795 CCDS:CCDS24302.1 GeneID:18373 MGI:107600
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10675610-10676548; olfactory receptor MOR269-3 product : olfactory receptor 9 protein_id : NP_667072.1

name	Olfr763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203799 CCDS:CCDS24303.1 GeneID:258861 MGI:3030597
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10696986-10697915; olfactory receptor MOR269-2 product : olfactory receptor 763 protein_id : NP_667073.1

name	EG622733 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388733 GeneID:622733 MGI:3648718
definition	codon_start : 1 product : similar to olfactory receptor Olfr227 protein_id : XP_892278.2

name	EG546487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261121 GeneID:546487 MGI:3647536
definition	codon_start : 1 product : similar to olfactory receptor Olfr227 protein_id : XP_621234.3

name	Olfr765 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239322 CCDS:CCDS24304.1 GeneID:258315 MGI:3030599
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PULF-10732607-10731678; olfactory receptor MOR115-4 product : olfactory receptor 765 protein_id : NP_666430.1

name	Olfr768 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129145 CCDS:CCDS24305.1 GeneID:258863 MGI:3030602
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10779441-10778503; olfactory receptor MOR114-4 product : olfactory receptor 768 protein_id : NP_667075.1

name	Olfr769 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128633 CCDS:CCDS24306.1 GeneID:257667 MGI:3030603
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x5J8B7W6HFP-2821674-2820736; GA_x6K02T2PULF-10797876-10796938 product : olfactory receptor 769 protein_id : NP_666379.1

name	Olfr770 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129151 CCDS:CCDS24307.1 GeneID:258862 MGI:3030604
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10819232-10818297; olfactory receptor MOR114-5 product : olfactory receptor 770 protein_id : NP_667074.1

name	Olfr771 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203779 CCDS:CCDS24308.1 GeneID:258540 MGI:3030605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10846420-10845467; olfactory receptor MOR114-8 product : olfactory receptor 771 protein_id : NP_666758.1

name	Olfr772 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170036 CCDS:CCDS24309.1 GeneID:257666 MGI:3030606
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR114-3; GA_x6K02T2PULF-10860457-10859522; olfactory receptor GA_x5J8B7W1NLL-1408-2343 product : olfactory receptor 772 protein_id : NP_666378.1

name	Olfr773-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170074 CCDS:CCDS24310.1 GeneID:257664 MGI:3030607
definition	codon_start : 1 exception : mismatches in translation product : olfactory receptor 773 protein_id : NP_996891.1

name	Olfr774 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518530 GeneID:258232 MGI:3030608
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10924432-10925370; olfactory receptor MOR111-11 product : olfactory receptor 774 protein_id : NP_997503.1

name	Olfr1518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125858743 GeneID:258538 MGI:3031352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR111-7; olfactory receptor 775; GA_x6K02T2PULF-10936819-10937757; olfactory receptor MOR111-6 product : olfactory receptor 1518 protein_id : NP_666756.2

name	Olfr776 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430578 CCDS:CCDS24311.1 GeneID:404321 MGI:3030610
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10947193-10948131 product : olfactory receptor 776 protein_id : NP_997442.1

name	Olfr777 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239328 CCDS:CCDS24312.1 GeneID:258537 MGI:3030611
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10955551-10954616; olfactory receptor MOR114-9 product : olfactory receptor 777 protein_id : NP_666755.1

name	LOC544749 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261123 GeneID:544749
definition	codon_start : 1 product : similar to olfactory receptor Olfr779 protein_id : XP_001479675.1

name	Olfr780 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203773 CCDS:CCDS24313.1 GeneID:258281 MGI:3030614
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11002360-11003298; olfactory receptor MOR114-12 product : olfactory receptor 780 protein_id : NP_666396.1

name	Olfr781 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239326 CCDS:CCDS24314.1 GeneID:258723 MGI:3030615
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11013616-11014551; olfactory receptor MOR114-6 product : olfactory receptor 781 protein_id : NP_666939.1

