MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-106J14
Chromosome	10 (Build37)
Map Location	129,072,932 - 129,073,985
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Ikzf4, Suox, EG622589, Rab5b, Cdk2, Si, Dgka, LOC100043669, Wibg, LOC622655, Mmp19, 1110012D08Rik, Dnajc14, Ormdl2, 1110005A23Rik, Gdf11, Cd63, Rdh5, Bloc1s1, Itga7, Mettl7b, Olfr9, Olfr763, EG622733, EG546487, Olfr765, Olfr768, Olfr769, Olfr770, Olfr771, Olfr772, Olfr773-ps1, LOC624925, Olfr774, Olfr1518, Olfr776, Olfr777, Olfr778-ps1, LOC544749, Olfr780, Olfr781, Olfr782, Olfr783-ps1, Olfr784, EG546488, Olfr786, Olfr787, Olfr788, Olfr789-ps1, Olfr790, Olfr791, Olfr792, GA_x5J8B7W6HFP-3168293-3169194, Olfr794, GA_x5J8B7W6HFP-3198834-3199739, Olfr796, GA_x5J8B7W6HFP-3231749-3230798, Olfr798
Downstream gene	Olfr799, Olfr800, Smt3h2-ps3, Olfr801, Olfr802, Olfr803, Olfr804, Olfr805, Olfr806, Olfr807, Olfr808, Olfr809, Olfr810, Olfr811, Olfr812, Olfr813, Olfr814, Olfr815, Olfr816, Olfr1544-ps1, Olfr817-ps1, Olfr818, LOC100043200, Olfr247, LOC100043203, Olfr820, Olfr821, Olfr822, Olfr1542-ps1, Olfr823, LOC382471, Olfr824, LOC672405, Olfr825, Olfr826, Olfr827, Neurod4, 5830405N20Rik, EG625068, LOC100043719, EG623734, EG625109, EG625131
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pa2g4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18813 MGI:894684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erbb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13867 MGI:95411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins pseudo : _no_value

name	Rps26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27370 MGI:1351628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikzf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22781 MGI:1343139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211389 MGI:2446117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622589 MGI:3647630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 905 ESTs, 8 Proteins

name	Rab5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19344 MGI:105938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cdk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12566 MGI:104772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Si (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20431 MGI:98301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13139 MGI:102952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043669 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Wibg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78428 MGI:1925678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 2624 ESTs, 6 Proteins pseudo : _no_value

name	Mmp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58223 MGI:1927899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110012D08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73827 MGI:1921077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74330 MGI:1921580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ormdl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66844 MGI:1914094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110005A23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66118 MGI:1913368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14561 MGI:1338027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12512 MGI:99529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rdh5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19682 MGI:1201412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bloc1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14533 MGI:1195276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16404 MGI:102700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mettl7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71664 MGI:1918914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18373 MGI:107600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr763 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258861 MGI:3030597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622733 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622733 MGI:3648718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2403 Proteins

name	EG546487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546487 MGI:3647536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2453 Proteins

name	Olfr765 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258315 MGI:3030599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr768 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258863 MGI:3030602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr769 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257667 MGI:3030603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr770 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258862 MGI:3030604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr771 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258540 MGI:3030605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257666 MGI:3030606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr773-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257664 MGI:3030607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr774 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258232 MGI:3030608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258538 MGI:3031352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404321 MGI:3030610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr777 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258537 MGI:3030611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr778-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404426 MGI:3030612
definition	note : olfactory receptor 778, pseudogene 1 pseudo : _no_value

name	LOC544749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 961 Proteins

name	Olfr780 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258281 MGI:3030614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258723 MGI:3030615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257985 MGI:3030616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr783-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257983 MGI:3030617
definition	gene_synonym : MOR114-10P note : olfactory receptor 783, pseudogene 1 pseudo : _no_value

name	Olfr784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258724 MGI:3030618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546488 MGI:3647538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2326 Proteins

name	Olfr786 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258542 MGI:3030620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr787 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258069 MGI:3030621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr788 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258544 MGI:3030622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr789-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258148 MGI:3030623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2348 Proteins pseudo : _no_value

name	Olfr790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258935 MGI:3030624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr791 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258932 MGI:3030625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr792 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258150 MGI:3030626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6HFP-3168293-3169194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257720
definition	note : olfactory receptor GA_x5J8B7W6HFP-3168293-3169194 pseudo : _no_value

name	Olfr794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258375 MGI:3030628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6HFP-3198834-3199739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257771
definition	note : olfactory receptor GA_x5J8B7W6HFP-3198834-3199739 pseudo : _no_value

name	Olfr796 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258933 MGI:3030630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6HFP-3231749-3230798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257770
definition	note : olfactory receptor GA_x5J8B7W6HFP-3231749-3230798 pseudo : _no_value

name	Olfr798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258549 MGI:3030632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr799 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258929 MGI:3030633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr800 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258541 MGI:3030634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smt3h2-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108289 MGI:1926285
definition	note : SMT3 suppressor of mif two 3 homolog 2, pseudogene 3 (S. cerevisiae) pseudo : _no_value

name	Olfr801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258282 MGI:3030635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258934 MGI:3030636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr803 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258547 MGI:3030637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr804 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258068 MGI:3030638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr805 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258548 MGI:3030639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr806 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258546 MGI:3030640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr807 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258931 MGI:3030641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr808 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258930 MGI:3030642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258321 MGI:3030643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr810 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258543 MGI:3030644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr811 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258545 MGI:3030645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr812 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258791 MGI:3030646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr813 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258252 MGI:3030647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259165 MGI:3030648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr815 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258665 MGI:3030649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr816 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258667 MGI:3030650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1544-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259141 MGI:3031378
definition	gene_synonym : MOR281-2P note : olfactory receptor 1544, pseudogene 1 pseudo : _no_value

name	Olfr817-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257918 MGI:3030651
definition	gene_synonym : MOR110-9 note : olfactory receptor 817, pseudogene 1 pseudo : _no_value

name	Olfr818 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258773 MGI:3030652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043200 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2010 Proteins

name	Olfr247 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258266 MGI:3030081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2033 Proteins pseudo : _no_value

name	Olfr820 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258670 MGI:3030654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258772 MGI:3030655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr822 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258666 MGI:3030656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1542-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259142 MGI:3031376
definition	gene_synonym : MOR0-8P note : olfactory receptor 1542, pseudogene 1 pseudo : _no_value

name	Olfr823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258668 MGI:3030657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Olfr824 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258669 MGI:3030658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr825 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258672 MGI:3030659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr826 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258671 MGI:3030660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr827 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258297 MGI:3030661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neurod4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11923 MGI:108055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830405N20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67596 MGI:1914846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625068 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625068 MGI:3643367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043719 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 111 ESTs, 26 Proteins pseudo : _no_value

name	EG623734 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623734 MGI:3646965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 Proteins

