MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-204F14
Chromosome	10 (Build37)
Map Location	127,136,010 - 127,254,846
singlet/doublet	doublet
Overlap gene	Myo1a, Tac2, Zbtb39, Admr, Rdh1, Rdh9, Rdh16
Upstream gene	LOC668336, Xrcc6bp1, LOC622567, Ctdsp2, Avil, Tsfm, Mettl1, Cyp27b1, March9, Cdk4, Tspan31, Centg1, Os9, LOC100043028, B4galnt1, LOC100043035, C78409, D10Ertd610e, Dtx3, Pip5k2c, Kif5a, Dctn2, Mbd6, LOC100043045, Ddit3, Mars, LOC622075, Arhgap9, Gli1, Inhbe, Inhbc, R3hdm2, Stac3, Ndufa4l2, Shmt2, Nxph4, Lrp1, LOC100043054, Stat6, Nab2, BC030440
Downstream gene	AY053573, Rdhs, BC089597, Rdh7, Sdro, LOC382468, Hsd17b6, LOC100043618, Prim1, LOC100043077, Naca, Ptges3, Atp5b, Baz2a, LOC100043085, Rbms2, LOC100043624, Gls2, Spryd4, Mip, Timeless, Apon, Apof, Stat2, Il23a, Usp52, Tmem4, Cs, Coq10a, Ankrd52, Slc39a5, Obfc2b, Rnf41, Smarcc2, Myl6, Myl6b, Mbc2, Zc3h10, Rpl41, LOC668453, Pa2g4, Erbb3, LOC100043114, LOC668459, Rps26, Ikzf4, Suox, EG622589, Rab5b, Cdk2, Si, Dgka, LOC100043669, Wibg, LOC622655, Mmp19, 1110012D08Rik, Dnajc14
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Xrcc6bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68876 MGI:1916984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Ctdsp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52468 MGI:1098748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avil (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11567 MGI:1333798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsfm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66399 MGI:1913649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mettl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17299 MGI:1339986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp27b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13115 MGI:1098274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216438 MGI:2446144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12567 MGI:88357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67125 MGI:1914375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216439 MGI:3580016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Os9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216440 MGI:1924301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	B4galnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14421 MGI:1342057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043035 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	C78409 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216441 MGI:2143920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	D10Ertd610e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52666 MGI:1277173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80904 MGI:2135752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117150 MGI:2152214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16572 MGI:109564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dctn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69654 MGI:107733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110962 MGI:106378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043045 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ddit3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13198 MGI:109247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216443 MGI:1345633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Arhgap9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216445 MGI:2143764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gli1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14632 MGI:95727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inhbe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16326 MGI:109269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inhbc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16325 MGI:105932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	R3hdm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71750 MGI:1919000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237611 MGI:3606571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa4l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407790 MGI:3039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 57 ESTs, 5 Proteins

name	Shmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108037 MGI:1277989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxph4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104080 MGI:1336197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16971 MGI:96828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043054 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Stat6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20852 MGI:103034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nab2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17937 MGI:107563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC030440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210035 MGI:2446113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432516 MGI:107732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21334 MGI:98476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320080 MGI:2443316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Admr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11536 MGI:109545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107605 MGI:1195275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103142 MGI:2143528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19683 MGI:1201375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AY053573 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380674 MGI:2687008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdhs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216453 MGI:2678390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC089597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216454 MGI:3583955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54150 MGI:1860517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdro (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70061 MGI:1917311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Hsd17b6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27400 MGI:1351670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 219 ESTs, 4 Proteins

name	Prim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19075 MGI:97757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Naca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17938 MGI:106095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptges3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56351 MGI:1929282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11947 MGI:107801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Baz2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116848 MGI:2151152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Rbms2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56516 MGI:1861776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Gls2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216456 MGI:2143539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spryd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66701 MGI:1913951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17339 MGI:96990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timeless (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21853 MGI:1321393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apon (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28194 MGI:88931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apof (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103161 MGI:104539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20847 MGI:103039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il23a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83430 MGI:1932410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103135 MGI:1918984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56530 MGI:1928477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12974 MGI:88529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210582 MGI:2684847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237615 MGI:2444029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72002 MGI:1919336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Obfc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69917 MGI:1917167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67588 MGI:1914838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68094 MGI:1915344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17904 MGI:109318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216459 MGI:1917789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23943 MGI:1344426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103284 MGI:2143670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67945 MGI:1915195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668453 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein pseudo : _no_value

name	Pa2g4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18813 MGI:894684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erbb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13867 MGI:95411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins pseudo : _no_value

name	Rps26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27370 MGI:1351628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikzf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22781 MGI:1343139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211389 MGI:2446117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622589 MGI:3647630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 905 ESTs, 8 Proteins

name	Rab5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19344 MGI:105938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cdk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12566 MGI:104772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Si (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20431 MGI:98301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13139 MGI:102952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043669 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Wibg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78428 MGI:1925678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 2624 ESTs, 6 Proteins pseudo : _no_value

name	Mmp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58223 MGI:1927899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110012D08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73827 MGI:1921077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74330 MGI:1921580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xrcc6bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754037 GeneID:68876 MGI:1916984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : XRCC6 binding protein 1 transcript_id : NM_026858.2

name	Ctdsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122478 GeneID:52468 MGI:1098748
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 transcript_id : NM_146012.1

name	Avil (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475908 GeneID:11567 MGI:1333798
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : advillin transcript_id : NM_009635.2

name	Tsfm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130307 GeneID:66399 MGI:1913649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ts translation elongation factor, mitochondrial transcript_id : NM_025537.3

name	Mettl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754681 GeneID:17299 MGI:1339986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase-like 1 transcript_id : NM_010792.1

name	Cyp27b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51890202 GeneID:13115 MGI:1098274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 27, subfamily b, polypeptide 1 transcript_id : NM_010009.1

name	March9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802613 GeneID:216438 MGI:2446144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 9 transcript_id : NM_001033262.2

name	Cdk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560614 GeneID:12567 MGI:88357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 4 transcript_id : NM_009870.2

name	Tspan31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803175 GeneID:67125 MGI:1914375
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 31 transcript_id : NM_025982.2

name	Centg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363313 GeneID:216439 MGI:3580016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, gamma 1 transcript_id : NM_001033263.2

name	Os9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341352 GeneID:216440 MGI:1924301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amplified in osteosarcoma transcript_id : NM_177614.2

name	B4galnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130998 GeneID:14421 MGI:1342057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,4-N-acetyl-galactosaminyl transferase 1 transcript_id : NM_008080.4

name	LOC100043035 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261109 GeneID:100043035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : similar to solute carrier family 26, member 10 transcript_id : XM_001479384.1

name	C78409 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261207 GeneID:216441 MGI:2143920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : expressed sequence C78409 transcript_id : XM_001480853.1

name	D10Ertd610e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362982 GeneID:52666 MGI:1277173
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, ERATO Doi 610, expressed transcript_id : NM_028027.2

name	Dtx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71143148 GeneID:80904 MGI:2135752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 3 homolog (Drosophila) transcript_id : NM_030714.2

name	Pip5k2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543483 GeneID:117150 MGI:2152214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type II, gamma transcript_id : NM_054097.2

name	Kif5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345296 GeneID:16572 MGI:109564
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 5A transcript_id : NM_001039000.2

name	Kif5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130812 GeneID:16572 MGI:109564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 5A transcript_id : NM_008447.3

name	Dctn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076934 GeneID:69654 MGI:107733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 2 transcript_id : NM_027151.1

name	Mbd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778937 GeneID:110962 MGI:106378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl-CpG binding domain protein 6 transcript_id : NM_033072.2

name	LOC100043045 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261113 GeneID:100043045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043045 transcript_id : XM_001479400.1

name	Ddit3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982414 GeneID:13198 MGI:109247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA-damage inducible transcript 3 transcript_id : NM_007837.2