name	Olfr782 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801360 CCDS:CCDS24315.1 GeneID:257985 MGI:3030616
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11031172-11032116; olfactory receptor MOR110-8 product : olfactory receptor 782 protein_id : NP_001011797.1

name	Olfr784 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129385 CCDS:CCDS24316.1 GeneID:258724 MGI:3030618
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11068246-11069205; olfactory receptor MOR110-3 product : olfactory receptor 784 protein_id : NP_666940.1

name	EG546488 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261125 GeneID:546488 MGI:3647538
definition	codon_start : 1 product : similar to olfactory receptor Olfr787 protein_id : XP_621235.4

name	Olfr786 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544963 CCDS:CCDS24317.1 GeneID:258542 MGI:3030620
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11116958-11117896; olfactory receptor MOR111-5 product : olfactory receptor 786 protein_id : NP_666760.1

name	Olfr787 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801408 CCDS:CCDS24318.1 GeneID:258069 MGI:3030621
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11141498-11142436; olfactory receptor MOR111-10 product : olfactory receptor 787 protein_id : NP_001011822.1

name	Olfr788 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239344 CCDS:CCDS24319.1 GeneID:258544 MGI:3030622
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11151514-11152449; olfactory receptor MOR111-4 product : olfactory receptor 788 protein_id : NP_666762.1

name	Olfr790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129043 CCDS:CCDS24320.1 GeneID:258935 MGI:3030624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11179777-11180721; olfactory receptor MOR112-1 product : olfactory receptor 790 protein_id : NP_667144.1

name	Olfr791 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129045 CCDS:CCDS24321.1 GeneID:258932 MGI:3030625
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11205096-11206034; olfactory receptor MOR114-1 product : olfactory receptor 791 protein_id : NP_667141.1

name	Olfr792 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801456 CCDS:CCDS24322.1 GeneID:258150 MGI:3030626
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11219415-11220350; olfactory receptor MOR108-2 product : olfactory receptor 792 protein_id : NP_001011849.1

name	Olfr794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129549 CCDS:CCDS24323.1 GeneID:258375 MGI:3030628
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11248702-11249664; olfactory receptor MOR114-11 product : olfactory receptor 794 protein_id : NP_666490.1

name	Olfr796 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129047 CCDS:CCDS24324.1 GeneID:258933 MGI:3030630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11287099-11286167; olfactory receptor MOR269-1 product : olfactory receptor 796 protein_id : NP_667142.1

name	Olfr798 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582552 CCDS:CCDS24325.1 GeneID:258549 MGI:3030632
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11304679-11303744; olfactory receptor MOR108-1 product : olfactory receptor 798 protein_id : NP_666767.2

name	Olfr799 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203803 CCDS:CCDS24326.1 GeneID:258929 MGI:3030633
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11325750-11326685; olfactory receptor MOR114-2 product : olfactory receptor 799 protein_id : NP_667138.1

name	Olfr800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203789 CCDS:CCDS24327.1 GeneID:258541 MGI:3030634
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11338429-11339364; olfactory receptor MOR114-7 product : olfactory receptor 800 protein_id : NP_666759.1

name	Olfr801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129719 CCDS:CCDS24328.1 GeneID:258282 MGI:3030635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11349138-11348182; olfactory receptor MOR110-10 product : olfactory receptor 801 protein_id : NP_666397.1

name	Olfr802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129041 CCDS:CCDS24329.1 GeneID:258934 MGI:3030636
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11361362-11360424; olfactory receptor MOR111-1 product : olfactory receptor 802 protein_id : NP_667143.1

name	Olfr803 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129527 CCDS:CCDS24330.1 GeneID:258547 MGI:3030637
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11370664-11369738; olfactory receptor MOR111-3 product : olfactory receptor 803 protein_id : NP_666765.1