name	EG625109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625109 MGI:3649066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 11 Proteins

name	EG625131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625131 MGI:3645796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 11 Proteins

name	Pa2g4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383894 GeneID:18813 MGI:894684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proliferation-associated 2G4 transcript_id : NM_011119.3

name	Erbb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098018 GeneID:13867 MGI:95411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) transcript_id : NM_010153.1

name	Rps26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305446 GeneID:27370 MGI:1351628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S26 transcript_id : NM_013765.1

name	Ikzf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114636 GeneID:22781 MGI:1343139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IKAROS family zinc finger 4 transcript_id : NM_011772.2

name	Suox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343458 GeneID:211389 MGI:2446117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfite oxidase transcript_id : NM_173733.2

name	EG622589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388730 GeneID:622589 MGI:3647630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 905 ESTs, 8 Proteins product : predicted gene, EG622589 transcript_id : XM_887027.2

name	Rab5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130364 GeneID:19344 MGI:105938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5B, member RAS oncogene family transcript_id : NM_177411.3

name	Rab5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755261 GeneID:19344 MGI:105938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5B, member RAS oncogene family transcript_id : NM_011229.1

name	Cdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803406 GeneID:12566 MGI:104772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 2 transcript_id : NM_016756.3

name	Cdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715990 GeneID:12566 MGI:104772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 2 transcript_id : NM_183417.2

name	Si (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353045 GeneID:20431 MGI:98301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : silver transcript_id : NM_021882.4

name	Dgka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560473 GeneID:13139 MGI:102952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, alpha transcript_id : NM_016811.2

name	LOC100043669 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261215 GeneID:100043669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100043669 transcript_id : XM_001480976.1

name	Wibg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753956 GeneID:78428 MGI:1925678
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : within bgcn homolog (Drosophila) transcript_id : NM_030100.2

name	Mmp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946771 GeneID:58223 MGI:1927899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 19 transcript_id : NM_021412.1

name	1110012D08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342609 GeneID:73827 MGI:1921077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012D08 gene transcript_id : NM_178066.2

name	Dnajc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366323 GeneID:74330 MGI:1921580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 14 transcript_id : NM_028873.3

name	Ormdl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892143 GeneID:66844 MGI:1914094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ORM1-like 2 (S. cerevisiae) transcript_id : NM_024180.4

name	1110005A23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384729 GeneID:66118 MGI:1913368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110005A23 gene transcript_id : NM_025364.1

name	Gdf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807179 GeneID:14561 MGI:1338027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 11 transcript_id : NM_010272.1

name	Cd63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431343 GeneID:12512 MGI:99529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd63 antigen transcript_id : NM_001042580.1

name	Cd63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431342 GeneID:12512 MGI:99529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd63 antigen transcript_id : NM_007653.3

name	Rdh5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94421441 GeneID:19682 MGI:1201412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 5 transcript_id : NM_134006.4

name	Bloc1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373142 GeneID:14533 MGI:1195276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biogenesis of lysosome-related organelles complex-1, subunit 1 transcript_id : NM_015740.3

name	Itga7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293268 GeneID:16404 MGI:102700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 7 transcript_id : NM_008398.2

name	Mettl7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376702 GeneID:71664 MGI:1918914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase like 7B transcript_id : NM_027853.2

name	Olfr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203794 GeneID:18373 MGI:107600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 9 transcript_id : NM_146861.1

name	Olfr763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203798 GeneID:258861 MGI:3030597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 763 transcript_id : NM_146862.1

name	EG622733 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388732 GeneID:622733 MGI:3648718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2403 Proteins product : predicted gene, EG622733 transcript_id : XM_887185.2

name	EG546487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261120 GeneID:546487 MGI:3647536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2453 Proteins product : predicted gene, EG546487 transcript_id : XM_621234.3

name	Olfr765 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239321 GeneID:258315 MGI:3030599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 765 transcript_id : NM_146318.1

name	Olfr768 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129144 GeneID:258863 MGI:3030602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 768 transcript_id : NM_146864.1

name	Olfr769 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128632 GeneID:257667 MGI:3030603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 769 transcript_id : NM_146267.1

name	Olfr770 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129150 GeneID:258862 MGI:3030604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 770 transcript_id : NM_146863.1

name	Olfr771 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203778 GeneID:258540 MGI:3030605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 771 transcript_id : NM_146547.1

name	Olfr772 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170035 GeneID:257666 MGI:3030606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 772 transcript_id : NM_146266.1

name	Olfr773-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170073 GeneID:257664 MGI:3030607
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 773, pseudogene 1 transcript_id : NM_207008.1

name	Olfr774 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518529 GeneID:258232 MGI:3030608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 774 transcript_id : NM_207620.1

name	Olfr1518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125858742 GeneID:258538 MGI:3031352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1518 transcript_id : NM_146545.2

name	Olfr776 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430577 GeneID:404321 MGI:3030610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 776 transcript_id : NM_207559.1

name	Olfr777 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239327 GeneID:258537 MGI:3030611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 777 transcript_id : NM_146544.1

name	LOC544749 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261122 GeneID:544749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 961 Proteins product : similar to olfactory receptor Olfr779 transcript_id : XM_001479625.1

name	Olfr780 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203772 GeneID:258281 MGI:3030614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 780 transcript_id : NM_146284.1

name	Olfr781 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239325 GeneID:258723 MGI:3030615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 781 transcript_id : NM_146728.1

name	Olfr782 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801359 GeneID:257985 MGI:3030616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 782 transcript_id : NM_001011797.1

name	Olfr784 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129384 GeneID:258724 MGI:3030618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 784 transcript_id : NM_146729.1

name	EG546488 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261124 GeneID:546488 MGI:3647538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2326 Proteins product : predicted gene, EG546488 transcript_id : XM_621235.4

name	Olfr786 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544962 GeneID:258542 MGI:3030620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 786 transcript_id : NM_146549.1

name	Olfr787 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801407 GeneID:258069 MGI:3030621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 787 transcript_id : NM_001011822.1

name	Olfr788 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239343 GeneID:258544 MGI:3030622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 788 transcript_id : NM_146551.1

name	Olfr790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129042 GeneID:258935 MGI:3030624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 790 transcript_id : NM_146933.1

name	Olfr791 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129044 GeneID:258932 MGI:3030625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 791 transcript_id : NM_146930.1

name	Olfr792 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801455 GeneID:258150 MGI:3030626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 792 transcript_id : NM_001011849.1

name	Olfr794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129548 GeneID:258375 MGI:3030628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 794 transcript_id : NM_146378.1

name	Olfr796 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129046 GeneID:258933 MGI:3030630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 796 transcript_id : NM_146931.1

name	Olfr798 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582551 GeneID:258549 MGI:3030632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 798 transcript_id : NM_146556.2