name	Mars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491851 GeneID:216443 MGI:1345633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine-tRNA synthetase transcript_id : NM_001003913.1

name	Arhgap9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90093350 GeneID:216445 MGI:2143764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 9 transcript_id : NM_146011.2

name	Gli1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90186272 GeneID:14632 MGI:95727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLI-Kruppel family member GLI1 transcript_id : NM_010296.2

name	Inhbe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680452 GeneID:16326 MGI:109269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibin beta E transcript_id : NM_008382.1

name	Inhbc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560578 GeneID:16325 MGI:105932
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibin beta-C transcript_id : NM_010565.2

name	R3hdm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76559939 GeneID:71750 MGI:1919000
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : R3H domain containing 2 transcript_id : NM_027900.3

name	Stac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803518 GeneID:237611 MGI:3606571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and cysteine rich domain 3 transcript_id : NM_177707.3

name	Ndufa4l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388702 GeneID:407790 MGI:3039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 57 ESTs, 5 Proteins product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2, transcript variant 2 transcript_id : XM_001004705.1

name	Shmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130451 GeneID:108037 MGI:1277989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine hydroxymethyltransferase 2 (mitochondrial) transcript_id : NM_028230.3

name	Nxph4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676392 GeneID:104080 MGI:1336197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexophilin 4 transcript_id : NM_183297.2

name	Lrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124494255 GeneID:16971 MGI:96828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein 1 transcript_id : NM_008512.2

name	Stat6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485773 GeneID:20852 MGI:103034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 6 transcript_id : NM_009284.2

name	Nab2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679003 GeneID:17937 MGI:107563
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ngfi-A binding protein 2 transcript_id : NM_008668.1

name	BC030440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343470 GeneID:210035 MGI:2446113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC030440 transcript_id : NM_173732.2

name	Myo1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487036 GeneID:432516 MGI:107732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IA transcript_id : NM_001081219.1

name	Tac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678208 GeneID:21334 MGI:98476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tachykinin 2 transcript_id : NM_009312.1

name	Zbtb39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574146 GeneID:320080 MGI:2443316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 39 transcript_id : NM_198035.1

name	Admr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606338 GeneID:11536 MGI:109545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenomedullin receptor transcript_id : NM_007412.2

name	Rdh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349108 GeneID:107605 MGI:1195275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 1 (all trans) transcript_id : NM_080436.2

name	Rdh9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130113 GeneID:103142 MGI:2143528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 9 transcript_id : NM_153133.2

name	Rdh16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363086 GeneID:19683 MGI:1201375
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 16 transcript_id : NM_009040.2

name	AY053573 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227084 GeneID:380674 MGI:2687008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY053573 transcript_id : NM_199313.1

name	Rdhs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117320519 GeneID:216453 MGI:2678390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase similar transcript_id : NM_147222.2

name	BC089597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703845 GeneID:216454 MGI:3583955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC089597 transcript_id : NM_145424.1

name	Rdh7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386947 GeneID:54150 MGI:1860517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 7 transcript_id : NM_017473.2

name	Sdro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789299 GeneID:70061 MGI:1917311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : orphan short chain dehydrogenase/reductase transcript_id : NM_027301.3

name	Hsd17b6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23680951 GeneID:27400 MGI:1351670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 6 transcript_id : NM_013786.2

name	LOC100043618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261212 GeneID:100043618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 146 ESTs, 4 Proteins product : similar to Sm D2, transcript variant 2 transcript_id : XM_001480921.1

name	LOC100043618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261210 GeneID:100043618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 218 ESTs, 4 Proteins product : similar to Sm D2, transcript variant 1 transcript_id : XM_001480919.1

name	Prim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130631 GeneID:19075 MGI:97757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA primase, p49 subunit transcript_id : NM_008921.2

name	Naca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41350311 GeneID:17938 MGI:106095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nascent polypeptide-associated complex alpha polypeptide transcript_id : NM_013608.2

name	Ptges3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370453 GeneID:56351 MGI:1929282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E synthase 3 (cytosolic) transcript_id : NM_019766.3

name	Atp5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892441 GeneID:11947 MGI:107801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit transcript_id : NM_016774.3

name	Baz2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205434 GeneID:116848 MGI:2151152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain adjacent to zinc finger domain, 2A transcript_id : NM_054078.2

name	LOC100043085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261116 GeneID:100043085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to proline-rich protein BstNI subfamily 2 transcript_id : XM_001479461.1

name	Rbms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872206 GeneID:56516 MGI:1861776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif, single stranded interacting protein 2 transcript_id : NM_001039080.1

name	Rbms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872202 GeneID:56516 MGI:1861776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif, single stranded interacting protein 2 transcript_id : NM_019711.2

name	Gls2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348692 GeneID:216456 MGI:2143539
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaminase 2 (liver, mitochondrial) transcript_id : NM_001033264.2

name	Spryd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130283 GeneID:66701 MGI:1913951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPRY domain containing 4 transcript_id : NM_025716.2

name	Mip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365201 GeneID:17339 MGI:96990
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major intrinsic protein of eye lens fiber transcript_id : NM_008600.3

name	Timeless (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755788 GeneID:21853 MGI:1321393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : timeless homolog (Drosophila) transcript_id : NM_011589.1

name	Apon (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60499026 GeneID:28194 MGI:88931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein N transcript_id : NM_133996.3

name	Apof (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892165 GeneID:103161 MGI:104539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein F transcript_id : NM_133997.2

name	Stat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910571 GeneID:20847 MGI:103039
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 2 transcript_id : NM_019963.1

name	Il23a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892789 GeneID:83430 MGI:1932410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 23, alpha subunit p19 transcript_id : NM_031252.2

name	Usp52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380546 GeneID:103135 MGI:1918984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 52 transcript_id : NM_133992.2

name	Tmem4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9903606 GeneID:56530 MGI:1928477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 4 transcript_id : NM_019953.1

name	Cs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129843 GeneID:12974 MGI:88529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : citrate synthase transcript_id : NM_026444.3

name	Coq10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486651 GeneID:210582 MGI:2684847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q10 homolog A (yeast) transcript_id : NM_001081040.1

name	Ankrd52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129954 GeneID:237615 MGI:2444029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 52 transcript_id : NM_172790.2

name	Slc39a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801371 GeneID:72002 MGI:1919336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (metal ion transporter), member 5 transcript_id : NM_028092.2

name	Slc39a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382758 GeneID:72002 MGI:1919336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (metal ion transporter), member 5 transcript_id : NM_028051.2

name	Obfc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076936 GeneID:69917 MGI:1917167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligonucleotide/oligosaccharide-binding fold containing 2B transcript_id : NM_027257.1

name	Rnf41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543596 GeneID:67588 MGI:1914838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 41 transcript_id : NM_026259.2

name	Smarcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718971 GeneID:68094 MGI:1915344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 transcript_id : NM_198160.1

name	Myl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357256 GeneID:17904 MGI:109318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 6, alkali, smooth muscle and non-muscle transcript_id : NM_010860.3

name	Myl6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986554 GeneID:216459 MGI:1917789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 6B transcript_id : NM_172259.1

name	Mbc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130020 GeneID:23943 MGI:1344426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane bound C2 domain containing protein transcript_id : NM_011843.2

name	Zc3h10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527225 GeneID:103284 MGI:2143670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 10 transcript_id : NM_134003.1

name	Rpl41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365971 GeneID:67945 MGI:1915195
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L41 transcript_id : NM_018860.3

name	Pa2g4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383894 GeneID:18813 MGI:894684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proliferation-associated 2G4 transcript_id : NM_011119.3

name	Erbb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098018 GeneID:13867 MGI:95411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) transcript_id : NM_010153.1

