MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-113I11
Chromosome	10 (Build37)
Map Location	98,968,248 - 98,969,190
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG432494, Atp2b1, Wdr51b, Galnt4, Dusp6, LOC100042222, Gad1-ps, LOC100042232
Downstream gene	LOC667502, Csl, LOC100042246, Kitl, LOC100043208, LOC100043211, EG667532, LOC670007, LOC235966, LOC667556, LOC100043224, LOC100043227, LOC100043231, LOC100043235, LOC667580, LOC100043239, LOC100043242, LOC100043244, LOC667607, LOC100043247, EG213051, Tmtc3
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG432494 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432494 MGI:3646787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Atp2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67972 MGI:104653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr51b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382406 MGI:1918511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galnt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14426 MGI:894692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67603 MGI:1914853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042222 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Gad1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382407 MGI:95633
definition	gene_synonym : Gad-1ps note : glutamic acid decarboxylase 1, pseudogene pseudo : _no_value

name	LOC100042232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC667502 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Csl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71832 MGI:1919082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Kitl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17311 MGI:96974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs

name	LOC100043211 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	EG667532 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667532 MGI:3646823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC670007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins

name	LOC235966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:235966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC667556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC100043227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC100043231 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC100043235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC667580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC100043242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC100043244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC667607 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043247 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	EG213051 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213051 MGI:3643164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Tmtc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237500 MGI:3036255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432494 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261022 GeneID:432494 MGI:3646787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG432494 transcript_id : XM_990631.2

name	Atp2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62234486 GeneID:67972 MGI:104653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 1 transcript_id : NM_026482.1

name	Wdr51b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387380 GeneID:382406 MGI:1918511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 51B transcript_id : NM_027740.4

name	Galnt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794638 GeneID:14426 MGI:894692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 transcript_id : NM_015737.3

name	Dusp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803119 GeneID:67603 MGI:1914853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 6 transcript_id : NM_026268.2

name	LOC100042222 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261023 GeneID:100042222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042222 transcript_id : XM_001477753.1

name	LOC100042232 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261025 GeneID:100042232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042232 transcript_id : XM_001477770.1

name	Csl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367568 GeneID:71832 MGI:1919082
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : citrate synthase like transcript_id : NM_027945.2

name	Kitl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305266 GeneID:17311 MGI:96974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kit ligand transcript_id : NM_013598.1

name	LOC100043208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261130 GeneID:100043208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : hypothetical protein LOC100043208 transcript_id : XM_001480394.1

name	LOC100043211 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261132 GeneID:100043211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : hypothetical protein LOC100043211 transcript_id : XM_001480397.1

name	LOC670007 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261027 GeneID:670007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to ALY transcript_id : XM_001477845.1

name	LOC100043224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261136 GeneID:100043224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480405.1

name	LOC100043224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261138 GeneID:100043224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480409.1

name	LOC100043227 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261140 GeneID:100043227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480411.1

name	LOC100043227 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261142 GeneID:100043227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480412.1

name	LOC100043231 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261144 GeneID:100043231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480414.1

name	LOC100043231 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261146 GeneID:100043231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480417.1

name	LOC100043235 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261148 GeneID:100043235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480422.1

name	LOC100043235 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261150 GeneID:100043235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480425.1

name	LOC100043239 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261153 GeneID:100043239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480433.1

name	LOC100043239 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261155 GeneID:100043239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480438.1

name	LOC100043242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261157 GeneID:100043242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480442.1

name	LOC100043242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261159 GeneID:100043242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480446.1

name	LOC100043244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261161 GeneID:100043244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : similar to ALY transcript_id : XM_001480452.1

name	LOC100043247 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261164 GeneID:100043247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to RNA and export factor binding protein 1-II, transcript variant 1 transcript_id : XM_001480457.1

name	LOC100043247 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261166 GeneID:100043247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RNA and export factor binding protein 1-II, transcript variant 2 transcript_id : XM_001480459.1

name	Tmtc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348813 GeneID:237500 MGI:3036255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and tetratricopeptide repeat containing 3 transcript_id : NM_001033332.2

name	EG432494 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388579 GeneID:432494 MGI:3646787
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995725.1

name	Atp2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62234487 CCDS:CCDS24145.1 GeneID:67972 MGI:104653
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006816 - calcium ion transport [Evidence TAS]; GO:0006812 - cation transport [Evidence IEA] codon_start : 1 product : plasma membrane calcium ATPase 1 protein_id : NP_080758.1