name	Olfr799 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203802 GeneID:258929 MGI:3030633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 799 transcript_id : NM_146927.1

name	Olfr800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203788 GeneID:258541 MGI:3030634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 800 transcript_id : NM_146548.1

name	Olfr801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129718 GeneID:258282 MGI:3030635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 801 transcript_id : NM_146285.1

name	Olfr802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129040 GeneID:258934 MGI:3030636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 802 transcript_id : NM_146932.1

name	Olfr803 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129526 GeneID:258547 MGI:3030637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 803 transcript_id : NM_146554.1

name	Olfr804 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801405 GeneID:258068 MGI:3030638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 804 transcript_id : NM_001011821.1

name	Olfr805 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129528 GeneID:258548 MGI:3030639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 805 transcript_id : NM_146555.1

name	Olfr806 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129532 GeneID:258546 MGI:3030640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 806 transcript_id : NM_146553.1

name	Olfr807 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129050 GeneID:258931 MGI:3030641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 807 transcript_id : NM_146929.1

name	Olfr808 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203804 GeneID:258930 MGI:3030642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 808 transcript_id : NM_146928.1

name	Olfr809 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129644 GeneID:258321 MGI:3030643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 809 transcript_id : NM_146324.1

name	Olfr810 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239331 GeneID:258543 MGI:3030644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 810 transcript_id : NM_146550.1

name	Olfr811 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239341 GeneID:258545 MGI:3030645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 811 transcript_id : NM_146552.1

name	Olfr812 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129258 GeneID:258791 MGI:3030646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 812 transcript_id : NM_146795.1

name	Olfr813 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391054 GeneID:258252 MGI:3030647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 813 transcript_id : NM_207147.1

name	Olfr814 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391070 GeneID:259165 MGI:3030648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 814 transcript_id : NM_207159.1

name	Olfr815 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239329 GeneID:258665 MGI:3030649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 815 transcript_id : NM_146670.1

name	Olfr816 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239333 GeneID:258667 MGI:3030650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 816 transcript_id : NM_146672.1

name	Olfr818 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129296 GeneID:258773 MGI:3030652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 818 transcript_id : NM_146777.1

name	LOC100043200 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261128 GeneID:100043200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2010 Proteins product : similar to olfactory receptor MOR265-1 transcript_id : XM_001479734.1

name	Olfr247 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529277 GeneID:258266 MGI:3030081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 247 transcript_id : NM_146269.2

name	Olfr820 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239323 GeneID:258670 MGI:3030654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 820 transcript_id : NM_146675.1

name	Olfr821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129294 GeneID:258772 MGI:3030655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 821 transcript_id : NM_146776.1

name	Olfr822 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239335 GeneID:258666 MGI:3030656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 822 transcript_id : NM_146671.1

name	Olfr823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583929 GeneID:258668 MGI:3030657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 823 transcript_id : NM_146673.2

name	Olfr824 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380652 GeneID:258669 MGI:3030658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 824 transcript_id : NM_146674.1

name	Olfr825 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239097 GeneID:258672 MGI:3030659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 825 transcript_id : NM_146677.1

name	Olfr826 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239099 GeneID:258671 MGI:3030660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 826 transcript_id : NM_146676.1

name	Olfr827 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129684 GeneID:258297 MGI:3030661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 827 transcript_id : NM_146300.1

name	Neurod4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370774 GeneID:11923 MGI:108055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurogenic differentiation 4 transcript_id : NM_007501.3

name	5830405N20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352119 GeneID:67596 MGI:1914846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830405N20 gene transcript_id : NM_183264.2

name	EG625068 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517667 GeneID:625068 MGI:3643367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG625068 transcript_id : NM_001081448.1

name	EG623734 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388738 GeneID:623734 MGI:3646965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 Proteins product : predicted gene, EG623734 transcript_id : XM_888223.2

name	EG625109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83028447 GeneID:625109 MGI:3649066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 9 Proteins product : predicted gene, EG625109, transcript variant 1 transcript_id : XM_893348.1

name	EG625109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83028437 GeneID:625109 MGI:3649066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : predicted gene, EG625109, transcript variant 2 transcript_id : XM_900767.1

name	EG625131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83028449 GeneID:625131 MGI:3645796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 9 Proteins product : predicted gene, EG625131, transcript variant 1 transcript_id : XM_893353.1

name	EG625131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83028451 GeneID:625131 MGI:3645796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG625131, transcript variant 2 transcript_id : XM_900794.1

name	Pa2g4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755100 CCDS:CCDS24282.1 GeneID:18813 MGI:894684
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0050897 - cobalt ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004239 - methionyl aminopeptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : proliferation-associated protein 1; proliferation-associated 2G4, 38kD product : ErbB3-binding protein 1 protein_id : NP_035249.1

name	Erbb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098019 CCDS:CCDS24283.1 GeneID:13867 MGI:95411
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016328 - lateral plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005006 - epidermal growth factor receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : avian erythroblastosis oncogene B 3 receptor; receptor tyrosine kinase; glial growth factor receptor product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 protein_id : NP_034283.1

name	Rps26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305447 GeneID:27370 MGI:1351628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribosomal protein S26 protein_id : NP_038793.1

name	Ikzf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114637 CCDS:CCDS24284.1 GeneID:22781 MGI:1343139
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IPI] codon_start : 1 note : zinc finger protein, subfamily 1A, 4 (Eos) product : zinc finger protein, subfamily 1A, 4 protein_id : NP_035902.2

name	Suox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74024924 CCDS:CCDS24285.1 GeneID:211389 MGI:2446117
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030151 - molybdenum ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008482 - sulfite oxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : sulfite oxidase protein_id : NP_776094.2

name	EG622589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028352 GeneID:622589 MGI:3647630
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892120.1

name	Rab5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755262 CCDS:CCDS24287.1 GeneID:19344 MGI:105938
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5B, member RAS oncogene family protein_id : NP_035359.1

name	Rab5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916687 CCDS:CCDS24287.1 GeneID:19344 MGI:105938
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5B, member RAS oncogene family protein_id : NP_803130.1

name	Cdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949020 CCDS:CCDS24288.1 GeneID:12566 MGI:104772
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cyclin-dependent kinase 2 isoform 2 protein_id : NP_058036.1

name	Cdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556205 CCDS:CCDS24289.1 GeneID:12566 MGI:104772
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cyclin-dependent kinase 2 isoform 1 protein_id : NP_904326.1

name	Si (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981217 GeneID:20431 MGI:98301
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006583 - melanin biosynthesis from tyrosine [Evidence IEA] codon_start : 1 note : melanocyte protein pmel 17 product : silver protein_id : NP_068682.2

name	Dgka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560474 CCDS:CCDS24290.1 GeneID:13139 MGI:102952
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : diacylglycerol kinase, alpha (80 kDa) product : diacylglycerol kinase, alpha protein_id : NP_058091.2