name	Rps26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305446 GeneID:27370 MGI:1351628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S26 transcript_id : NM_013765.1

name	Ikzf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114636 GeneID:22781 MGI:1343139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IKAROS family zinc finger 4 transcript_id : NM_011772.2

name	Suox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343458 GeneID:211389 MGI:2446117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfite oxidase transcript_id : NM_173733.2

name	EG622589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388730 GeneID:622589 MGI:3647630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 905 ESTs, 8 Proteins product : predicted gene, EG622589 transcript_id : XM_887027.2

name	Rab5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130364 GeneID:19344 MGI:105938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5B, member RAS oncogene family transcript_id : NM_177411.3

name	Rab5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755261 GeneID:19344 MGI:105938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5B, member RAS oncogene family transcript_id : NM_011229.1

name	Cdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803406 GeneID:12566 MGI:104772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 2 transcript_id : NM_016756.3

name	Cdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715990 GeneID:12566 MGI:104772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 2 transcript_id : NM_183417.2

name	Si (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353045 GeneID:20431 MGI:98301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : silver transcript_id : NM_021882.4

name	Dgka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560473 GeneID:13139 MGI:102952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, alpha transcript_id : NM_016811.2

name	LOC100043669 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261215 GeneID:100043669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100043669 transcript_id : XM_001480976.1

name	Wibg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753956 GeneID:78428 MGI:1925678
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : within bgcn homolog (Drosophila) transcript_id : NM_030100.2

name	Mmp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946771 GeneID:58223 MGI:1927899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 19 transcript_id : NM_021412.1

name	1110012D08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342609 GeneID:73827 MGI:1921077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012D08 gene transcript_id : NM_178066.2

name	Dnajc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366323 GeneID:74330 MGI:1921580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 14 transcript_id : NM_028873.3

name	Xrcc6bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754038 CCDS:CCDS24220.1 GeneID:68876 MGI:1916984
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : XRCC6 binding protein 1 protein_id : NP_081134.2

name	Ctdsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122479 GeneID:52468 MGI:1098748
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] codon_start : 1 note : NLI-interacting factor 2 product : Nuclear LIM interactor-interacting factor 2 protein_id : NP_666124.1

name	Avil (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857753 CCDS:CCDS24221.1 GeneID:11567 MGI:1333798
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007015 - actin filament organization [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 exception : mismatches in translation product : advillin protein_id : NP_033765.1

name	Tsfm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313468 CCDS:CCDS24222.1 GeneID:66399 MGI:1913649
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 note : translation elongation factor product : Ts translation elongation factor, mitochondrial protein_id : NP_079813.1

name	Mettl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754682 CCDS:CCDS24223.1 GeneID:17299 MGI:1339986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008176 - tRNA (guanine-N7-)-methyltransferase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0006400 - tRNA modification [Evidence ISS]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : methyltransferase-like 1 protein_id : NP_034922.1

name	Cyp27b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51890203 CCDS:CCDS24224.1 GeneID:13115 MGI:1098274
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004498 - calcidiol 1-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 40 (25-hydroxyvitamin D3 1 alpha-hydroxylase); P450VD1alpha; 1alpha(OH)ase; 25(OH)D 1alpha-hydroxylase; 25-hydroxyvitamin D3 1alpha-hydroxylase; cytochrome P450, 27b1 product : cytochrome P450, family 27, subfamily b, polypeptide 1 protein_id : NP_034139.1

name	March9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781787 CCDS:CCDS24225.1 GeneID:216438 MGI:2446144
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : membrane-associated ring finger (C3HC4) 9 protein_id : NP_001028434.1

name	Cdk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753380 CCDS:CCDS24226.1 GeneID:12567 MGI:88357
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : p34/cdk4; serine/threonine kinase; cyclin dependent kinase 4 product : cyclin-dependent kinase 4 protein_id : NP_034000.1

name	Tspan31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385482 CCDS:CCDS24227.1 GeneID:67125 MGI:1914375
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : sarcoma amplified sequence protein_id : NP_080258.1

name	Centg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370300 CCDS:CCDS24228.1 GeneID:216439 MGI:3580016
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005768 - endosome [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008060 - ARF GTPase activator activity [Evidence ISS]; GO:0005524 - ATP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence IEA] [Evidence ISS]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0035014 - phosphoinositide 3-kinase regulator activity [Evidence ISS]; GO:0030295 - protein kinase activator activity [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0016197 - endosome transport [Evidence ISS]; GO:0045860 - positive regulation of protein kinase activity [Evidence ISS]; GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : centaurin, gamma 1 protein_id : NP_001028435.1

name	Os9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243990 CCDS:CCDS24229.1 GeneID:216440 MGI:1924301
definition	codon_start : 1 exception : mismatches in translation product : amplified in osteosarcoma protein_id : NP_808282.1

name	B4galnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679929 CCDS:CCDS24230.1 GeneID:14421 MGI:1342057
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003947 - (N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IMP] [Evidence IGI]; GO:0030259 - lipid glycosylation [Evidence IEA]; GO:0019915 - sequestering of lipid [Evidence IGI] codon_start : 1 note : GM2/GD2 synthase; UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)- galactosylglucosylceramide-beta-1, 4-N-acetylgalactosaminyltransferase; beta1,4GalNAC-T product : beta-1,4-N-acetylgalactosaminyltransferase protein_id : NP_032106.1

name	LOC100043035 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261110 GeneID:100043035
definition	codon_start : 1 product : similar to solute carrier family 26, member 10 protein_id : XP_001479434.1

name	C78409 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261208 GeneID:216441 MGI:2143920
definition	codon_start : 1 product : hypothetical protein LOC216441 protein_id : XP_001480903.1

name	D10Ertd610e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26553439 CCDS:CCDS24231.1 GeneID:52666 MGI:1277173
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAC/CDC42 exchange factor protein_id : NP_082303.1

name	Dtx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507662 GeneID:80904 MGI:2135752
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007219 - Notch signaling pathway [Evidence TAS] [Evidence IDA] codon_start : 1 product : deltex 3 protein_id : NP_109639.1

name	Pip5k2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17298686 CCDS:CCDS24232.1 GeneID:117150 MGI:2152214
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : phosphatidylinositol-4-phosphate 5-kinase, type II, gamma protein_id : NP_473438.1

name	Kif5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781727 CCDS:CCDS24233.1 GeneID:16572 MGI:109564
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005871 - kinesin complex [Evidence TAS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence TAS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : kinesin family member 5A protein_id : NP_001034089.1

name	Kif5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254635 CCDS:CCDS24233.1 GeneID:16572 MGI:109564
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005871 - kinesin complex [Evidence TAS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence TAS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : kinesin family member 5A protein_id : NP_032473.2

name	Dctn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076935 CCDS:CCDS24234.1 GeneID:69654 MGI:107733
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005869 - dynactin complex [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0030426 - growth cone [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : dynactin 2 protein_id : NP_081427.1

name	Mbd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778938 CCDS:CCDS24235.1 GeneID:110962 MGI:106378
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : methyl-CpG binding domain protein 6 protein_id : NP_149063.2

name	LOC100043045 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261114 GeneID:100043045
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479450.1

name	Ddit3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982415 CCDS:CCDS24236.1 GeneID:13198 MGI:109247
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IEA]; GO:0006983 - ER overload response [Evidence IMP]; GO:0042789 - mRNA transcription from RNA polymerase II promoter [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0030503 - regulation of cell redox homeostasis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0030968 - unfolded protein response [Evidence IMP] codon_start : 1 exception : mismatches in translation note : C/EBP homoologous protein 10 product : DNA-damage inducible transcript 3 protein_id : NP_031863.2

name	Mars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491852 CCDS:CCDS24237.1 GeneID:216443 MGI:1345633
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004825 - methionine-tRNA ligase activity [Evidence IEA] [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IEA] GO_process : GO:0006431 - methionyl-tRNA aminoacylation [Evidence ISS] [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0009303 - rRNA transcription [Evidence ISS]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 note : methionine tRNA ligase product : methionyl-tRNA synthetase protein_id : NP_001003913.1

