MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-236C18
Chromosome	10 (Build37)
Map Location	75,599,601 - 75,743,540
singlet/doublet	doublet
Overlap gene	Slc5a4a, LOC100040150, Prmt2, S100b, Dip2a
Upstream gene	Bcr, Specc1l, LOC100040670, Adora2a, EG544707, Upb1, 1110038D17Rik, Snrpd3, AI646023, Ggt1, Ggtla1, Susd2, Cabin1, Ddt, Gstt3, Gstt1, Gstt4, Gstt2, Mif, Derl3, Smarcb1, Mmp11, Ndg2, Gm867, Vpreb3, EG333669, Suhw2, Slc5a4b
Downstream gene	Pcnt, 2610028H24Rik, A130042E20Rik, Mcm3ap, Lss, 1700027D21Rik, Ftcd, Col6a2, Col6a1, Pcbp3, LOC100041099, Slc19a1, Col18a1, LOC665762, Pofut2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Bcr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110279 MGI:88141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Specc1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74392 MGI:1921642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040670 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Adora2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11540 MGI:99402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544707 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544707 MGI:3645934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins

name	Upb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103149 MGI:2143535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110038D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68778 MGI:1916028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67332 MGI:1914582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI646023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192734 MGI:2143657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14598 MGI:95706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggtla1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23887 MGI:1346063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Susd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71733 MGI:1918983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104248 MGI:1298375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13202 MGI:1298381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103140 MGI:2143526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14871 MGI:107379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75886 MGI:1923136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14872 MGI:106188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17319 MGI:96982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Derl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70377 MGI:1917627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20587 MGI:1328366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17385 MGI:97008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103172 MGI:2143558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333670 MGI:2685713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vpreb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22364 MGI:98938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG333669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333669 MGI:3646667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suhw2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64453 MGI:1927865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64454 MGI:1890478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64452 MGI:1927848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Prmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15468 MGI:1316652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	S100b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20203 MGI:98217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dip2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64451 MGI:2385920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18541 MGI:102722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610028H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76964 MGI:1924214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130042E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216119 MGI:2656825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcm3ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54387 MGI:1930089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lss (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16987 MGI:1336155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76573 MGI:1923823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftcd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14317 MGI:1339962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col6a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12834 MGI:88460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12833 MGI:88459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59093 MGI:1890470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Slc19a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20509 MGI:103182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col18a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12822 MGI:88451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Pofut2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80294 MGI:1916863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487228 GeneID:110279 MGI:88141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : breakpoint cluster region homolog transcript_id : NM_001081412.1

name	Specc1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274626 GeneID:74392 MGI:1921642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPECC1-like transcript_id : NM_153406.2

name	Adora2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517499 GeneID:11540 MGI:99402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine A2a receptor transcript_id : NM_009630.2

name	Upb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352709 GeneID:103149 MGI:2143535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ureidopropionase, beta transcript_id : NM_133995.2

name	1110038D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181296 GeneID:68778 MGI:1916028
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110038D17 gene transcript_id : NM_175133.1

name	Snrpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129857 GeneID:67332 MGI:1914582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein D3 transcript_id : NM_026095.4

name	AI646023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38524601 GeneID:192734 MGI:2143657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI646023 transcript_id : NM_198860.1

name	Ggt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130952 GeneID:14598 MGI:95706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyltransferase 1 transcript_id : NM_008116.2

name	Ggtla1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801950 GeneID:23887 MGI:1346063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyltransferase-like activity 1 transcript_id : NM_011820.3

name	Susd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802902 GeneID:71733 MGI:1918983
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi domain containing 2 transcript_id : NM_027890.4

name	Cabin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92859876 GeneID:104248 MGI:1298375
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcineurin binding protein 1 transcript_id : NM_172549.3

name	Ddt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753617 GeneID:13202 MGI:1298381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D-dopachrome tautomerase transcript_id : NM_010027.1

name	Gstt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892397 GeneID:103140 MGI:2143526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, theta 3 transcript_id : NM_133994.3

name	Gstt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982316 GeneID:14871 MGI:107379
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, theta 1 transcript_id : NM_008185.2

name	Gstt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313101 GeneID:75886 MGI:1923136
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, theta 4 transcript_id : NM_029472.1