name	Olfr804 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801406 CCDS:CCDS24331.1 GeneID:258068 MGI:3030638
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11383575-11384519; olfactory receptor MOR110-7; odorant receptor B3 product : olfactory receptor 804 protein_id : NP_001011821.1

name	Olfr805 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129529 CCDS:CCDS24332.1 GeneID:258548 MGI:3030639
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11402237-11401278; olfactory receptor MOR110-4 product : olfactory receptor 805 protein_id : NP_666766.1

name	Olfr806 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129533 CCDS:CCDS24333.1 GeneID:258546 MGI:3030640
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11417610-11416669; olfactory receptor MOR110-5 product : olfactory receptor 806 protein_id : NP_666764.1

name	Olfr807 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129051 CCDS:CCDS24334.1 GeneID:258931 MGI:3030641
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11434134-11433199; olfactory receptor MOR117-1 product : olfactory receptor 807 protein_id : NP_667140.1

name	Olfr808 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203805 CCDS:CCDS24335.1 GeneID:258930 MGI:3030642
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11446184-11447122; olfactory receptor MOR112-2 product : olfactory receptor 808 protein_id : NP_667139.1

name	Olfr809 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129645 CCDS:CCDS24336.1 GeneID:258321 MGI:3030643
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11454600-11455541; olfactory receptor MOR108-4 product : olfactory receptor 809 protein_id : NP_666436.1

name	Olfr810 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239332 CCDS:CCDS24337.1 GeneID:258543 MGI:3030644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11470271-11469333; olfactory receptor MOR113-4 product : olfactory receptor 810 protein_id : NP_666761.1

name	Olfr811 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239342 CCDS:CCDS24338.1 GeneID:258545 MGI:3030645
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11481207-11480248; olfactory receptor MOR110-6 product : olfactory receptor 811 protein_id : NP_666763.1

name	Olfr812 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129259 CCDS:CCDS24339.1 GeneID:258791 MGI:3030646
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11521598-11520666; olfactory receptor MOR110-1 product : olfactory receptor 812 protein_id : NP_667006.1

name	Olfr813 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391055 CCDS:CCDS24340.1 GeneID:258252 MGI:3030647
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11535078-11536010; olfactory receptor MOR108-3 product : olfactory receptor 813 protein_id : NP_997030.1

name	Olfr814 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391071 CCDS:CCDS24341.1 GeneID:259165 MGI:3030648
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11553313-11552381; olfactory receptor MOR113-5 product : olfactory receptor 814 protein_id : NP_997042.1

name	LOC382468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382468
definition	number : 1 pseudo : _no_value

name	LOC100043077 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043077
definition	number : 1 pseudo : _no_value

name	LOC668453 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668453
definition	number : 1 pseudo : _no_value

name	LOC100043114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043114
definition	number : 1 pseudo : _no_value

name	LOC624925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624925
definition	number : 2 pseudo : _no_value

name	LOC624925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624925
definition	number : 1 pseudo : _no_value

name	Olfr789-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258148
definition	number : 1 pseudo : _no_value

name	Olfr789-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258148
definition	number : 2 pseudo : _no_value

name	LOC100043624 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261214 GeneID:100043624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Ribosomal protein L34 pseudo : _no_value transcript_id : XR_034912.1

name	LOC668459 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261119 GeneID:668459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins product : hypothetical LOC668459 pseudo : _no_value transcript_id : XR_034246.1

name	LOC622655 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261217 GeneID:622655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 2624 ESTs, 6 Proteins product : similar to hCG31107 pseudo : _no_value transcript_id : XR_034936.1