name	Arhgap9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90093351 GeneID:216445 MGI:2143764
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 9 protein_id : NP_666123.2

name	Gli1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90186273 CCDS:CCDS24238.1 GeneID:14632 MGI:95727
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0008589 - regulation of smoothened signaling pathway [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS]; GO:0007283 - spermatogenesis [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 5 product : GLI-Kruppel family member GLI1 protein_id : NP_034426.2

name	Inhbe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680453 CCDS:CCDS24239.1 GeneID:16326 MGI:109269
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : activin; activin betaE product : inhibin beta E protein_id : NP_032408.1

name	Inhbc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754354 CCDS:CCDS24240.1 GeneID:16325 MGI:105932
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : activin product : inhibin beta-C protein_id : NP_034695.1

name	R3hdm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76559940 CCDS:CCDS24241.1 GeneID:71750 MGI:1919000
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : R3H domain containing 2 protein_id : NP_082176.3

name	Stac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244166 CCDS:CCDS24242.1 GeneID:237611 MGI:3606571
definition	GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : SH3 and cysteine rich domain 3 protein_id : NP_808375.1

name	Ndufa4l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388703 GeneID:407790 MGI:3039567
definition	codon_start : 1 product : similar to NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 isoform 2 protein_id : XP_001004705.1

name	Shmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312298 CCDS:CCDS24244.1 GeneID:108037 MGI:1277989
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006544 - glycine metabolism [Evidence IEA]; GO:0006563 - L-serine metabolism [Evidence IEA] codon_start : 1 note : serine hydroxymethyl transferase 2 (mitochondrial) product : serine hydroxymethyltransferase 2 (mitochondrial) protein_id : NP_082506.1

name	Nxph4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676393 GeneID:104080 MGI:1336197
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] codon_start : 1 product : neurexophilin 4 protein_id : NP_899120.2

name	Lrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124494256 CCDS:CCDS24245.1 GeneID:16971 MGI:96828
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 note : alpha 2-macroglobulin receptor; lipoprotein receptor-related protein product : low density lipoprotein receptor-related protein 1 protein_id : NP_032538.2

name	Stat6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485774 GeneID:20852 MGI:103034
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : signal transducer and activator of transcription 6 protein_id : NP_033310.2

name	Nab2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679004 CCDS:CCDS24247.1 GeneID:17937 MGI:107563
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IGI]; GO:0016564 - transcriptional repressor activity [Evidence IEA] GO_process : GO:0001958 - endochondral ossification [Evidence IGI]; GO:0042552 - myelination [Evidence IGI]; GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0045682 - regulation of epidermis development [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0014037 - Schwann cell differentiation [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Ngfi-A binding protein 2 protein_id : NP_032694.1

name	BC030440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424569 GeneID:210035 MGI:2446113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC210035 protein_id : NP_776093.1

name	Myo1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487037 GeneID:432516 MGI:107732
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin, heavy polypeptide-like (110kD); brush border myosin 1 product : myosin IA protein_id : NP_001074688.1

name	Tac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678209 CCDS:CCDS24248.1 GeneID:21334 MGI:98476
definition	GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007217 - tachykinin signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : substance K; neurokinin 2; neurokinin A; neuropeptide K; neuromedin L; neurokinin alpha product : tachykinin 2 protein_id : NP_033338.1

name	Zbtb39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574147 CCDS:CCDS24249.1 GeneID:320080 MGI:2443316
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 39 protein_id : NP_932152.1

name	Admr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606339 GeneID:11536 MGI:109545
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adrenomedullin receptor protein_id : NP_031438.2

name	Rdh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20147789 CCDS:CCDS24250.1 GeneID:107605 MGI:1195275
definition	GO_function : GO:0004745 - retinol dehydrogenase activity [Evidence IDA]; GO:0016229 - steroid dehydrogenase activity [Evidence IDA] GO_process : GO:0001523 - retinoid metabolism [Evidence IDA]; GO:0008202 - steroid metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation function : putative retinol (all-trans-retinol and 9-cis-retinol)dehydrogenase function : putative sterol 3-alpha-hydroxydehydrogenase note : retinol dehydrogenase 1 (11-cis) product : retinol dehydrogenase 1 (all trans) protein_id : NP_536684.1

name	Rdh9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23680945 CCDS:CCDS24251.1 GeneID:103142 MGI:2143528
definition	codon_start : 1 note : cis-retinol/androgen dehydrogenase type 3 product : retinol dehydrogenase 9 protein_id : NP_694773.1

name	Rdh16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677697 CCDS:CCDS24252.1 GeneID:19683 MGI:1201375
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : retinol dehydrogenase type 6; retinol dehydrogenase 6; cis-retinol/androgen dehydrogenase 1 product : retinol dehydrogenase 16 protein_id : NP_033066.1

name	AY053573 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227085 GeneID:380674 MGI:2687008
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : cis-retinol/3alpha-hydroxysterol short-chain dehydrogenasecis-retinol/3alpha-hydroxysterol short-chain dehydrogenasecis-retinol/3alpha-hydroxysterol short-chain dehydrogenase product : truncated cis-retinol/3alpha-hydroxysterol short-chain dehydrogenase protein_id : NP_955017.1

name	Rdhs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117320520 CCDS:CCDS24253.1 GeneID:216453 MGI:2678390
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004745 - retinol dehydrogenase activity [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : retinol dehydrogenase similar protein 2 protein_id : NP_671755.2

name	BC089597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703846 CCDS:CCDS24254.1 GeneID:216454 MGI:3583955
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cis-retinol/3alpha hydroxysterol short-chain dehydrogenase-like protein_id : NP_663399.1

name	Rdh7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567342 CCDS:CCDS24255.1 GeneID:54150 MGI:1860517
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence ISS]; GO:0004745 - retinol dehydrogenase activity [Evidence IEA] codon_start : 1 note : cis-Retinol/3alpha-hydroxysterol short-chain dehydrogenase product : retinol dehydrogenase 7 protein_id : NP_059501.1

name	Sdro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076941 CCDS:CCDS24256.1 GeneID:70061 MGI:1917311
definition	codon_start : 1 product : retinol dehydrogenase similar protein protein_id : NP_081577.1

name	Hsd17b6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305165 CCDS:CCDS24257.1 GeneID:27400 MGI:1351670
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : hydroxysteroid 17-beta dehydrogenase 9 product : hydroxysteroid (17-beta) dehydrogenase 9 protein_id : NP_038814.1

name	LOC100043618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261211 GeneID:100043618
definition	codon_start : 1 product : similar to Sm D2 isoform 1 protein_id : XP_001480969.1

name	LOC100043618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261213 GeneID:100043618
definition	codon_start : 1 product : similar to Sm D2 isoform 2 protein_id : XP_001480971.1

name	Prim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679459 GeneID:19075 MGI:97757
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IEA] GO_function : GO:0003896 - DNA primase activity [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006269 - DNA replication, synthesis of RNA primer [Evidence IEA] codon_start : 1 product : DNA primase small subunit, 49kDa protein_id : NP_032947.1

name	Naca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41350312 CCDS:CCDS24258.1 GeneID:17938 MGI:106095
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0017025 - TATA-binding protein binding [Evidence IDA]; GO:0003713 - transcription coactivator activity [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nascent polypeptide-associated complex alpha polypeptide protein_id : NP_038636.2

name	Ptges3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790017 GeneID:56351 MGI:1929282
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0050220 - prostaglandin-E synthase activity [Evidence IEA] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : telomerase binding protein, p23 product : prostaglandin E synthase 3 (cytosolic) protein_id : NP_062740.1