name	Gstt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754087 GeneID:14872 MGI:106188
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, theta 2 transcript_id : NM_010361.1

name	Mif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130170 GeneID:17319 MGI:96982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage migration inhibitory factor transcript_id : NM_010798.2

name	Derl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891759 GeneID:70377 MGI:1917627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Der1-like domain family, member 3 transcript_id : NM_024440.2

name	Smarcb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755577 GeneID:20587 MGI:1328366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 transcript_id : NM_011418.1

name	Mmp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893135 GeneID:17385 MGI:97008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 11 transcript_id : NM_008606.2

name	Ndg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34013513 GeneID:103172 MGI:2143558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nur77 downstream gene 2 transcript_id : NM_175329.3

name	Gm867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226203 GeneID:333670 MGI:2685713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 867, (NCBI) transcript_id : NM_001037714.2

name	Vpreb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345561 GeneID:22364 MGI:98938
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B lymphocyte gene 3 transcript_id : NM_009514.3

name	EG333669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802175 GeneID:333669 MGI:3646667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG333669 transcript_id : NM_198635.2

name	Suhw2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343456 GeneID:64453 MGI:1927865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of hairy wing homolog 2 (Drosophila) transcript_id : NM_177475.2

name	Slc5a4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676362 GeneID:64454 MGI:1890478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (neutral amino acid transporters, system A), member 4b transcript_id : NM_023219.2

name	Slc5a4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444905 GeneID:64452 MGI:1927848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5, member 4a transcript_id : NM_133184.2

name	Prmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938279 GeneID:15468 MGI:1316652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 2 transcript_id : NM_133182.2

name	Prmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938281 GeneID:15468 MGI:1316652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 2 transcript_id : NM_001077638.1

name	S100b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54262155 GeneID:20203 MGI:98217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 protein, beta polypeptide, neural transcript_id : NM_009115.2

name	Dip2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487256 GeneID:64451 MGI:2385920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIP2 disco-interacting protein 2 homolog A (Drosophila) transcript_id : NM_001081419.1

name	Pcnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93004084 GeneID:18541 MGI:102722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pericentrin (kendrin) transcript_id : NM_008787.3

name	2610028H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037478 GeneID:76964 MGI:1924214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610028H24 gene transcript_id : NM_029816.1

name	A130042E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865957 GeneID:216119 MGI:2656825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130042E20 gene transcript_id : NM_172550.4

name	Mcm3ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627647 GeneID:54387 MGI:1930089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 3 (S. cerevisiae) associated protein transcript_id : NM_019434.2

name	Lss (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122468 GeneID:16987 MGI:1336155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lanosterol synthase transcript_id : NM_146006.1

name	1700027D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313251 GeneID:76573 MGI:1923823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700027D21 gene transcript_id : NM_029661.1

name	Ftcd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252783 GeneID:14317 MGI:1339962
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formiminotransferase cyclodeaminase transcript_id : NM_080845.1

name	Col6a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203746 GeneID:12834 MGI:88460
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VI, alpha 2 transcript_id : NM_146007.1

name	Col6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129824 GeneID:12833 MGI:88459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VI, alpha 1 transcript_id : NM_009933.2

name	Pcbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947013 GeneID:59093 MGI:1890470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 3 transcript_id : NM_021568.1

name	LOC100041099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260965 GeneID:100041099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041099 transcript_id : XM_001477376.1

name	Slc19a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130166 GeneID:20509 MGI:103182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 19 (sodium/hydrogen exchanger), member 1 transcript_id : NM_031196.2

name	Col18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789281 GeneID:12822 MGI:88451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XVIII, alpha 1 transcript_id : NM_009929.2

name	Pofut2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044906 GeneID:80294 MGI:1916863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-fucosyltransferase 2 transcript_id : NM_030262.3

name	Bcr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487229 GeneID:110279 MGI:88141
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : breakpoint cluster region homolog protein_id : NP_001074881.1

name	Specc1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49274627 GeneID:74392 MGI:1921642
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : SPECC1-like protein_id : NP_700455.2