name	Wdr51b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059149 GeneID:382406 MGI:1918511
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : WD repeat domain 51B protein_id : NP_082016.1

name	Galnt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657112 GeneID:14426 MGI:894692
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : ppGaNTase-T4 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 protein_id : NP_056552.1

name	Dusp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13399314 CCDS:CCDS24147.1 GeneID:67603 MGI:1914853
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 product : dual specificity phosphatase 6 protein_id : NP_080544.1

name	LOC100042222 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261024 GeneID:100042222
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477803.1

name	LOC100042232 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261026 GeneID:100042232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477820.1

name	Csl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386272 CCDS:CCDS24149.1 GeneID:71832 MGI:1919082
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : citrate synthase-like protein protein_id : NP_082221.1

name	Kitl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305267 GeneID:17311 MGI:96974
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005173 - stem cell factor receptor binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007281 - germ cell development [Evidence TAS]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA] codon_start : 1 note : mast cell growth factor; Steel factor; stem cell factor; cloud gray; grizzle-belly product : kit ligand protein_id : NP_038626.1

name	LOC100043208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261131 GeneID:100043208
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480444.1

name	LOC100043211 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261133 GeneID:100043211
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480447.1

name	LOC670007 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261028 GeneID:670007
definition	codon_start : 1 product : similar to ALY protein_id : XP_001477895.1

name	LOC100043224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261137 GeneID:100043224
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480455.1

name	LOC100043224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261139 GeneID:100043224
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480459.1

name	LOC100043227 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261141 GeneID:100043227
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480461.1

name	LOC100043227 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261143 GeneID:100043227
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480462.1

name	LOC100043231 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261145 GeneID:100043231
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480464.1

name	LOC100043231 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261147 GeneID:100043231
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480467.1

name	LOC100043235 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261149 GeneID:100043235
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480472.1

name	LOC100043235 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261151 GeneID:100043235
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480475.1

name	LOC100043239 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261154 GeneID:100043239
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480483.1

name	LOC100043239 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261156 GeneID:100043239
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480488.1

name	LOC100043242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261158 GeneID:100043242
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480492.1

name	LOC100043242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261160 GeneID:100043242
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480496.1

name	LOC100043244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261162 GeneID:100043244
definition	codon_start : 1 product : similar to ALY protein_id : XP_001480502.1

name	LOC100043247 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261167 GeneID:100043247
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 2 protein_id : XP_001480509.1

name	LOC100043247 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261165 GeneID:100043247
definition	codon_start : 1 product : similar to RNA and export factor binding protein 1-II isoform 1 protein_id : XP_001480507.1

name	Tmtc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677476 CCDS:CCDS24150.1 GeneID:237500 MGI:3036255
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : transmembrane and tetratricopeptide repeat containing 3 protein_id : NP_001028504.1

name	LOC667502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667502
definition	number : 3 pseudo : _no_value

name	LOC667502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667502
definition	number : 2 pseudo : _no_value

name	LOC667502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667502
definition	number : 1 pseudo : _no_value

name	LOC100042246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042246
definition	number : 2 pseudo : _no_value

name	LOC100042246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042246
definition	number : 1 pseudo : _no_value

name	LOC235966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:235966
definition	number : 1 pseudo : _no_value

name	LOC235966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:235966
definition	number : 2 pseudo : _no_value

name	LOC235966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:235966
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	misc_feature
link
xref
definition	function : clone overlap note : overlaps bases 1..82252 of clone AC101882

name	EG667532 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261134 GeneID:667532 MGI:3646823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : predicted gene, EG667532 pseudo : _no_value transcript_id : XR_034683.1

name	LOC667556 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261135 GeneID:667556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to THO complex 4 pseudo : _no_value transcript_id : XR_034685.1

name	LOC667580 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261152 GeneID:667580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to THO complex 4 pseudo : _no_value transcript_id : XR_034691.1

name	LOC667607 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261163 GeneID:667607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to THO complex 4 pseudo : _no_value transcript_id : XR_034700.1

name	EG213051 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261029 GeneID:213051 MGI:3643164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG213051 pseudo : _no_value transcript_id : XR_035690.1