name	LOC100043669 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261216 GeneID:100043669
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481026.1

name	Wibg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821033 GeneID:78428 MGI:1925678
definition	codon_start : 1 exception : unclassified translation discrepancy product : within bgcn homolog protein_id : NP_084376.1

name	Mmp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946772 CCDS:CCDS24292.1 GeneID:58223 MGI:1927899
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA] [Evidence ISS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0030574 - collagen catabolism [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : matrix metalloproteinase 19 protein_id : NP_067387.1

name	1110012D08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017375 CCDS:CCDS24293.1 GeneID:73827 MGI:1921077
definition	codon_start : 1 product : hypothetical protein LOC73827 protein_id : NP_835167.1

name	Dnajc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542012 CCDS:CCDS24294.1 GeneID:74330 MGI:1921580
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DnaJ (Hsp40) homolog, subfamily C, member 14 protein_id : NP_083149.2

name	Ormdl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313282 CCDS:CCDS24295.1 GeneID:66844 MGI:1914094
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : ORM1-like 2 protein_id : NP_077142.1

name	1110005A23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384730 GeneID:66118 MGI:1913368
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cytokine induced protein 29 kDa protein_id : NP_079640.1

name	Gdf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807180 CCDS:CCDS24296.1 GeneID:14561 MGI:1338027
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0048469 - cell maturation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0040007 - growth [Evidence IEA]; GO:0001656 - metanephros development [Evidence IDA]; GO:0045596 - negative regulation of cell differentiation [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0031016 - pancreas development [Evidence IMP]; GO:0001657 - ureteric bud development [Evidence IMP] codon_start : 1 product : growth differentiation factor 11 protein_id : NP_034402.1

name	Cd63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431344 GeneID:12512 MGI:99529
definition	GO_component : GO:0010008 - endosome membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : melanoma 1 antigen product : Cd63 antigen protein_id : NP_001036045.1

name	Cd63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680888 CCDS:CCDS24297.1 GeneID:12512 MGI:99529
definition	GO_component : GO:0010008 - endosome membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : melanoma 1 antigen product : Cd63 antigen protein_id : NP_031679.1

name	Rdh5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549323 CCDS:CCDS24298.1 GeneID:19682 MGI:1201412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : 9-cis-retinol dehydrogenase; 11-cis retinol dehydrogenase; retinol dehydrogenase type 5 product : retinol dehydrogenase 5 protein_id : NP_598767.1

name	Bloc1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980697 CCDS:CCDS24299.1 GeneID:14533 MGI:1195276
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : general control of amino acid synthesis, yeast homolog-like 1; GCN5 general control of amino acid synthesis-like 1 product : general control of amino acid synthesis-like 1 protein_id : NP_056555.2

name	Itga7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293269 CCDS:CCDS24300.1 GeneID:16404 MGI:102700
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 product : integrin alpha 7 protein_id : NP_032424.2

name	Mettl7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229118 CCDS:CCDS24301.1 GeneID:71664 MGI:1918914
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : methyltransferase like 7B protein_id : NP_082129.2

name	Olfr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203795 CCDS:CCDS24302.1 GeneID:18373 MGI:107600
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10675610-10676548; olfactory receptor MOR269-3 product : olfactory receptor 9 protein_id : NP_667072.1

name	Olfr763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203799 CCDS:CCDS24303.1 GeneID:258861 MGI:3030597
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10696986-10697915; olfactory receptor MOR269-2 product : olfactory receptor 763 protein_id : NP_667073.1

name	EG622733 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388733 GeneID:622733 MGI:3648718
definition	codon_start : 1 product : similar to olfactory receptor Olfr227 protein_id : XP_892278.2

name	EG546487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261121 GeneID:546487 MGI:3647536
definition	codon_start : 1 product : similar to olfactory receptor Olfr227 protein_id : XP_621234.3

name	Olfr765 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239322 CCDS:CCDS24304.1 GeneID:258315 MGI:3030599
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PULF-10732607-10731678; olfactory receptor MOR115-4 product : olfactory receptor 765 protein_id : NP_666430.1

name	Olfr768 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129145 CCDS:CCDS24305.1 GeneID:258863 MGI:3030602
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10779441-10778503; olfactory receptor MOR114-4 product : olfactory receptor 768 protein_id : NP_667075.1

name	Olfr769 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128633 CCDS:CCDS24306.1 GeneID:257667 MGI:3030603
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x5J8B7W6HFP-2821674-2820736; GA_x6K02T2PULF-10797876-10796938 product : olfactory receptor 769 protein_id : NP_666379.1

name	Olfr770 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129151 CCDS:CCDS24307.1 GeneID:258862 MGI:3030604
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10819232-10818297; olfactory receptor MOR114-5 product : olfactory receptor 770 protein_id : NP_667074.1

name	Olfr771 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203779 CCDS:CCDS24308.1 GeneID:258540 MGI:3030605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10846420-10845467; olfactory receptor MOR114-8 product : olfactory receptor 771 protein_id : NP_666758.1

name	Olfr772 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170036 CCDS:CCDS24309.1 GeneID:257666 MGI:3030606
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR114-3; GA_x6K02T2PULF-10860457-10859522; olfactory receptor GA_x5J8B7W1NLL-1408-2343 product : olfactory receptor 772 protein_id : NP_666378.1

name	Olfr773-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170074 CCDS:CCDS24310.1 GeneID:257664 MGI:3030607
definition	codon_start : 1 exception : mismatches in translation product : olfactory receptor 773 protein_id : NP_996891.1

name	Olfr774 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518530 GeneID:258232 MGI:3030608
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10924432-10925370; olfactory receptor MOR111-11 product : olfactory receptor 774 protein_id : NP_997503.1

name	Olfr1518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125858743 GeneID:258538 MGI:3031352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR111-7; olfactory receptor 775; GA_x6K02T2PULF-10936819-10937757; olfactory receptor MOR111-6 product : olfactory receptor 1518 protein_id : NP_666756.2

name	Olfr776 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430578 CCDS:CCDS24311.1 GeneID:404321 MGI:3030610
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10947193-10948131 product : olfactory receptor 776 protein_id : NP_997442.1

name	Olfr777 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239328 CCDS:CCDS24312.1 GeneID:258537 MGI:3030611
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-10955551-10954616; olfactory receptor MOR114-9 product : olfactory receptor 777 protein_id : NP_666755.1

name	LOC544749 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261123 GeneID:544749
definition	codon_start : 1 product : similar to olfactory receptor Olfr779 protein_id : XP_001479675.1

name	Olfr780 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203773 CCDS:CCDS24313.1 GeneID:258281 MGI:3030614
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11002360-11003298; olfactory receptor MOR114-12 product : olfactory receptor 780 protein_id : NP_666396.1