name	Adora2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517500 CCDS:CCDS23924.1 GeneID:11540 MGI:99402
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0001611 - A2A adenosine receptor activity, G-protein coupled [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001973 - adenosine receptor signaling pathway [Evidence IDA]; GO:0042755 - eating behavior [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IDA] [Evidence IGI]; GO:0007626 - locomotory behavior [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001963 - synaptic transmission, dopaminergic [Evidence IGI] codon_start : 1 product : adenosine A2a receptor protein_id : NP_033760.2

name	Upb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527212 CCDS:CCDS23925.1 GeneID:103149 MGI:2143535
definition	GO_function : GO:0003837 - beta-ureidopropionase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ureidopropionase, beta protein_id : NP_598756.1

name	1110038D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181297 GeneID:68778 MGI:1916028
definition	codon_start : 1 product : hypothetical protein LOC68778 protein_id : NP_780342.1

name	Snrpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385598 CCDS:CCDS23926.1 GeneID:67332 MGI:1914582
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein D3 protein_id : NP_080371.1

name	AI646023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38524602 GeneID:192734 MGI:2143657
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC192734 protein_id : NP_942560.1

name	Ggt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679995 CCDS:CCDS23927.1 GeneID:14598 MGI:95706
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003840 - gamma-glutamyltransferase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006750 - glutathione biosynthesis [Evidence IEA]; GO:0006749 - glutathione metabolism [Evidence TAS]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : gamma-glutamyl transpeptidase product : gamma-glutamyltransferase 1 protein_id : NP_032142.1

name	Ggtla1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542891 CCDS:CCDS23928.1 GeneID:23887 MGI:1346063
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003840 - gamma-glutamyltransferase activity [Evidence IDA] [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006750 - glutathione biosynthesis [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0019370 - leukotriene biosynthesis [Evidence IMP] codon_start : 1 note : gamma-glutamyl leukotrienase product : gamma-glutamyltransferase-like activity 1 protein_id : NP_035950.2

name	Susd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980672 CCDS:CCDS23929.1 GeneID:71733 MGI:1918983
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sushi domain containing 2 protein_id : NP_082166.2

name	Cabin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70995287 GeneID:104248 MGI:1298375
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0004864 - protein phosphatase inhibitor activity [Evidence ISS] GO_process : GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : calcineurin inhibitor; protein phosphatase 3 inhibitor product : calcineurin binding protein 1 protein_id : NP_766137.2

name	Ddt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753618 CCDS:CCDS23930.1 GeneID:13202 MGI:1298381
definition	GO_function : GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006583 - melanin biosynthesis from tyrosine [Evidence IEA] codon_start : 1 product : D-dopachrome tautomerase protein_id : NP_034157.1

name	Gstt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536248 CCDS:CCDS23931.1 GeneID:103140 MGI:2143526
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA] codon_start : 1 product : glutathione S-transferase, theta 3 protein_id : NP_598755.1

name	Gstt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982317 CCDS:CCDS23932.1 GeneID:14871 MGI:107379
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : glutathione S-transferase, theta 1 protein_id : NP_032211.2

name	Gstt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313102 CCDS:CCDS23933.1 GeneID:75886 MGI:1923136
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : glutathione S-transferase, theta 4 protein_id : NP_083748.1

name	Gstt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754088 GeneID:14872 MGI:106188
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006749 - glutathione metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation product : glutathione S-transferase, theta 2 protein_id : NP_034491.1

name	Mif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754696 CCDS:CCDS23934.1 GeneID:17319 MGI:96982
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0050178 - phenylpyruvate tautomerase activity [Evidence IEA] GO_process : GO:0007569 - cell aging [Evidence IMP]; GO:0030330 - DNA damage response, signal transduction by p53 class mediator [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP] codon_start : 1 product : macrophage migration inhibitory factor protein_id : NP_034928.1

name	Derl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18859601 CCDS:CCDS23935.1 GeneID:70377 MGI:1917627
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Der1-like domain family, member 3 protein_id : NP_077760.1

name	Smarcb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755578 CCDS:CCDS23936.1 GeneID:20587 MGI:1328366
definition	GO_component : GO:0000228 - nuclear chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0016514 - SWI/SNF complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001824 - blastocyst development [Evidence IMP]; GO:0001835 - blastocyst hatching [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence IEA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0045090 - retroviral genome replication [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : integrase interactor 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 protein_id : NP_035548.1