name	Atp5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980648 CCDS:CCDS24259.1 GeneID:11947 MGI:107801
definition	EC_number : 3.6.3.14 GO_component : GO:0045255 - hydrogen-translocating F-type ATPase complex [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATP synthase, H+ transporting mitochondrial F1 complex, alpha subunit; mitochondrial ATP synthase, H+ transporting F1 complex beta subunit product : ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit protein_id : NP_058054.2

name	LOC100043085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261117 GeneID:100043085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479511.1

name	Baz2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205435 GeneID:116848 MGI:2151152
definition	GO_component : GO:0005731 - nucleolus organizer complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence ISS] [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : bromodomain adjacent to zinc finger domain, 2A protein_id : NP_473419.2

name	Rbms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872203 CCDS:CCDS24261.1 GeneID:56516 MGI:1861776
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : RNA binding motif, single stranded interacting protein 2 isoform a protein_id : NP_062685.2

name	Rbms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872207 CCDS:CCDS24262.1 GeneID:56516 MGI:1861776
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RNA binding motif, single stranded interacting protein 2 isoform b protein_id : NP_001034169.1

name	Gls2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677498 CCDS:CCDS24263.1 GeneID:216456 MGI:2143539
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006541 - glutamine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : liver mitochondrial glutaminase product : glutaminase 2 (liver, mitochondrial) protein_id : NP_001028436.1

name	Spryd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037095 CCDS:CCDS24264.1 GeneID:66701 MGI:1913951
definition	codon_start : 1 product : SPRY domain containing 4 protein_id : NP_079992.1

name	Mip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543250 CCDS:CCDS24265.1 GeneID:17339 MGI:96990
definition	GO_component : GO:0005921 - gap junction [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015267 - channel or pore class transporter activity [Evidence NAS]; GO:0005212 - structural constituent of eye lens [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence IMP] GO_process : GO:0007154 - cell communication [Evidence NAS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP]; GO:0006833 - water transport [Evidence IMP] codon_start : 1 note : hydropic fibers; lens opacity; dominant cataract product : major intrinsic protein of eye lens fiber protein_id : NP_032626.2

name	Timeless (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755789 CCDS:CCDS24266.1 GeneID:21853 MGI:1321393
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence IDA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0007623 - circadian rhythm [Evidence IEP]; GO:0007275 - development [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0002009 - morphogenesis of an epithelium [Evidence IEP]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : timeless homolog protein_id : NP_035719.1

name	Apon (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527214 CCDS:CCDS24267.1 GeneID:28194 MGI:88931
definition	codon_start : 1 note : apolipoprotein F-like product : apolipoprotein N protein_id : NP_598757.1

name	Apof (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527216 CCDS:CCDS24268.1 GeneID:103161 MGI:104539
definition	GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : apolipoprotein F protein_id : NP_598758.1

name	Stat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910572 CCDS:CCDS24269.1 GeneID:20847 MGI:103039
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : signal transducer and activator of transcription 2 protein_id : NP_064347.1

name	Il23a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752579 CCDS:CCDS24270.1 GeneID:83430 MGI:1932410
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005138 - interleukin-6 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : interleukin 23, alpha subunit p19 protein_id : NP_112542.1

name	Usp52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789349 CCDS:CCDS24271.1 GeneID:103135 MGI:1918984
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0000175 - 3'-5'-exoribonuclease activity [Evidence ISS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0000291 - mRNA catabolism, exonucleolytic [Evidence ISS]; GO:0000289 - poly(A) tail shortening [Evidence ISS]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 52 protein_id : NP_598753.1

name	Tmem4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9903607 CCDS:CCDS24272.1 GeneID:56530 MGI:1928477
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : putative secreted protein ZSIG9 product : transmembrane protein 4 protein_id : NP_064337.1

name	Cs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385942 CCDS:CCDS24273.1 GeneID:12974 MGI:88529
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0004108 - citrate (Si)-synthase activity [Evidence ISS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0046912 - transferase activity, transferring acyl groups, acyl groups converted into alkyl on transfer [Evidence IEA] GO_process : GO:0006092 - main pathways of carbohydrate metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 product : citrate synthase protein_id : NP_080720.1

name	Coq10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486652 GeneID:210582 MGI:2684847
definition	codon_start : 1 product : coenzyme Q10 homolog A protein_id : NP_001074509.1

name	Ankrd52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370168 CCDS:CCDS24274.1 GeneID:237615 MGI:2444029
definition	codon_start : 1 product : ankyrin repeat domain 52 protein_id : NP_766378.1

name	Slc39a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312540 CCDS:CCDS24275.1 GeneID:72002 MGI:1919336
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence TAS] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence TAS]; GO:0006829 - zinc ion transport [Evidence TAS] codon_start : 1 exception : mismatches in translation product : solute carrier family 39 (metal ion transporter), member 5 protein_id : NP_082327.1

name	Slc39a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312454 CCDS:CCDS24275.1 GeneID:72002 MGI:1919336
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence TAS] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence TAS]; GO:0006829 - zinc ion transport [Evidence TAS] codon_start : 1 product : solute carrier family 39 (metal ion transporter), member 5 protein_id : NP_082368.1

name	Obfc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076937 CCDS:CCDS24276.1 GeneID:69917 MGI:1917167
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : nucleic acid binding protein 2 product : oligonucleotide/oligosaccharide-binding fold containing 2B protein_id : NP_081533.1

name	Rnf41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543597 CCDS:CCDS24277.1 GeneID:67588 MGI:1914838
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ring finger protein 41 protein_id : NP_080535.2

name	Smarcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718972 CCDS:CCDS24278.1 GeneID:68094 MGI:1915344
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SWI/SNF-related matrix-associated actin-dependent regulator of chromatin c2 protein_id : NP_937803.1

name	Myl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33620739 GeneID:17904 MGI:109318
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA]; GO:0016461 - unconventional myosin [Evidence IEP] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] [Evidence TAS]; GO:0008307 - structural constituent of muscle [Evidence TAS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030049 - muscle filament sliding [Evidence TAS]; GO:0007519 - striated muscle development [Evidence TAS] codon_start : 1 note : myosin light chain, alkali, nonmuscle product : myosin, light polypeptide 6, alkali, smooth muscle and non-muscle protein_id : NP_034990.1

name	Myl6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986555 CCDS:CCDS24279.1 GeneID:216459 MGI:1917789
definition	GO_component : GO:0016459 - myosin [Evidence IEA]; GO:0016461 - unconventional myosin [Evidence IEP] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] [Evidence TAS]; GO:0008307 - structural constituent of muscle [Evidence TAS] GO_process : GO:0030049 - muscle filament sliding [Evidence TAS]; GO:0007519 - striated muscle development [Evidence TAS] codon_start : 1 product : myosin light chain 1 slow a protein_id : NP_758463.1

name	Mbc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859650 CCDS:CCDS24280.1 GeneID:23943 MGI:1344426
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : membrane bound C2 domain containing protein protein_id : NP_035973.1

name	Zc3h10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527226 CCDS:CCDS24281.1 GeneID:103284 MGI:2143670
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger CCCH type containing 10 protein_id : NP_598764.1

name	Rpl41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256636 GeneID:67945 MGI:1915195
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L41 protein_id : NP_061348.1

name	Pa2g4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755100 CCDS:CCDS24282.1 GeneID:18813 MGI:894684
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0050897 - cobalt ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004239 - methionyl aminopeptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : proliferation-associated protein 1; proliferation-associated 2G4, 38kD product : ErbB3-binding protein 1 protein_id : NP_035249.1

name	Erbb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098019 CCDS:CCDS24283.1 GeneID:13867 MGI:95411
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016328 - lateral plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005006 - epidermal growth factor receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : avian erythroblastosis oncogene B 3 receptor; receptor tyrosine kinase; glial growth factor receptor product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 protein_id : NP_034283.1