clone name	MSMg01-108J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-095C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-357J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134B19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-510O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-484H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-071H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-196E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346J06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-483J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-188F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-429H05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-490H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408O24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387J20
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-204F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300B05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-097O08.b	B6Ng01-097O08.g
ACC	DH908144	DH908145
length	763	735
definition	DH908144\|Mus musculus domesticus DNA, BAC clone: B6Ng01-097O08, 5' end.	DH908145\|Mus musculus domesticus DNA, BAC clone: B6Ng01-097O08, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(128,140,951 - 128,141,707)	(128,335,909 - 128,336,475)
sequence	tcatagtgatcatctctcagagcagacttacttgacgatattagggtgat taagttccttaaggagagagatctctcggatggcagtactgggtacacct tcagtctcacttggagaggttgggaaaacagagacaagaatacggttaca aacatcattctctcagggatacacaacccccagcccccttaggaaggcag acaggagaggtgctgtgaggagttaatttctgggtagttagggtgtggct tttagacatatttaaggccattatttcctctttttccagtgaaaggtaag aagagcctccaggtgaatgaaaagcagaagaaaggtaataggggagtggg gtgagagtagctcccggcctcccctgagggccagtgaatctcaactgcca ttcttttgaaagagagtgagggttctaagtatggtgctggagcagtgagg agagctctccattcagaaaggaacttttctctggttaccacataacccaa ctccacgaacagccctggacccctcctatcccgggctcccaccccacaac tttctcttcccaagtctctcggctagcagatttgggagcacaccggctgg agcactgcaagaaacttttcccctggattccagccccggacagtctcctc cggtagagcctccacggtcggccaacccaccgctcgcttcacgcggtccc tccctccctccccgctacctttccgggtccgggggacgctacccgcctgt ttggggtaggggg	gaattccaggacagccagggctacacagagaaaccctgtctcgaaaaaca aaacaaaacaaaacaaaacaaaacaaaaaaaaaaaaaaaaacaaaaaaaa aaaaaaaagaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaagga aaggaaaggaaagaactcactatgtagaccaggctggcctcaaactcata gatatctgcctttctctgcctccctcccaagtgttagaattaaaggtgtg caccactatgcctgggcatattatctttagacttgtgggaattaaattga ctttgcttgctgagcagtggtggcacacacctttgatcccaaatactcca ggggctgaggcaggtggatctttgtgaatttgaggccagcctggtctaca gagtgagttctagaacagccagagctatacagagaaaccctgtatccaaa aaaaaaaattgtatttaattaattagttaattaattaaaaataaaacaac tttgctctgatgggctgagaaggtggctcattggtggatagaattgactg ctctcccagaggacccatgtgcagtctcacaccaggtggctcacaactgt cactccatctacaggggatctgacaccctttctgcattccatgggcgcct tcatcttttctgctgagacagagcacagatgagcttttaatcaatgagac aaaagcaaagctatgtgtttgctggtaacttattt
quality values	Open. Hide. 43 43 36 61 49 55 52 61 38 49 49 49 59 61 61 61 61 49 43 11 14 18 17 10 10 12 11 11 9 24 31 41 43 59 59 59 59 61 61 61 61 59 59 59 59 61 59 61 61 59 59 59 44 55 61 61 61 61 61 61 59 59 27 49 36 24 28 24 28 26 36 36 59 59 59 61 61 61 59 61 59 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 59 59 59 61 59 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 61 61 59 61 59 61 59 61 59 61 61 61 61 59 59 59 50 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 59 61 61 59 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 