name	Mmp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678894 CCDS:CCDS23937.1 GeneID:17385 MGI:97008
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : stromelysin 3 product : matrix metalloproteinase 11 protein_id : NP_032632.1

name	Ndg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34013514 CCDS:CCDS23938.1 GeneID:103172 MGI:2143558
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : Nur77 downstream protein 2 protein_id : NP_780538.2

name	Gm867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83423528 GeneID:333670 MGI:2685713
definition	codon_start : 1 product : hypothetical protein LOC333670 protein_id : NP_001032803.1

name	Vpreb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678579 CCDS:CCDS23940.1 GeneID:22364 MGI:98938
definition	codon_start : 1 product : pre-B lymphocyte gene 3 protein_id : NP_033540.1

name	EG333669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348512 GeneID:333669 MGI:3646667
definition	codon_start : 1 product : hypothetical protein LOC333669 protein_id : NP_941037.1

name	Suhw2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29126215 CCDS:CCDS23942.1 GeneID:64453 MGI:1927865
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : suppressor of hairy wing homolog 2 protein_id : NP_803426.1

name	Slc5a4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676363 GeneID:64454 MGI:1890478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 note : low affinity sodium-glucose cotransporter product : solute carrier family 5 member 4b protein_id : NP_075708.2

name	Slc5a4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444906 GeneID:64452 MGI:1927848
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 5, member alpha 4a; sodium-dependent glucose cotransporter product : solute carrier family 5, member 4a protein_id : NP_573447.2

name	Prmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938282 GeneID:15468 MGI:1316652
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein methyltransferase-like 1 protein_id : NP_001071106.1

name	Prmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938280 GeneID:15468 MGI:1316652
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein methyltransferase-like 1 protein_id : NP_573445.2

name	S100b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677839 GeneID:20203 MGI:98217
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence NAS] [Evidence TAS]; GO:0005576 - extracellular region [Evidence IDA] [Evidence NAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence NAS] [Evidence TAS]; GO:0019210 - kinase inhibitor activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0048154 - S100 beta binding [Evidence ISS]; GO:0048156 - tau protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0048143 - astrocyte activation [Evidence ISS]; GO:0007409 - axonogenesis [Evidence ISS]; GO:0006874 - calcium ion homeostasis [Evidence NAS]; GO:0006112 - energy reserve metabolism [Evidence NAS]; GO:0048151 - hyperphosphorylation [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence NAS]; GO:0007613 - memory [Evidence IMP]; GO:0045917 - positive regulation of complement activation [Evidence ISS]; GO:0042035 - regulation of cytokine biosynthesis [Evidence NAS]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence NAS]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence IMP] codon_start : 1 product : S100 protein, beta polypeptide, neural protein_id : NP_033141.1

name	Dip2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487257 GeneID:64451 MGI:2385920
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : disco interacting protein 2 homolog protein_id : NP_001074888.1

name	Pcnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93004085 CCDS:CCDS23944.1 GeneID:18541 MGI:102722
definition	GO_component : GO:0005814 - centriole [Evidence IDA]; GO:0005813 - centrosome [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IDA] GO_process : GO:0042384 - cilium biogenesis [Evidence ISS]; GO:0007051 - spindle organization and biogenesis [Evidence IDA] codon_start : 1 note : pericentrin 2; pericentrin-360; pericentrin-250 product : pericentrin protein_id : NP_032813.3

name	2610028H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037479 GeneID:76964 MGI:1924214
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC76964 protein_id : NP_084092.1

name	A130042E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607131 CCDS:CCDS23946.1 GeneID:216119 MGI:2656825
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC216119 protein_id : NP_766138.3

name	Mcm3ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109627648 CCDS:CCDS23947.1 GeneID:54387 MGI:1930089
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : nuclear protein GANP; minichromosome maintenance deficient (S. cerevisiae) 3-associated protein product : minichromosome maintenance complex component 3 associated protein protein_id : NP_062307.2

name	Lss (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122469 CCDS:CCDS23948.1 GeneID:16987 MGI:1336155
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0000250 - lanosterol synthase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 product : lanosterol synthase protein_id : NP_666118.1