name	Rps26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305447 GeneID:27370 MGI:1351628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribosomal protein S26 protein_id : NP_038793.1

name	Ikzf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114637 CCDS:CCDS24284.1 GeneID:22781 MGI:1343139
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IPI] codon_start : 1 note : zinc finger protein, subfamily 1A, 4 (Eos) product : zinc finger protein, subfamily 1A, 4 protein_id : NP_035902.2

name	Suox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74024924 CCDS:CCDS24285.1 GeneID:211389 MGI:2446117
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030151 - molybdenum ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008482 - sulfite oxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : sulfite oxidase protein_id : NP_776094.2

name	EG622589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83028352 GeneID:622589 MGI:3647630
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892120.1

name	Rab5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755262 CCDS:CCDS24287.1 GeneID:19344 MGI:105938
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5B, member RAS oncogene family protein_id : NP_035359.1

name	Rab5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916687 CCDS:CCDS24287.1 GeneID:19344 MGI:105938
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5B, member RAS oncogene family protein_id : NP_803130.1

name	Cdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949020 CCDS:CCDS24288.1 GeneID:12566 MGI:104772
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cyclin-dependent kinase 2 isoform 2 protein_id : NP_058036.1

name	Cdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556205 CCDS:CCDS24289.1 GeneID:12566 MGI:104772
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cyclin-dependent kinase 2 isoform 1 protein_id : NP_904326.1

name	Si (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981217 GeneID:20431 MGI:98301
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006583 - melanin biosynthesis from tyrosine [Evidence IEA] codon_start : 1 note : melanocyte protein pmel 17 product : silver protein_id : NP_068682.2

name	Dgka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560474 CCDS:CCDS24290.1 GeneID:13139 MGI:102952
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : diacylglycerol kinase, alpha (80 kDa) product : diacylglycerol kinase, alpha protein_id : NP_058091.2

name	LOC100043669 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261216 GeneID:100043669
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481026.1

name	Wibg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821033 GeneID:78428 MGI:1925678
definition	codon_start : 1 exception : unclassified translation discrepancy product : within bgcn homolog protein_id : NP_084376.1

name	Mmp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946772 CCDS:CCDS24292.1 GeneID:58223 MGI:1927899
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA] [Evidence ISS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0030574 - collagen catabolism [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : matrix metalloproteinase 19 protein_id : NP_067387.1

name	1110012D08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017375 CCDS:CCDS24293.1 GeneID:73827 MGI:1921077
definition	codon_start : 1 product : hypothetical protein LOC73827 protein_id : NP_835167.1

name	Dnajc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542012 CCDS:CCDS24294.1 GeneID:74330 MGI:1921580
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DnaJ (Hsp40) homolog, subfamily C, member 14 protein_id : NP_083149.2

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 4 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 3 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 2 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 1 pseudo : _no_value

name	LOC622567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622567
definition	number : 1 pseudo : _no_value

name	LOC100043028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043028
definition	number : 2 pseudo : _no_value

name	LOC100043028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043028
definition	number : 1 pseudo : _no_value

name	LOC100043054 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043054
definition	number : 2 pseudo : _no_value

name	LOC100043054 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043054
definition	number : 1 pseudo : _no_value

name	LOC382468 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382468
definition	number : 1 pseudo : _no_value

name	LOC100043077 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043077
definition	number : 1 pseudo : _no_value

name	LOC668453 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668453
definition	number : 1 pseudo : _no_value

name	LOC100043114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043114
definition	number : 1 pseudo : _no_value

name	LOC622075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261209 GeneID:622075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034887.1

name	LOC100043624 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261214 GeneID:100043624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Ribosomal protein L34 pseudo : _no_value transcript_id : XR_034912.1

name	LOC668459 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261119 GeneID:668459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins product : hypothetical LOC668459 pseudo : _no_value transcript_id : XR_034246.1

name	LOC622655 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261217 GeneID:622655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 2624 ESTs, 6 Proteins product : similar to hCG31107 pseudo : _no_value transcript_id : XR_034936.1