name	Olfr781 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239326 CCDS:CCDS24314.1 GeneID:258723 MGI:3030615
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11013616-11014551; olfactory receptor MOR114-6 product : olfactory receptor 781 protein_id : NP_666939.1

name	Olfr782 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801360 CCDS:CCDS24315.1 GeneID:257985 MGI:3030616
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11031172-11032116; olfactory receptor MOR110-8 product : olfactory receptor 782 protein_id : NP_001011797.1

name	Olfr784 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129385 CCDS:CCDS24316.1 GeneID:258724 MGI:3030618
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11068246-11069205; olfactory receptor MOR110-3 product : olfactory receptor 784 protein_id : NP_666940.1

name	EG546488 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261125 GeneID:546488 MGI:3647538
definition	codon_start : 1 product : similar to olfactory receptor Olfr787 protein_id : XP_621235.4

name	Olfr786 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544963 CCDS:CCDS24317.1 GeneID:258542 MGI:3030620
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11116958-11117896; olfactory receptor MOR111-5 product : olfactory receptor 786 protein_id : NP_666760.1

name	Olfr787 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801408 CCDS:CCDS24318.1 GeneID:258069 MGI:3030621
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11141498-11142436; olfactory receptor MOR111-10 product : olfactory receptor 787 protein_id : NP_001011822.1

name	Olfr788 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239344 CCDS:CCDS24319.1 GeneID:258544 MGI:3030622
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11151514-11152449; olfactory receptor MOR111-4 product : olfactory receptor 788 protein_id : NP_666762.1

name	Olfr790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129043 CCDS:CCDS24320.1 GeneID:258935 MGI:3030624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11179777-11180721; olfactory receptor MOR112-1 product : olfactory receptor 790 protein_id : NP_667144.1

name	Olfr791 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129045 CCDS:CCDS24321.1 GeneID:258932 MGI:3030625
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11205096-11206034; olfactory receptor MOR114-1 product : olfactory receptor 791 protein_id : NP_667141.1

name	Olfr792 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801456 CCDS:CCDS24322.1 GeneID:258150 MGI:3030626
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11219415-11220350; olfactory receptor MOR108-2 product : olfactory receptor 792 protein_id : NP_001011849.1

name	Olfr794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129549 CCDS:CCDS24323.1 GeneID:258375 MGI:3030628
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11248702-11249664; olfactory receptor MOR114-11 product : olfactory receptor 794 protein_id : NP_666490.1

name	Olfr796 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129047 CCDS:CCDS24324.1 GeneID:258933 MGI:3030630
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11287099-11286167; olfactory receptor MOR269-1 product : olfactory receptor 796 protein_id : NP_667142.1

name	Olfr798 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582552 CCDS:CCDS24325.1 GeneID:258549 MGI:3030632
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11304679-11303744; olfactory receptor MOR108-1 product : olfactory receptor 798 protein_id : NP_666767.2

name	Olfr799 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203803 CCDS:CCDS24326.1 GeneID:258929 MGI:3030633
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11325750-11326685; olfactory receptor MOR114-2 product : olfactory receptor 799 protein_id : NP_667138.1

name	Olfr800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203789 CCDS:CCDS24327.1 GeneID:258541 MGI:3030634
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11338429-11339364; olfactory receptor MOR114-7 product : olfactory receptor 800 protein_id : NP_666759.1

name	Olfr801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129719 CCDS:CCDS24328.1 GeneID:258282 MGI:3030635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11349138-11348182; olfactory receptor MOR110-10 product : olfactory receptor 801 protein_id : NP_666397.1

name	Olfr802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129041 CCDS:CCDS24329.1 GeneID:258934 MGI:3030636
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11361362-11360424; olfactory receptor MOR111-1 product : olfactory receptor 802 protein_id : NP_667143.1

name	Olfr803 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129527 CCDS:CCDS24330.1 GeneID:258547 MGI:3030637
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11370664-11369738; olfactory receptor MOR111-3 product : olfactory receptor 803 protein_id : NP_666765.1

name	Olfr804 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801406 CCDS:CCDS24331.1 GeneID:258068 MGI:3030638
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11383575-11384519; olfactory receptor MOR110-7; odorant receptor B3 product : olfactory receptor 804 protein_id : NP_001011821.1

name	Olfr805 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129529 CCDS:CCDS24332.1 GeneID:258548 MGI:3030639
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11402237-11401278; olfactory receptor MOR110-4 product : olfactory receptor 805 protein_id : NP_666766.1

name	Olfr806 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129533 CCDS:CCDS24333.1 GeneID:258546 MGI:3030640
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11417610-11416669; olfactory receptor MOR110-5 product : olfactory receptor 806 protein_id : NP_666764.1

name	Olfr807 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129051 CCDS:CCDS24334.1 GeneID:258931 MGI:3030641
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11434134-11433199; olfactory receptor MOR117-1 product : olfactory receptor 807 protein_id : NP_667140.1

name	Olfr808 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203805 CCDS:CCDS24335.1 GeneID:258930 MGI:3030642
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11446184-11447122; olfactory receptor MOR112-2 product : olfactory receptor 808 protein_id : NP_667139.1

name	Olfr809 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129645 CCDS:CCDS24336.1 GeneID:258321 MGI:3030643
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11454600-11455541; olfactory receptor MOR108-4 product : olfactory receptor 809 protein_id : NP_666436.1

name	Olfr810 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239332 CCDS:CCDS24337.1 GeneID:258543 MGI:3030644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11470271-11469333; olfactory receptor MOR113-4 product : olfactory receptor 810 protein_id : NP_666761.1

name	Olfr811 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239342 CCDS:CCDS24338.1 GeneID:258545 MGI:3030645
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11481207-11480248; olfactory receptor MOR110-6 product : olfactory receptor 811 protein_id : NP_666763.1

name	Olfr812 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129259 CCDS:CCDS24339.1 GeneID:258791 MGI:3030646
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11521598-11520666; olfactory receptor MOR110-1 product : olfactory receptor 812 protein_id : NP_667006.1

name	Olfr813 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391055 CCDS:CCDS24340.1 GeneID:258252 MGI:3030647
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11535078-11536010; olfactory receptor MOR108-3 product : olfactory receptor 813 protein_id : NP_997030.1

name	Olfr814 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391071 CCDS:CCDS24341.1 GeneID:259165 MGI:3030648
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11553313-11552381; olfactory receptor MOR113-5 product : olfactory receptor 814 protein_id : NP_997042.1

name	Olfr815 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239330 CCDS:CCDS24342.1 GeneID:258665 MGI:3030649
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11581263-11580331; olfactory receptor MOR113-3 product : olfactory receptor 815 protein_id : NP_666881.1

name	Olfr816 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239334 CCDS:CCDS24343.1 GeneID:258667 MGI:3030650
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11590830-11589892; olfactory receptor MOR113-1 product : olfactory receptor 816 protein_id : NP_666883.1