45 59 59 52 59 49 49 52 59 59 59 59 59 59 59 59 49 59 59 61 59 59 35 49 52 43 49 52 59 59 59 59 59 59 41 59 52 61 59 59 61 61 59 61 59 59 59 59 52 52 61 55 55 55 61 61 61 55 61 55 61 61 61 61 52 55 55 52 55 61 49 55 55 61 55 61 61 61 61 61 61 61 61 55 55 55 55 55 43 61 55 52 52 61 61 55 52 61 49 43 37 29 34 37 55 61 61 49 50 50 47 43 49 43 41 55 50 47 47 55 55 39 55 55 61 55 61 55 61 55 61 55 55 43 50 43 55 50 55 61 61 61 43 55 55 55 55 55 61 53 53 47 50 50 50 50 50 50 50 61 61 61 61 50 53 50 47 43 43 43 43 50 50 53 50 53 53 50 50 50 53 50 50 50 38 50 39 47 53 53 50 50 47 50 50 39 52 50 37 27 32 21 47 27 35 33 39 47 35 52 35 45 45 52 45 43 52 45 50 39 45 52 47 47 34 42 50 53 53 53 41 45 23 40 61 52 46 52 47 53 53 43 35 38 36 38 42 42 34 52 45 37 34 38 29 28 38 42 38 45 33 53 47 38 53 30 30 32 20 30 27 17 16 23 20 47 38 43 35 50 35 22 38 38 35 36 28 45 47 24 9 47 52 52 34 35 28 16 25 24 32 28 21 52 45 38 50 38 38 30 29 24 19 31 30 21 30 20 10 24 28 28 34 19 24 35 38 38 32 43 32 20 20 23 16 18 22 17 42 39 28 18 18 28 17 28 20 16 30 30 20 18 34 15 45 45 32 10 40 20 10 15 33 22 31 30 36 33 19 34 35 26 12 34 8 36 19 33 35 34 19 29 32 32 24 21	Open. Hide. 59 59 59 61 61 59 12 12 11 11 7 10 8 11 10 19 19 36 43 61 59 55 61 61 59 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 36 32 26 26 28 26 26 37 52 59 59 59 59 61 55 55 61 61 61 61 61 59 61 61 61 59 59 61 61 61 59 59 61 61 61 52 59 43 50 52 49 52 61 61 61 59 59 61 61 61 61 61 61 52 52 52 27 59 52 44 59 61 61 61 59 59 59 61 59 59 59 61 59 59 59 59 55 55 55 59 59 59 61 59 59 55 55 55 44 55 55 55 59 59 49 43 59 55 44 44 55 59 59 55 55 55 44 43 49 44 36 50 49 43 49 44 32 38 39 36 39 44 36 39 27 49 44 39 43 49 38 36 36 52 52 45 49 44 45 43 45 45 49 39 37 31 39 38 28 49 36 36 39 35 37 39 59 50 55 59 52 52 49 52 45 49 45 45 36 39 45 43 39 41 41 43 59 39 37 39 52 39 23 30 13 28 31 39 45 45 49 41 31 44 27 36 30 44 35 27 49 45 36 45 44 44 49 49 52 49 35 59 52 52 43 43 49 39 52 45 37 37 36 37 36 39 45 37 49 43 39 30 36 24 37 32 41 37 41 52 45 45 49 49 52 49 49 49 39 49 52 49 52 45 52 44 52 39 49 41 52 26 36 36 34 39 49 36 31 52 36 31 45 49 37 36 36 44 36 49 45 43 36 36 49 43 59 45 43 52 39 35 36 41 41 36 38 27 52 61 61 59 49 52 52 59 49 38 23 18 24 35 23 36 30 33 36 23 36 37 59 52 39 43 52 45 52 52 59 52 59 59 61 59 59 43 27 39 45 27 35 18 19 22 27 33 41 35 35 49 36 43 52 49 52 52 43 52 49 28 13 43 49 59 52 43 35 39 32 31 52 30 35 35 28 33 25 33 24 22 52 31 52 52 43 55 52 43 27 36 18 29 41 43 38 49 52 52 52 52 52 52 52 52 50 49 49 35 52 30 49 52 55 49 52 55 55 30 35 43 55 47 47 35 35 38 47 41 37 41 55 50 47 43 50 55 49 50 49 43 38 37 37 26 28 37 26 37 49 37 31 29 21 28 23 19 23 34 24 38 49 43 37 43 31 43 14 37 29 27 30 25 50 50 43 47 35 35 32 35 36 18 32 43 43 43 31 21 15 25 22 14 8 28 43 32 33 39 33 52 61 39 39 39 33 23 5 24 24 29 33 31 45 38 31 37 47 42 53 61 14 24 21 32 28 39 34 45 35 39 33 28 28 27 9 38 24 17 17 21 29 28 40 31 38 38 47 16 43 30 43 38 34 34 20 31 32 29 30 45 24 31 45 32 14 50 38 52 39 38 40 29 29 40 39 38 39 43 31 33 30 43 28 22 36 38 39 30 30 30 36 27 18 30 27 33 34 35 17 26 12 26 28 34 30 42 33 43 43 32 37 45 31 52 15 39 23 17 14 22 8 14 14 19 12 7 32 35 23 50 12 18 9 23 26 20 9 8 7 8 6 8 22 23 36 29 25 34 31 28 20 23 9 24 19 14 31 27 42 37 45 42 50 17 31 31 42 26 10 14 6 8 16 7 15 14 19 7 7 4 24 23 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_128140951_128141707
seq2: B6Ng01-097O08.b_52_814