clone name	MSMg01-431I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-108J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-095C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-357J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134B19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-510O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-484H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-204F14.b	B6Ng01-204F14.g
ACC	GA024318	GA024319
length	1,046	1,120
definition	B6Ng01-204F14.b	B6Ng01-204F14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(127,254,196 - 127,254,846)	(127,136,010 - 127,137,116)
sequence	gaattcagtaagaatttaacaaggaagttacctattcagtaaccaattag cattataaaagacagagccaacagctcagggctagtctgcaagatgttta ctaggacagaaagcacagtcttatccagatagggtttaccatgagaaaag ctaggaaatcccactgaaacaggtttcttcactaggccctaagaattcag gcagaactatagagcataaataaattttatgcctcagcccagccttttct tttttatattaacaacaggcaggagatgtaacctcccccgcccccagctt gaaatctggctgatcaggtttgactgttagcacaaggagagcatcagggg tggagccagccaccctatcggtctgccactcccacagctgctacctgctg cctagctgttcaggagacacgtggtcacctgaaactggactccaaggatg atttggtcggaatgggccccttccccttcttcataacccagtgtctcaga atagtaaaattgaaccttgatcagactgatgtcttgattttattctttct cacgccgcctagttccctcttctcttccaggttccaagttgcctcccagg ctagaacccagacatgtgggccactggccagcctcaacagaggaccatgg ttctatcaggaagaggtgcaataagtgatttattacagttcttccttaag gtctgggccttggttatcagtggtttatctgtgaatctaaagctgggcca ctctccctacagcgggcaagctgcccatgggtctgctctacatttggcct tctgttcctctctcctgtgcctgattctgttttaaattatggctgatatt ccttgtcatccctgcctccactttctgtctcttgctcctgcgtgtgcaga aactaaataggacatttgtcatgggggctattagcacacaatgtccgcag aatccctagcctctgaactgcatcttggcaaatgtagtactaggcttttc cttgacccaaagttcgtgcagaatattgggtgcctgtttggatctt	gaattcactgtaagtgactttgctcttctgtgggttgactcactgtgaaa gacagatttcttttcaaggccattttttttaaaactgtatttgaatttgg ggcgagcaaagcaagctcattttcttacccctgcctggtagttggagaag tgaatgctgagagagctgcttcagacagtgaaggacagacggtgcctctt ttgtatgctgtgtatccttggcctgcctgcctgcctgcctgcctgggtgg ctccgctggatgcttctgagcctctgcgtgcccagacactgcttgagtca gctcagtctcatccctcagaatgagctcatcaaggaccgagggagaagtg gagtgagctggacactggagccatgagcgctgtgtgccagcaatcatcga tccagaagctggttccaggagtgggggtcttgatggtattggaaatgcat tgcttctaatgggtctgacctgagttcataaaacatgactcccgttaatg ggaacataagaggcagccggcatacaactttacagttttcctttccttat gagaacatactgatcaaagccaggaaaagtttagcaactttgataacttg gttaccttgaaatgagaaagagccagttccccacccacattcttgttttc tcagcagagggtggttttgtctgagatggctctttgggtcccactgttcc attttaccatatgaccgcccattcaagggcatagccctctgtgaatcagt tgtgttctctttagcctaccctacttgggtgattgaggttttggtgaata aaaggacccaaataggccagagaattcccccaggccttgatacccgtgaa gaaatttggacgggttacataatttgttgaaaggtatgctgagatggatc ccagagttaaaatggaccttagctgtgcccacagctctgttggaacttga gtggtaacaagtgaagtgtgcagacatgaaaaataatggcctctagtatt ccaatgggactcggtcccaagatgggtgccctgcatttgccatgctgaga gacatgggcaggtgtacggagcctctcccttaaggcaagcacactgaaaa ccaatggtagtagcacacag
quality values	Open. Hide. 47 36 21 32 58 28 21 38 52 54 54 62 62 31 33 62 62 52 56 47 42 47 62 62 38 62 62 62 62 62 54 62 42 27 27 21 22 15 22 27 34 30 38 28 35 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 51 62 62 59 62 59 59 56 56 62 62 62 59 62 62 59 62 62 62 62 59 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 59 62 54 54 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 51 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 37 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 42 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 58 47 54 58 58 58 58 58 54 58 58 58 58 58 58 54 49 58 58 54 54 54 58 58 58 58 58 58 54 58 52 54 58 58 58 52 58 58 54 58 54 58 42 58 58 58 58 54 58 54 52 54 54 58 54 52 54 38 52 54 42 42 58 54 41 58 58 58 58 58 58 58 58 58 58 54 52 47 58 51 54 58 51 58 49 40 58 54 53 53 58 54 32 45 58 53 53 51 54 50 48 47 41 49 58 45 50 49 37 39 39 40 50 41 39 49 50 49 50 58 37 41 26 28 43 50 47 58 41 36 51 58 41 52 41 37 42 24 35 35 43 25 51 27 43 35 51 46 37 36 49 58 58 38 46 58 46 34 58 58 42 50 50 41 52 30 19 18 58 53 41 41 53 48 51 30 32 26 25 38 13 46 41 58 58 44 32 58 32 33 51 28 22 19 39 35 49 42 39 29 51 50 41 54 41 45 39 54 52 49 36 42 32 27 35 47 47 29 54 44 35 42 49 37 54 33 33 31 28 49 35 47 45 51 54 47 35 30 16 7 16 44 40 44 46 40 53 34 32 42 30 40 29 54 27 25 28 33 51 42 35 53 51 41 37 34 33 21 28 42 34 39 54 15 17 31 17 51 35 35 45 31 54 16 14 38 15 49 12 32 53 32 40 35 27 41 29 34 18 47 25 35 41 32 30 53 29 46 9 46 49 14 38 51 27 19 34 40 27 33 22 20 35 30 41 13 31 21 13 51 25 20 27 51 31 31 24 38 21 51 26 26 28 25 29 30 19 22 29 20 10 51 31 42 30 40 17 31 29 36 19 6 12 27 31 18 25 12 28 31 32 30 42 26 43 28 36 30 37 47 11 33 13 9 33 31 30 25 6 16 41 22 21 31 48 31 42 20 28 18 26 31 46 39 44 26 35 38 34 25 25 31 18 31 26 31 29 19 9 6 9 26 16 29 38 21 31 24 17 39 33 19 8 44 21 31 33 20 18 9 21 32 32 33 18 28 11 19 29 21 31 19 30 23 37 16 24 11 44 44 28 18 38 11 37 21 20 24 25 33 29 20 10 17 26 38 44 27 18 20 31 21 29 17 11 33 8 24 31 11 8 31 21 21 18 17 21 12 17 13 32 34 9 5 11 21 9 34 10 9 29 14 15 26 14 7 31 10 27 25 13 10 10 13 24	Open. Hide. 62 47 42 44 62 47 56 47 62 62 62 13 15 19 22 25 16 16 34 27 32 38 32 32 48 50 62 62 62 62 62 54 54 62 62 62 62 59 59 62 59 62 59 62 62 59 62 59 62 62 62 59 59 59 59 59 59 59 56 56 59 62 59 56 46 56 54 62 62 56 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 56 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 56 59 59 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 47 39 56 62 46 46 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 54 48 62 62 62 52 52 50 62 62 62 54 58 54 58 46 58 58 54 58 52 54 54 45 41 54 58 58 58 58 58 58 52 54 54 54 52 52 58 40 58 52 58 54 54 58 58 58 58 54 58 53 54 54 54 54 58 52 52 34 52 40 52 52 58 54 52 58 58 58 58 58 54 58 58 45 52 58 54 58 52 58 54 49 46 51 52 49 58 58 42 53 53 52 42 45 48 47 48 49 58 47 58 58 58 58 46 52 58 58 58 46 58 46 51 53 58 58 58 50 51 50 50 49 49 58 53 58 51 51 54 37 32 54 52 51 50 51 58 50 50 54 54 37 58 46 51 45 58 32 41 58 41 51 28 41 46 51 43 50 52 53 58 50 41 52 41 50 58 50 50 49 58 29 58 58 31 51 53 39 32 40 51 51 27 49 6 58 37 50 49 43 50 58 54 58 53 53 49 51 40 58 31 41 37 51 49 35 51 52 39 38 33 50 54 49 37 53 54 53 39 41 35 49 50 27 32 41 24 28 54 54 51 37 52 50 27 40 40 40 50 39 31 49 27 27 54 46 32 53 54 33 26 42 34 32 47 27 33 35 32 20 41 54 40 53 39 40 51 27 27 33 33 29 31 37 26 33 35 47 33 51 29 51 53 37 53 53 52 33 28 31 29 47 32 33 29 53 46 32 43 39 25 49 47 51 28 32 37 32 39 31 31 32 13 11 7 51 52 9 31 30 31 51 30 41 23 28 46 40 32 28 27 18 30 51 45 28 32 30 31 16 12 31 31 30 32 21 46 13 45 30 26 24 24 51 45 45 32 19 19 30 22 12 18 25 27 31 31 25 25 47 46 21 6 9 42 37 10 21 40 10 24 28 25 32 24 33 14 23 40 14 9 16 23 32 23 41 36 11 10 46 6 14 15 25 30 30 41 24 25 27 21 35 29 23 26 28 31 39 23 25 26 31 38 22 32 21 48 36 38 11 31 7 28 11 9 41 41 22 24 31 22 19 13 19 9 15 10 6 26 23 38 7 22 27 48 42 31 32 23 30 24 37 26 12 7 9 9 23 28 17 17 20 8 11 17 34 28 17 26 48 9 7 7 12 14 25 12 9 4 4 19 21 31 32 20 30 25 17 17 21 19 19 6 14 24 37 39 48 11 29 10 24 8 11 12 25 7 7 4 9 25 13 8 9 23 12 21 14 6 7 13 17 28 6 27 19 17 8 11 10 5 13 38 15 28 28 10 20 7 13 47 21 10 27 7 38 9 8 11 20 13 21 12 8 16 8 14 20 24 13 25 10 6 23 7 8 11 3 8 5 3 14 29 14 5 4 10 9 8 5 4 9 15 14 7 6 4 8 7 13 9 10 14 16 15 4 5 8 4 14 11 6 7 9 14 4 5 10 7 7 6 6 16 28 23 20 7 24 10 3 1 3 19 6 12 6 3 3 3 3 1 3 7 9 2 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_127254196_127254846
seq2: B6Ng01-204F14.b_45_695 (reverse)

seq1  ACCATGGTCCTCTGTTGAGGCTGGCCAGTGGCCCACATGTCTGGGTTCTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATGGTCCTCTGTTGAGGCTGGCCAGTGGCCCACATGTCTGGGTTCTA  50

seq1  GCCTGGGAGGCAACTTGGAACCTGGAAGAGAAGAGGGAACTAGGCGGCGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGGGAGGCAACTTGGAACCTGGAAGAGAAGAGGGAACTAGGCGGCGT  100

seq1  GAGAAAGAATAAAATCAAGACATCAGTCTGATCAAGGTTCAATTTTACTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAGAATAAAATCAAGACATCAGTCTGATCAAGGTTCAATTTTACTA  150

seq1  TTCTGAGACACTGGGTTATGAAGAAGGGGAAGGGGCCCATTCCGACCAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAGACACTGGGTTATGAAGAAGGGGAAGGGGCCCATTCCGACCAAA  200

seq1  TCATCCTTGGAGTCCAGTTTCAGGTGACCACGTGTCTCCTGAACAGCTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCCTTGGAGTCCAGTTTCAGGTGACCACGTGTCTCCTGAACAGCTAG  250