name	Olfr818 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129297 CCDS:CCDS24344.1 GeneID:258773 MGI:3030652
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11624146-11623190; olfactory receptor MOR110-2 product : olfactory receptor 818 protein_id : NP_666988.1

name	LOC100043200 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261129 GeneID:100043200
definition	codon_start : 1 product : similar to olfactory receptor MOR265-1 protein_id : XP_001479784.1

name	Olfr247 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529278 GeneID:258266 MGI:3030081
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2LVGG-5968-6912; olfactory receptor MOR265-1 product : olfactory receptor 247 protein_id : NP_666381.2

name	Olfr820 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239324 CCDS:CCDS24345.1 GeneID:258670 MGI:3030654
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11688441-11689379; olfactory receptor MOR116-1 product : olfactory receptor 820 protein_id : NP_666886.1

name	Olfr821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129295 CCDS:CCDS24346.1 GeneID:258772 MGI:3030655
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11704843-11705775; olfactory receptor MOR109-1 product : olfactory receptor 821 protein_id : NP_666987.1

name	Olfr822 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239336 CCDS:CCDS24347.1 GeneID:258666 MGI:3030656
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11745102-11746040; olfactory receptor MOR113-2 product : olfactory receptor 822 protein_id : NP_666882.1

name	Olfr823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583930 CCDS:CCDS24348.1 GeneID:258668 MGI:3030657
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11783479-11782532; olfactory receptor MOR210-4 product : olfactory receptor 823 protein_id : NP_666884.2

name	Olfr824 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380653 CCDS:CCDS24349.1 GeneID:258669 MGI:3030658
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11797746-11796799; olfactory receptor MOR210-3 product : olfactory receptor 824 protein_id : NP_666885.1

name	Olfr825 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239098 CCDS:CCDS24350.1 GeneID:258672 MGI:3030659
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11834065-11833103; olfactory receptor MOR210-1 product : olfactory receptor 825 protein_id : NP_666888.1

name	Olfr826 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239100 CCDS:CCDS24351.1 GeneID:258671 MGI:3030660
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11851623-11850682; olfactory receptor MOR210-2 product : olfactory receptor 826 protein_id : NP_666887.1

name	Olfr827 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129685 CCDS:CCDS24352.1 GeneID:258297 MGI:3030661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PULF-11878777-11877809; olfactory receptor MOR210-5 product : olfactory receptor 827 protein_id : NP_666412.1

name	Neurod4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671587 CCDS:CCDS24353.1 GeneID:11923 MGI:108055
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0045165 - cell fate commitment [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0010001 - glial cell differentiation [Evidence IGI]; GO:0007399 - nervous system development [Evidence IEA]; GO:0007405 - neuroblast proliferation [Evidence IGI]; GO:0048666 - neuron development [Evidence IMP]; GO:0001764 - neuron migration [Evidence IGI] [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : atonal homolog 3 product : neurogenic differentiation 4 protein_id : NP_031527.1

name	5830405N20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304048 GeneID:67596 MGI:1914846
definition	codon_start : 1 product : hypothetical protein LOC67596 protein_id : NP_899087.1

name	EG625068 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517668 GeneID:625068 MGI:3643367
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0008170 - N-methyltransferase activity [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IEA]; GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal receptor Vmn2r84 protein_id : NP_001074917.1

name	EG623734 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388739 GeneID:623734 MGI:3646965
definition	codon_start : 1 product : similar to predicted gene, EG623734 protein_id : XP_893316.2

name	EG625109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028448 GeneID:625109 MGI:3649066
definition	codon_start : 1 product : similar to predicted gene, EG623734 isoform 1 protein_id : XP_898441.1

name	EG625109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028438 GeneID:625109 MGI:3649066
definition	codon_start : 1 product : similar to predicted gene, EG623734 isoform 2 protein_id : XP_905860.1

name	EG625131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028450 GeneID:625131 MGI:3645796
definition	codon_start : 1 product : similar to predicted gene, EG623734 isoform 1 protein_id : XP_898446.1

name	EG625131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028452 GeneID:625131 MGI:3645796
definition	codon_start : 1 product : similar to predicted gene, EG623734 isoform 2 protein_id : XP_905887.1

name	LOC100043114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043114
definition	number : 1 pseudo : _no_value

name	LOC624925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624925
definition	number : 2 pseudo : _no_value

name	LOC624925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624925
definition	number : 1 pseudo : _no_value

name	Olfr789-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258148
definition	number : 1 pseudo : _no_value

name	Olfr789-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258148
definition	number : 2 pseudo : _no_value

name	LOC100043203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043203
definition	number : 4 pseudo : _no_value

name	LOC100043203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043203
definition	number : 3 pseudo : _no_value

name	LOC100043203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043203
definition	number : 2 pseudo : _no_value

name	LOC100043203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043203
definition	number : 1 pseudo : _no_value

name	LOC382471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382471
definition	number : 1 pseudo : _no_value

name	LOC672405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672405
definition	number : 1 pseudo : _no_value

name	LOC672405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672405
definition	number : 2 pseudo : _no_value

name	LOC672405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672405
definition	number : 3 pseudo : _no_value

name	LOC672405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672405
definition	number : 4 pseudo : _no_value

name	LOC668459 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261119 GeneID:668459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins product : hypothetical LOC668459 pseudo : _no_value transcript_id : XR_034246.1

name	LOC622655 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261217 GeneID:622655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 2624 ESTs, 6 Proteins product : similar to hCG31107 pseudo : _no_value transcript_id : XR_034936.1

name	LOC100043719 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261218 GeneID:100043719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 111 ESTs, 26 Proteins product : similar to Ctdsp2 protein pseudo : _no_value transcript_id : XR_034953.1