seq1  TCATAGTGATCATCTCTCAGAGCAGACTTACTTGACGATATTAGGGTGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATAGTGATCATCTCTCAGAGCAGACTTACTTGACGATATTAGGGTGAT  50

seq1  TAAGTTCCTTAAGGAGAGAGATCTCTCGGATGGCAGTACTGGGTACACCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTTCCTTAAGGAGAGAGATCTCTCGGATGGCAGTACTGGGTACACCT  100

seq1  TCAGTCTCACTTGGAGAGGTTGGGAAAACAGAGACAAGAATACGGTTACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTCTCACTTGGAGAGGTTGGGAAAACAGAGACAAGAATACGGTTACA  150

seq1  AACATCATTCTCTCAGGGATACACAACCCCCAGCCCCCTTAGGAAGGCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATCATTCTCTCAGGGATACACAACCCCCAGCCCCCTTAGGAAGGCAG  200

seq1  ACAGGAGAGGTGCTGTGAGGAGTTAATTTCTGGGTAGTTAGGGTGTGGCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGAGAGGTGCTGTGAGGAGTTAATTTCTGGGTAGTTAGGGTGTGGCT  250

seq1  TTTAGACATATTTAAGGCCATTATTTCCTCTTTTTCCAGTGAAAGGTAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGACATATTTAAGGCCATTATTTCCTCTTTTTCCAGTGAAAGGTAAG  300

seq1  AAGAGCCTCCAGGTGAATGAAAAGCAGAAGAAAGGTAATAGGGGAGTGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCCTCCAGGTGAATGAAAAGCAGAAGAAAGGTAATAGGGGAGTGGG  350

seq1  GTGAGAGTAGCTCCCGGCCTCCCCTGAGGGCCAGTGAATCTCAACTGCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGAGTAGCTCCCGGCCTCCCCTGAGGGCCAGTGAATCTCAACTGCCA  400

seq1  TTCTTTTGAAAGAGAGTGAGGGTTCTAAGTATGGTGCTGGAGCAGTGAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTTGAAAGAGAGTGAGGGTTCTAAGTATGGTGCTGGAGCAGTGAGG  450

seq1  AGAGCTCTCCATTCAGAAAGGAACTTTTCTCTGGTTACCACATAACCCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTCTCCATTCAGAAAGGAACTTTTCTCTGGTTACCACATAACCCAA  500

seq1  CTCCACGAACAGCCCTGGACCCCTCCTATCCCGGGCTCCCACCCCACAAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACGAACAGCCCTGGACCCCTCCTATCCCGGGCTCCCACCCCACAAC  550

seq1  TTTCTCTTCCCAAGTCTCTCGGCTAGCAGATTTGGGAGCACACCGGCTGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTCTTCCCAAGTCTCTCGGCTAGCAGATTTGGGAGCACACCGGCTGG  600