clone name	MSMg01-473O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050F19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-233P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187P04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-113I11.b	B6Ng01-113I11.g
ACC	DH919300	DH919301
length	940	1,079
definition	DH919300\|Mus musculus domesticus DNA, BAC clone: B6Ng01-113I11, 5' end.	DH919301\|Mus musculus domesticus DNA, BAC clone: B6Ng01-113I11, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagtatatctagccgggcgtagtggcgcacgcctttaatcccagc actcgggaggcagaggcaggcggatttgagttcgaggccagcctggtcta caaagtgagtgccaggacagccaaggctacacagagaaaccctgtctcaa aaaaaaccaaaaaacaaaaaaagaattcagtatatctgatgaattcatga aaggccaggaacaatagagattagtggaccaagggaagaggagcctgaga cacagtggcagatgttggtgggagcagaaccactcggtgtattggacacc atggtaaagtccttgtctctgtctccaaagcatctcaaaggctttgaatg agcttgaatcaggaagtggtttcctctttgaatctgttgggacatgcaag aaaagaagtaggacatctgctaggggactcctagagctgtccagatgcat gtggggggtgccttgggttacggtggtgggaagctgtgggaactgagctg taagatgaacaacagtcagccctgtaggcttttgtggatcattgacttgg tataagatgcaacgatggggatgatctgcctgatttctaggattctgtct agagtatgtttatggttctgccctttccctcaggagaaatcgatttgaaa gggaagtgtatttgttctgatttggatatgttatactaagtagtagatgg cttggtgaacacttttactctaaagatagatacttggcaaaaaggatgaa cgttgatgtccttaaaagacatctaagaccacaggaataaatgagatgcc tcggatggtgggcagtaccattccaagaagatatcccaaaacatcataaa taaaacctagctatgtgtcagttggcctgggggctactataacagcatcc tccattgctcctgttacatcaattgtgtggatgaaagagt	gaattcaagaagtctaaagaagacacacagacatatccagattaatgaaa ttaaggagaaagaattacttaaggagaataaatttctcagtgatgaaact gcccaaaagaagatgataaaaatgatgaaggcaattcaggacttgagaat gggatttaataaggagataaaatcattatagaagactcaagctgaaatga tggtgagatttaaagacctaataacccaacaagaacacctaaaggaaagt cttataagtagaataaattaaacagaaggtcaaatgtcaggtcttaagaa taaaaatagaagatctcagccaagtaagaaggaatacaaaaaaatttaaa gccacagtaaaggaacatatagaaaatgtgaaacatcataataaaaccaa acctttgaaatataaaacataggaagggatgatacttcatcataatcaaa gaaacatttaaccaagaagacattaccatcctaaacatatttgtaccaaa ttctggtgcacccaattatttatatatatatatatatatatatatatata tatatatatatatatatacacagattagtaatgatctactacacttggtg atttcaacattccacttttctccaacagacagatcacgtggaaaaaaatg aacagaaccatcagaattaattaatattatacatcaaatggacttaacaa ttatctatagaatattttaccccaaatcaaagaatgtataatctatccag cagtacacagacacttttatgaatgagagcaggcctagggacacaaagca cagcttttcgaattgaaaaagatgaaaatcactcttttgtaccctatcta accacactgcataaaacttaaattgacagcaagcaaatctctaggaaata cacaagcctatggagattaaccactcactgcaaaagatgacgagacaaga agaaattaagaaaaaaaaaccaaaactttccagagttaatgaacacacca cacagctgttgggctgcttgaagcatgctgtgagggaatactccttaagt gcctaataaacgcagaaaagacccggatt
quality values	Open. Hide. 53 42 14 27 53 36 24 27 53 39 61 53 41 61 61 61 61 61 61 61 61 61 53 53 61 53 50 18 11 4 8 12 10 7 5 7 11 28 36 52 55 52 55 61 61 61 61 49 52 55 52 55 61 61 55 61 59 37 59 61 59 59 59 61 59 61 59 59 61 61 37 29 36 28 30 52 49 35 49 36 59 59 59 59 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 55 55 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 49 52 61 61 61 61 61 61 61 61 52 55 61 61 61 61 61 61 61 61 55 61 61 61 37 61 61 61 55 50 61 55 61 41 61 61 61 61 55 61 61 55 55 61 61 61 55 55 61 61 61 61 61 61 43 61 50 61 61 61 61 61 47 61 61 61 39 61 61 61 61 61 55 55 61 61 61 47 50 61 61 61 