clone name	MSMg01-425K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-071H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-196E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346J06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-483J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-188F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-429H05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-490H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408O24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-473D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-324A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337O02
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-254A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064K07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-106J14.b	B6Ng01-106J14.g
ACC	DH914294	DH914295
length	1,052	1,175
definition	DH914294\|Mus musculus domesticus DNA, BAC clone: B6Ng01-106J14, 5' end.	DH914295\|Mus musculus domesticus DNA, BAC clone: B6Ng01-106J14, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaacctaggtcattttaaactcatgtttatctaacattcatcatt ttcccctctaacatatgagtagtttccaaaaccacaaattccacaagtgt ttagatctcagacttgtagatatttatctcctttcatgaggagtgccttt ctttctcatcctttattgcattcagatggctctaatttctctccatgttc ttaaataagtgaaataatttaactgaattgagagctgtaatgtgtttgag aagatcaacccagaaacaacagaaaagtgaattgtttccaatgaatctgt tcagagtgactgagcaactgcatgttagatgaataaataaaatgaccgta atttcattgaataaaagaacaaattagtaacagactctgataaatattgc taagaaatacatattctctattcttgttatttctttctatgtggatatac attctggtaaagtataattttcaaaaaaaaataaaatgtcatttatacaa atagaatatgtatttgaatcaaataagactattttgctcaattaacttat cagtgacaccaggtggcaaacctgtctaaaagaataattcaggggacata tgctatgtgattacatgtctgttacataattttctaacatgtgttaagct acttaattacctatgccattttagtgattattttttcaattataaactag gtgtaagtcatatattctaaacgctaggcaaaaagcaacattaagcatgt acacatttttttgtaagtttcaatatcttccagatgtcctgttgaacagt tttataaagtcataaacttgaatttttctttatttctaagatttcaaaaa tatttcctaaatttatgtgagaagttttcctggactcttcctcctatctg tttccttgtgtcgaaaaagtgacattttgcagctgagtttttatcaagaa tatttgttacttagaattttgttttatcaattaaatgtattctttaatat atatatatatatatatatatatatatatatatatatatatatatacatgt tt	gaattcttatagtactaagtcaagagaaagaaactaaatgggtacaaata gaaaaaatgtcagatttccctgtagttacacatgtctgtattctatactt agaaaactcttgaatactgcatcagaatatatttagataatgatcaaatc taggaaaatagcagaagatatcaatctataaaaatatgcggcttttcaga tagaacaacattatcaataagaaagaaatcatgtaaacaatttcatctta agttattttttaacaaagtacctacaaaactagtaagaaaatgtaacatc cataataaaaataaactgaaggaaaatatcataagatactcaatcatgca aaagaatcccatgttcaataaattgaacaaattacagtggccatattctc tgaagcaatccacagactcagtataatcacaatcaaaacatccatggaat tctttatagcagcagaaaattaataccaaaattcatataaaatcaccaca gattcaacataccaaacatatcttgacaaaataaagaacaatgctgaggt ttctcaatagacaattaaaatttatacttcaaacccattgtgagaaaaaa taattaattgtattggcatagaaatgagcaaatgactaatacatatagat acagccataagactcttgacaaattgtcataaacaaatggtaaacaagag acagacttataatggatagggtacatctaagtgtaacacattaaaaacta gattccttttataaaattagattcaagatcgtttttggtgtctttcatgt tatcctaacagtttcaaaacctgatagaagtttcctccaatatgaaatct agccatccaggcttagacttccacattaatccacttttatctctgtatgt attttacatgtatttatctctctaaagcatggtgtattttgaacatattg tctcgttatttatgtatgatgggaaactgagagatggcaatagtctgttt gtttagggaggacgggcatagatatctctcacactctagaagagcttcac acttttgaactgaaattttctttagtaacacatggttctggatcagatat cattgagcagatggctaggttcacttcttctctcttctcttgctatctca tctcatcttctcatctgatgctatt
quality values	Open. Hide. 61 47 37 49 61 37 43 59 61 61 61 59 61 61 61 59 52 59 61 61 61 61 61 61 61 37 33 22 28 59 49 45 61 61 61 61 61 61 61 59 61 61 61 59 61 61 59 61 61 61 61 61 44 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 55 59 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 37 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 53 47 34 50 61 61 61 61 53 61 61 61 61 61 53 53 61 61 61 61 61 61 53 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 57 53 47 46 52 53 47 57 57 57 57 57 57 47 53 52 53 52 57 43 57 53 57 57 57 57 45 57 53 57 45 57 57 53 57 53 40 53 53 57 57 57 53 57 57 57 40 53 47 47 52 57 57 50 52 53 57 47 47 45 41 57 57 33 43 52 38 57 41 32 37 52 33 57 41 52 57 53 50 30 53 53 53 45 53 32 43 41 46 37 38 53 57 42 52 35 42 57 53 53 41 41 53 53 42 53 53 57 53 40 52 46 46 46 37 53 52 50 47 57 33 30 57 57 46 53 39 38 52 40 52 42 52 35 21 57 27 53 33 34 53 33 34 45 28 53 29 52 51 57 57 52 57 57 34 36 40 53 40 52 57 40 44 37 30 35 44 41 53 37 45 37 40 30 13 43 28 41 37 29 53 33 53 16 40 37 40 39 22 20 37 32 51 51 31 30 30 32 51 39 41 36 34 36 39 31 46 37 31 32 25 32 38 36 30 46 46 51 14 21 32 51 47 28 27 46 31 29 34 29 22 21 30 16 46 20 28 26 51 51 51 34 31 27 29 51 25 12 13 19 29 46 29 23 51 29 29 29 29 24 29 35 23 29 29 26 33 30 29 10 10 13 21 29 29 27 25 30 26 19 30 26 28 28 29 29 23 29 28 28 29 36 26 51 29 21 31 18 31 36 17 29 23 29 22 39 51 51 51 46 23 16 21 14 14 17 28 51 46 6 19 28 34 31 31 28 23 29 12 36 51 46 51 22 19 24 27 17 22 18 39 23 23 23 27 51 34 20 14 10 30 15 23 28 6 6 8 5 6 44 51 39 28 27 51 44 17 27 24 30 22 19 19 24 20 51 28 17 35 12 13 19 19 14 8 38 26 17 26 8 8 21 22 17 8 6 23 12 15 25 26 32 28 12 14 7 12 9 11 16 19 11 11 6 12 14 13 9 6 8 6 12 12 7 12 16 10 13 8 11 14 7 5 11 11 22 11 18 10 7 14 10 30 21	Open. Hide. 61 61 59 49 43 36 28 28 27 36 20 22 26 33 39 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 59 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 61 61 61 59 61 55 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 45 61 61 61 47 61 61 61 61 61 61 53 53 61 61 61 61 57 57 57 47 53 53 57 57 57 57 53 57 57 57 57 53 57 52 47 53 53 53 57 57 57 53 43 57 57 53 53 53 47 47 53 53 52 53 57 53 47 47 47 53 57 57 50 57 57 53 57 57 57 57 57 57 42 53 53 43 53 47 52 41 57 57 31 53 52 57 57 37 53 53 53 57 42 57 57 50 52 57 57 45 57 50 57 53 41 57 53 50 52 45 57 45 50 53 53 53 53 53 43 46 53 50 45 57 45 53 52 57 45 52 43 52 50 57 45 53 52 53 53 57 47 50 52 57 53 33 57 57 38 50 37 47 32 57 53 34 19 57 40 36 57 57 24 38 57 53 39 34 57 50 57 36 39 32 40 53 52 37 52 41 42 37 28 53 36 57 53 40 31 52 53 57 57 31 31 37 28 53 40 47 52 52 40 53 53 29 37 40 41 33 37 33 45 53 40 57 57 57 40 33 34 33 37 29 29 48 33 41 34 57 57 41 35 33 34 57 57 44 30 36 36 34 39 20 31 32 16 44 32 38 26 35 39 30 51 51 51 30 46 48 25 36 25 30 29 46 29 32 32 29 36 18 33 31 28 23 47 31 25 29 23 16 39 39 51 29 29 34 47 45 30 13 8 20 33 33 31 30 20 29 48 20 41 44 33 29 25 27 21 37 14 24 28 28 21 27 29 51 27 20 30 27 35 29 36 29 14 29 21 41 21 20 34 28 29 25 24 7 29 21 21 29 23 21 15 22 26 31 31 23 25 26 28 31 28 29 28 51 51 39 19 26 29 21 26 22 36 20 34 33 43 23 22 12 46 51 29 24 27 17 23 30 14 20 26 51 31 21 23 24 20 28 31 28 23 28 44 27 27 33 33 27 31 27 9 21 14 20 24 51 51 28 28 29 10 7 18 7 16 16 19 23 21 31 16 20 19 24 11 12 26 51 31 31 25 34 25 23 28 31 31 19 34 51 25 13 51 22 15 24 34 30 11 31 7 51 16 25 25 15 10 23 18 24 23 23 34 23 34 23 44 39 12 14 39 24 8 20 31 8 16 6 26 4 6 14 35 17 14 17 10 5 9 8 16 8 11 7 9 9 22 20 10 22 8 4 5 21 12 8 6 14 14 8 11 5 20 34 9 17 4 3 4 9 14 31 36 13 23 21 14 9 20 29 18 6 4 5 15 26 14 17 4 30 15 16 22 14 22 6 9 6 6 7 12 19 17 9 16 19 11 21 19 7 5 6 4 3 2 3 10 7 3 8 9 5 4 2 1 6 12 3 2 3 10 5 4 1 3 4 3 13 10 4 15 9 13 11 16 13 8 6 14 9 17 10 12 15 3 12 5 7 3 1 2 3 1 6 7 6 6 4 10 6 3 5 4 11 5 11 4 6 5 4 4 14 3 20 6 8 17 7 11 14 9 7 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_129072932_129073985
seq2: B6Ng01-106J14.b_44_1095