seq1  AGCACTGCAAGAAAC-TTTCCCCTGGATTCCAGCCCCGGACAGTCTCCTC  649
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  AGCACTGCAAGAAACTTTTCCCCTGGATTCCAGCCCCGGACAGTCTCCTC  650

seq1  CGGTAGAGCCTCCACGGTCGGCCAACCCACCGCTCGCTTCACGC-GTCCC  698
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  CGGTAGAGCCTCCACGGTCGGCCAACCCACCGCTCGCTTCACGCGGTCCC  700

seq1  TCCCTCCCTCCCCGCTACCTT--CCGGTCC-GGGGACGCTACCCGCCTG-  744
      |||||||||||||||||||||  | ||||| |||||||||||||||||| 
seq2  TCCCTCCCTCCCCGCTACCTTTCCGGGTCCGGGGGACGCTACCCGCCTGT  750

seq1  TTGGGGTAGGGGG  757
      |||||||||||||
seq2  TTGGGGTAGGGGG  763

seq1: chr10_128335909_128336475
seq2: B6Ng01-097O08.g_236_803 (reverse)

seq1  AAAAAAGTAACCAGCAAACACATAGCTTTGCTTTTGTCTCATTGATTAAA  50
      ||| |||| |||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGTTACCAGCAAACACATAGCTTTGCTTTTGTCTCATTGATTAAA  50

seq1  TGCTCATCTGTGCTCTGTCTCAGCAG-AAAGATGAAGGCGCCCATGGAAT  99
       ||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  AGCTCATCTGTGCTCTGTCTCAGCAGAAAAGATGAAGGCGCCCATGGAAT  100

seq1  GCAGAAAGGGTGTCAGATCCCCTGTAGATGGAGTGACAGTTGTGAGCCAC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAAAGGGTGTCAGATCCCCTGTAGATGGAGTGACAGTTGTGAGCCAC  150

seq1  CTGGTGTGAGACTGCACATGGGTCCTCTGGGAGAGCAGTCAATTCTATCC  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTGTGAGACTGCACATGGGTCCTCTGGGAGAGCAGTCAATTCTATCC  200

seq1  ACCAATGAGCCACCTTCTCAGCCCATCAGAGCAAAGTTGTTTTATTTTTA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAATGAGCCACCTTCTCAGCCCATCAGAGCAAAGTTGTTTTATTTTTA  250

seq1  ATTAATTAACTAATTAATTAAATACAATTTTTTTTTTTGGATACAGGGTT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAATTAACTAATTAATTAAATACAATTTTTTTTTTTGGATACAGGGTT  300

seq1  TCTCTGTATAGCTCTGGCTGTTCTAGAACTCACTCTGTAGACCAGGCTGG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGTATAGCTCTGGCTGTTCTAGAACTCACTCTGTAGACCAGGCTGG  350

seq1  CCTCAAATTCACAAAGATCCACCTGCCTCAGCCCCTGGAGTATTTGGGAT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAAATTCACAAAGATCCACCTGCCTCAGCCCCTGGAGTATTTGGGAT  400

seq1  CAAAGGTGTGTGCCACCACTGCTCAGCAAGCAAAGTCAATTTAATTCCCA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGTGTGTGCCACCACTGCTCAGCAAGCAAAGTCAATTTAATTCCCA  450

seq1  CAAGTCTAAAGATAATATGCCCAGGCATAGTGGTGCACACCTTTAATTCT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTCTAAAGATAATATGCCCAGGCATAGTGGTGCACACCTTTAATTCT  500

seq1  AACACTTGGGAGGGAGGCAGAGAAAGGCAGATATCTATGAGTTTGAGGCC  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACTTGGGAGGGAGGCAGAGAAAGGCAGATATCTATGAGTTTGAGGCC  550

seq1  AGCCTGGTCTACATAGTG  567
      ||||||||||||||||||
seq2  AGCCTGGTCTACATAGTG  568

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information