seq1  GCAGCAGGTAGCAGCTGTGGGAGTGGCAGACCGATAGGGTGGCTGGCTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAGGTAGCAGCTGTGGGAGTGGCAGACCGATAGGGTGGCTGGCTCC  300

seq1  ACCCCTGATGCTCTCCTTGTGCTAACAGTCAAACCTGATCAGCCAGATTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCTGATGCTCTCCTTGTGCTAACAGTCAAACCTGATCAGCCAGATTT  350

seq1  CAAGCTGGGGGCGGGGGAGGTTACATCTCCTGCCTGTTGTTAATATAAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCTGGGGGCGGGGGAGGTTACATCTCCTGCCTGTTGTTAATATAAAA  400

seq1  AAGAAAAGGCTGGGCTGAGGCATAAAATTTATTTATGCTCTATAGTTCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAAGGCTGGGCTGAGGCATAAAATTTATTTATGCTCTATAGTTCTG  450

seq1  CCTGAATTCTTAGGGCCTAGTGAAGAAACCTGTTTCAGTGGGATTTCCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAATTCTTAGGGCCTAGTGAAGAAACCTGTTTCAGTGGGATTTCCTA  500

seq1  GCTTTTCTCATGGTAAACCCTATCTGGATAAGACTGTGCTTTCTGTCCTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTTCTCATGGTAAACCCTATCTGGATAAGACTGTGCTTTCTGTCCTA  550

seq1  GTAAACATCTTGCAGACTAGCCCTGAGCTGTTGGCTCTGTCTTTTATAAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACATCTTGCAGACTAGCCCTGAGCTGTTGGCTCTGTCTTTTATAAT  600

seq1  GCTAATTGGTTACTGAATAGGTAACTTCCTTGTTAAATTCTTACTGAATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAATTGGTTACTGAATAGGTAACTTCCTTGTTAAATTCTTACTGAATT  650

seq1  C  651
      |
seq2  C  651

seq1: chr10_127136010_127137116
seq2: B6Ng01-204F14.g_71_1190

seq1  GAATTCACTGTAAGTGACTTTGCTCTTCTGTGGGTTGACTCACTGTGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTGTAAGTGACTTTGCTCTTCTGTGGGTTGACTCACTGTGAAA  50

seq1  GACAGATTTCTTTTCAAGGCCATTTTTTTTAAAACTGTATTTGAATTTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGATTTCTTTTCAAGGCCATTTTTTTTAAAACTGTATTTGAATTTGG  100

seq1  GGCGAGCAAAGCAAGCTCATTTTCTTACCCCTGCCTGGTAGTTGGAGAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGAGCAAAGCAAGCTCATTTTCTTACCCCTGCCTGGTAGTTGGAGAAG  150

seq1  TGAATGCTGAGAGAGCTGCTTCAGACAGTGAAGGACAGACGGTGCCTCTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGCTGAGAGAGCTGCTTCAGACAGTGAAGGACAGACGGTGCCTCTT  200

seq1  TTGTATGCTGTGTATCCTTGGCCTGCCTGCCTGCCTGCCTGCCTGGGTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATGCTGTGTATCCTTGGCCTGCCTGCCTGCCTGCCTGCCTGGGTGG  250

seq1  CTCCGCTGGATGCTTCTGAGCCTCTGCGTGCCCAGACACTGCTTGAGTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCGCTGGATGCTTCTGAGCCTCTGCGTGCCCAGACACTGCTTGAGTCA  300

seq1  GCTCAGTCTCATCCCTCAGAATGAGCTCATCAAGGACCGAGGGAGAAGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAGTCTCATCCCTCAGAATGAGCTCATCAAGGACCGAGGGAGAAGTG  350

seq1  GAGTGAGCTGGACACTGGAGCCATGAGCGCTGTGTGCCAGCAATCATCGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGAGCTGGACACTGGAGCCATGAGCGCTGTGTGCCAGCAATCATCGA  400

seq1  TCCAGAAGCTGGTTCCAGGAGTGGGGGTCTTGATGGTATTGGAAATGCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGAAGCTGGTTCCAGGAGTGGGGGTCTTGATGGTATTGGAAATGCAT  450

seq1  TGCTTCTAATGGGTCTGACCTGAGTTCATAAAACATGACTCCCGTTAATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTCTAATGGGTCTGACCTGAGTTCATAAAACATGACTCCCGTTAATG  500

seq1  GGAACATAAGAGGCAGCCGGCATACAACTTTACAGTTTTCCTTTCCTTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACATAAGAGGCAGCCGGCATACAACTTTACAGTTTTCCTTTCCTTAT  550

seq1  GAGAACATACTGATCAAAGCCAGGAAAAGTTTAGCAACTTTGATAACTTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACATACTGATCAAAGCCAGGAAAAGTTTAGCAACTTTGATAACTTG  600

seq1  GTTACCTTGAAATGAGAAAGAGCCAGTTCCCCACCCACATTCTTGTTTTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACCTTGAAATGAGAAAGAGCCAGTTCCCCACCCACATTCTTGTTTTC  650

seq1  TCAGCAGAGGGTGGTTTTGTCTGAGATGGCTCTTTGGGTCCCACTGTTCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAGAGGGTGGTTTTGTCTGAGATGGCTCTTTGGGTCCCACTGTTCC  700

seq1  ATTTTACCATATGACCGCCCATTCAAGGGCATAGCCCTCTGTGAATCAGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTACCATATGACCGCCCATTCAAGGGCATAGCCCTCTGTGAATCAGT  750

seq1  TGTGTTCTCTTTAGCCTACCCTACTTGGGTGATTGAGG-TTTGGTGAATA  799
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  TGTGTTCTCTTTAGCCTACCCTACTTGGGTGATTGAGGTTTTGGTGAATA  800

seq1  AAAGGACCCAAATAGGCCAGAGAATTCCCCCAGGCCTTGATACCCGTGAA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGACCCAAATAGGCCAGAGAATTCCCCCAGGCCTTGATACCCGTGAA  850

seq1  G-AATTTGGACGGGTTACATAA-TTGTTGAAAGGTATGCTGAGATGGATC  897
      | |||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GAAATTTGGACGGGTTACATAATTTGTTGAAAGGTATGCTGAGATGGATC  900

seq1  CCAGAGTTAAAATGGACCTTAGCTGTGCCCACAGCTCTTGTGGA--CTGA  945
      ||||||||||||||||||||||||||||||||||||||  ||||   |||
seq2  CCAGAGTTAAAATGGACCTTAGCTGTGCCCACAGCTCTGTTGGAACTTGA  950

seq1  GTGGT-ACAAGTTGAAGTGTGCAGACA-GGAAAATAATGCCTTCTAGTAT  993
      ||||| ||||| ||||||||||||||| | ||||||||| | ||||||||
seq2  GTGGTAACAAG-TGAAGTGTGCAGACATGAAAAATAATGGCCTCTAGTAT  999

seq1  TCCCAT-GGACTCGGGTCCAAGATGGGTG-CCTGCATTTG-CATGCTGAG  1040
      ||| || ||||||||  |||||||||||| |||||||||| |||||||||
seq2  TCCAATGGGACTCGGTCCCAAGATGGGTGCCCTGCATTTGCCATGCTGAG  1049

seq1  AGGACAGGGGCAGGTGTACGGAG-CTCTCCCCTTAGGCAGG--CACTG-A  1086
      | |||| |||||||||||||||| ||||||| | ||||| |  ||||| |
seq2  A-GACATGGGCAGGTGTACGGAGCCTCTCCCTTAAGGCAAGCACACTGAA  1098

seq1  AACCAA-GGGAGAAGCACACAG  1107
      |||||| || || |||||||||
seq2  AACCAATGGTAGTAGCACACAG  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information