61 53 61 35 61 61 50 61 61 61 61 47 61 61 61 61 43 23 53 61 50 53 61 47 39 61 53 53 61 42 61 61 52 52 45 52 61 47 39 61 61 61 45 52 47 39 43 42 61 50 50 50 61 50 52 61 61 35 61 61 30 16 53 53 53 53 33 53 61 45 61 61 39 61 61 50 45 47 27 61 53 22 61 61 34 52 47 50 53 45 61 61 39 47 61 47 34 47 47 53 57 32 42 41 42 40 53 57 57 53 25 28 23 16 20 33 38 53 57 45 52 40 24 36 18 31 30 40 45 45 53 53 40 53 47 18 23 46 47 45 53 36 50 31 52 42 33 42 33 47 17 19 36 47 27 42 36 35 31 57 57 14 38 38 53 40 50 42 53 25 8 34 18 26 39 45 42 33 50 27 52 38 16 21 35 37 50 52 30 32 43 30 20 29 47 31 38 26 26 37 38 32 24 45 24 39 34 37 34 27 46 37 47 19 31 17 21 38 31 37 31 47 10 31 11 36 31 50 34 23 43 33 45 50 33 45 41 42 42 37 12 24 21 29 18 35 36 31 26 16 35 16 38 38 19 40 50 53 28 42 31 31 32 27 34 28 35 37 53 30 31 12 20 37 27 5 30 17 18 27 30 30 29 19 13 40 36 37 20 36 33 5 8 31 44 36 31 28 40 47 32 18 40 30 37 9 36 37 19 29 30 27 37 24 33 30 15 18 29 32 45 20 17 14 27 37 53 53 28 29 33 14 8 23 28 37 32 44 11 20 17 24 9 9 31 12 17 18 18 17 20 7 21 11 22 43 26 18 22 8 22 10 8 18 25 36 31 25 39 10 27 9 24 9 11 45 11 6 32 29 51 30 14 25 16 13	Open. Hide. 61 55 55 43 61 47 43 13 15 9 7 9 11 8 10 8 23 21 33 43 55 52 61 61 55 61 55 55 49 59 59 59 52 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 55 43 24 15 18 13 28 26 18 31 33 45 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 44 55 55 59 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 59 55 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 47 45 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 53 61 61 50 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 47 47 45 43 31 38 31 31 27 17 34 24 18 26 30 45 36 27 35 47 45 50 45 39 36 39 39 38 53 42 53 50 21 35 28 10 23 34 23 45 50 40 33 50 53 38 47 50 27 30 25 18 20 27 23 43 45 38 45 36 30 34 33 32 27 53 50 50 53 45 50 45 32 38 30 30 35 34 47 38 47 47 47 47 36 32 50 43 47 47 50 32 52 8 21 47 20 47 37 37 15 47 9 23 32 31 45 45 38 22 26 52 34 38 38 39 53 50 53 28 41 37 19 14 23 28 38 42 28 26 47 41 29 26 47 14 23 50 53 53 52 53 41 38 52 34 38 40 29 24 16 11 19 14 18 15 27 45 47 38 10 33 17 20 26 17 30 38 30 31 17 26 40 24 44 42 48 30 30 52 42 42 21 18 52 14 42 35 34 28 38 35 50 23 52 36 38 52 42 20 38 33 37 52 43 30 42 25 52 10 18 36 33 12 38 30 37 29 16 41 22 35 37 23 12 29 23 25 27 22 33 40 40 20 24 33 37 41 31 20 21 32 23 45 11 30 21 33 15 17 20 18 21 39 53 45 47 11 24 9 18 14 19 24 19 20 28 30 32 12 21 5 12 13 16 38 23 16 19 30 29 29 24 29 46 30 30 21 32 33 11 47 15 29 20 33 25 10 8 12 30 44 23 22 18 20 6 11 7 5 37 13 21 35 22 13 20 12 14 9 29 29 37 9 5 27 16 29 28 14 25 21 31 18 14 19 15 24 5 16 9 17 14 28 35 24 16 19 37 14 29 5 13 7 32 32 28 19 12 29 34 28 29 7 19 14 17 23 4 9 26 26 14 27 14 20 29 15 8 22 6 10 7 5 20 16 6 8 5 26 28 30 20 46 6 19 6 16 41 36 39 11 32 29 41 31 23 23 15 29 18 18 12 28 12 21 8 7 7 8 17 12 30 10 17 10 8 5 7 12 6 6 8 13 5 4 5 5 5 10 7 6 5 7 22 6 8 19 24 28 17 12 25 7 8 5 17 29 38 10 15 11 7 30 16 9 13 7 5 11 10 28 7 11 8 5 4 6 12 7 9 12 23 8 10 7 17 9 13 6 4 5 4 10 5 8 5 8 14 10 5 5 10 10 14 4 4 6 6 5 7 5 8 30 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_98968248_98969190
seq2: B6Ng01-113I11.b_48_987