seq1  GAATTCAACCTAGGTCATTTTAAACTCATGTTTATCTAACATTCATCATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACCTAGGTCATTTTAAACTCATGTTTATCTAACATTCATCATT  50

seq1  TTCCCCTCTAACATATGAGTAGTTTCCAAAACCACAAATTCCACAAGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCTCTAACATATGAGTAGTTTCCAAAACCACAAATTCCACAAGTGT  100

seq1  TTAGATCTCAGACTTGTAGATATTTATCTCCTTTCATGAGGAGTGCCTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGATCTCAGACTTGTAGATATTTATCTCCTTTCATGAGGAGTGCCTTT  150

seq1  CTTTCTCATCCTTTATTGCATTCAGATGGCTCTAATTTCTCTCCATGTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTCATCCTTTATTGCATTCAGATGGCTCTAATTTCTCTCCATGTTC  200

seq1  TTAAATAAGTGAAATAATTTAACTGAATTGAGAGCTGTAATGTGTTTGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATAAGTGAAATAATTTAACTGAATTGAGAGCTGTAATGTGTTTGAG  250

seq1  AAGATCAACCCAGAAACAACAGAAAAGTGAATTGTTTCCAATGAATCTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATCAACCCAGAAACAACAGAAAAGTGAATTGTTTCCAATGAATCTGT  300

seq1  TCAGAGTGACTGAGCAACTGCATGTTAGATGAATAAATAAAATGACCGTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAGTGACTGAGCAACTGCATGTTAGATGAATAAATAAAATGACCGTA  350

seq1  ATTTCATTGAATAAAAGAACAAATTAGTAACAGACTCTGATAAATATTGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCATTGAATAAAAGAACAAATTAGTAACAGACTCTGATAAATATTGC  400

seq1  TAAGAAATACATATTCTCTATTCTTGTTATTTCTTTCTATGTGGATATAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAAATACATATTCTCTATTCTTGTTATTTCTTTCTATGTGGATATAC  450

seq1  ATTCTGGTAAAGTATAATTTTCAAAAAAAAATAAAATGTCATTTATACAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGGTAAAGTATAATTTTCAAAAAAAAATAAAATGTCATTTATACAA  500

seq1  ATAGAATATGTATTTGAATCAAATAAGACTATTTTGCTCAATTAACTTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAATATGTATTTGAATCAAATAAGACTATTTTGCTCAATTAACTTAT  550

seq1  CAGTGACACCAGGTGGCAAACCTGTCTAAAAGAATAATTCAGGGGACATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGACACCAGGTGGCAAACCTGTCTAAAAGAATAATTCAGGGGACATA  600

seq1  TGCTATGTGATTACATGTCTGTTACATAATTTTCTAACATGTGTTAAGCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATGTGATTACATGTCTGTTACATAATTTTCTAACATGTGTTAAGCT  650

seq1  ACTTAATTACCTATGCCATTTTAGTGATTATTTTTTCAATTATAAACTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAATTACCTATGCCATTTTAGTGATTATTTTTTCAATTATAAACTAG  700

seq1  GTGTAAGTCATATATTCTAAACGCTAGGCAAAAAGCAACATTAAGCATGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTAAGTCATATATTCTAAACGCTAGGCAAAAAGCAACATTAAGCATGT  750

seq1  ACACATTTTTTTGTAAGTTTCAATATCTTCCAGATGTCCTGTTGAACAGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACATTTTTTTGTAAGTTTCAATATCTTCCAGATGTCCTGTTGAACAGT  800

seq1  TTTATAAAGTCATAAACTTGAATTTTTCTTTATTTCTAAGATTTCAAAAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATAAAGTCATAAACTTGAATTTTTCTTTATTTCTAAGATTTCAAAAA  850

seq1  TATTTCCTAAATTTATGTGAGAAGTTTTCCTGGACTCTTCCTCCTATCTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTCCTAAATTTATGTGAGAAGTTTTCCTGGACTCTTCCTCCTATCTG  900

seq1  TTTCCTTGTGTCGAAAAAAGTGACA-TTTGCAGCTGAGTTTTTATCAAGA  949
      ||||||||||||| ||||||||||| ||||||||||||||||||||||||
seq2  TTTCCTTGTGTCG-AAAAAGTGACATTTTGCAGCTGAGTTTTTATCAAGA  949

seq1  ATATTTGTAACTTAGGAATTTTGTTTTATCAATTAAATGTATTCTTTAAA  999
      |||||||| ||||| |||||||||||||||||||||||||||||||| ||
seq2  ATATTTGTTACTTA-GAATTTTGTTTTATCAATTAAATGTATTCTTT-AA  997

seq1  TATATATATATATATATATATATATATATATATATATATATATATATACA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATATATATATATATATATATATATATATATATATATATATATATACA  1047

seq1  TGTTT  1054
      |||||
seq2  TGTTT  1052

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information