seq1  GAATTCAGTATATCTAGCCGGGCGTAGTGGCGCACGCCTTTAATCCCAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTATATCTAGCCGGGCGTAGTGGCGCACGCCTTTAATCCCAGC  50

seq1  ACTCGGGAGGCAGAGGCAGGCGGATTTGAGTTCGAGGCCAGCCTGGTCTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCGGGAGGCAGAGGCAGGCGGATTTGAGTTCGAGGCCAGCCTGGTCTA  100

seq1  CAAAGTGAGTGCCAGGACAGCCAAGGCTACACAGAGAAACCCTGTCTCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGTGAGTGCCAGGACAGCCAAGGCTACACAGAGAAACCCTGTCTCAA  150

seq1  AAAAAACCAAAAAACAAAAAAAGAATTCAGTATATCTGATGAATTCATGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAACCAAAAAACAAAAAAAGAATTCAGTATATCTGATGAATTCATGA  200

seq1  AAGGCCAGGAACAATAGAGATTAGTGGACCAAGGGAAGAGGAGCCTGAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCCAGGAACAATAGAGATTAGTGGACCAAGGGAAGAGGAGCCTGAGA  250

seq1  CACAGTGGCAGATGTTGGTGGGAGCAGAACCACTCGGTGTATTGGACACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTGGCAGATGTTGGTGGGAGCAGAACCACTCGGTGTATTGGACACC  300

seq1  ATGGTAAAGTCCTTGTCTCTGTCTCCAAAGCATCTCAAAGGCTTTGAATG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTAAAGTCCTTGTCTCTGTCTCCAAAGCATCTCAAAGGCTTTGAATG  350

seq1  AGCTTGAATCAGGAAGTGGTTTCCTCTTTGAATCTGTTGGGACATGCAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTGAATCAGGAAGTGGTTTCCTCTTTGAATCTGTTGGGACATGCAAG  400

seq1  AAAAGAAGTAGGACATCTGCTAGGGGACTCCTAGAGCTGTCCAGATGCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAGTAGGACATCTGCTAGGGGACTCCTAGAGCTGTCCAGATGCAT  450

seq1  GTGGGGGGTGCCTTGGGTTACGGTGGTGGGAAGCTGTGGGAACTGAGCTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGGGGTGCCTTGGGTTACGGTGGTGGGAAGCTGTGGGAACTGAGCTG  500

seq1  TAAGATGAACAACAGTCAGCCCTGTAGGCTTTTGTGGATCATTGACTTGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGATGAACAACAGTCAGCCCTGTAGGCTTTTGTGGATCATTGACTTGG  550

seq1  TATAAGATGCAACGATGGGGATGATCTGCCTGATTTCTAGGATTCTGTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAGATGCAACGATGGGGATGATCTGCCTGATTTCTAGGATTCTGTCT  600

seq1  AGAGTATGTTTATGGTTCTGCCCTTTCCCTCAGGAGAAATCGATTTGAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTATGTTTATGGTTCTGCCCTTTCCCTCAGGAGAAATCGATTTGAAA  650

seq1  GGGAAGTGTATTTGTTCTGATTTGGATATGTTATACTAAGTAGTAGATGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAGTGTATTTGTTCTGATTTGGATATGTTATACTAAGTAGTAGATGG  700

seq1  CTTGGTGAACAC-TTTACTCTAAAGATAGATACTTGGCAAAAAGGATGAA  749
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  CTTGGTGAACACTTTTACTCTAAAGATAGATACTTGGCAAAAAGGATGAA  750

seq1  CGTTGATGTCCTTAAAAGACATCTAAGACCACAGGAATAAATGAGATGCC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTGATGTCCTTAAAAGACATCTAAGACCACAGGAATAAATGAGATGCC  800

seq1  TCGGATGGTGGGCAGTACCATTCCAAGAAGATATCCCAAAACATCATAAA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGATGGTGGGCAGTACCATTCCAAGAAGATATCCCAAAACATCATAAA  850

seq1  TAAAACCTAGCTATGTGTCAGTTGGCCTGGGGGCTAGCTATAAACAGCAT  899
      |||||||||||||||||||||||||||||||||||| |||| ||||||||
seq2  TAAAACCTAGCTATGTGTCAGTTGGCCTGGGGGCTA-CTAT-AACAGCAT  898

seq1  CCTCCATTGCTCCTGTTAACATCAATTGTGTGGGATGAAAGAGT  943
      ||||||||||||||||| ||||||||||||| ||||||||||||
seq2  CCTCCATTGCTCCTGTT-ACATCAATTGTGT-GGATGAAAGAGT  940

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information