name	1700027D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313252 CCDS:CCDS23949.1 GeneID:76573 MGI:1923823
definition	codon_start : 1 product : hypothetical protein LOC76573 protein_id : NP_083937.1

name	Ftcd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252784 CCDS:CCDS23950.1 GeneID:14317 MGI:1339962
definition	GO_function : GO:0030412 - formimidoyltetrahydrofolate cyclodeaminase activity [Evidence TAS]; GO:0030409 - glutamate formimidoyltransferase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006548 - histidine catabolism [Evidence TAS]; GO:0006547 - histidine metabolism [Evidence IEA] codon_start : 1 note : glutamate formiminotransferase product : formiminotransferase cyclodeaminase protein_id : NP_543121.1

name	Col6a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203747 CCDS:CCDS23951.1 GeneID:12834 MGI:88460
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type VI, alpha 2 protein_id : NP_666119.1

name	Col6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753484 CCDS:CCDS23952.1 GeneID:12833 MGI:88459
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type VI, alpha 1 protein_id : NP_034063.1

name	Pcbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947014 GeneID:59093 MGI:1890470
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : poly(rC)-binding protein 3 product : poly(rC) binding protein 3 protein_id : NP_067543.1

name	LOC100041099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260966 GeneID:100041099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477426.1

name	Slc19a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654260 GeneID:20509 MGI:103182
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005542 - folic acid binding [Evidence IEA]; GO:0008518 - reduced folate carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 19 (sodium/hydrogen exchanger), member 1 protein_id : NP_112473.1

name	Col18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789282 CCDS:CCDS23953.1 GeneID:12822 MGI:88451
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IDA] [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0001886 - endothelial cell morphogenesis [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 product : procollagen, type XVIII, alpha 1 protein_id : NP_034059.2

name	Pofut2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19525731 CCDS:CCDS23954.1 GeneID:80294 MGI:1916863
definition	GO_function : GO:0046922 - peptide-O-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006004 - fucose metabolism [Evidence IEA] codon_start : 1 product : protein O-fucosyltransferase 2 protein_id : NP_084538.2

name	LOC100040670 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040670
definition	number : 1 pseudo : _no_value

name	LOC100040150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040150
definition	number : 2 pseudo : _no_value

name	LOC100040150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040150
definition	number : 1 pseudo : _no_value

name	LOC665762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665762
definition	number : 1 pseudo : _no_value

name	EG544707 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260949 GeneID:544707 MGI:3645934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : predicted gene, EG544707 transcript_id : XR_001554.2

clone name	MSMg01-290M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300D23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-236C18.b	B6Ng01-236C18.g
ACC	GA047456	GA047457
length	1,155	1,092
definition	B6Ng01-236C18.b	B6Ng01-236C18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(75,599,601 - 75,600,763)	(75,742,444 - 75,743,540)
sequence	gaattcactgtgcctgggtgcctaagtctcctgtcacttatctgagatgg gatcattttctgttgtctactctgttgctagaccacatccaaaagggatc cctgcccccataggccagtgccaggggagctactggtctgagacactgta gaaggttctgttttgagtaaggagtaactagacccatgctgtcaaattca aagttcagcaaccaatttctagacaaatacatcttcttccatctatgatc ttgcttcttctctctgttccccacttgcagattgtacctagttgagtcct gctcaatgaactgtgtctctcctcagataaggtggcctgcattgtacctt ctgagtgtgagaaacagtgtggcactgcggtcggctgcaccaacaatgcc taccccaccctggtgctggagttgatgcctgatggtaagtaaccatccat agcatgtctagagggatacacgggccatgaggaacacattggggaagacc ctctggcaatccttccattaatgcagtcctactcatcagataatccttga gaatcagtcacagtcacccagtcacctgctggctgggtctggagattgca gagaggagctaatttctgttagaagaatactgccaagggtgaatgtctgg ttatgtcaacttgacacgagctggagttatcacagataaagcctcccttg aggaaatgcctccatgagatccagctgtaaggcattttttcaattagtga tcaaggggggagggtcccttgaggatggtgccatcactgggctggtagtc ttaggttctataagagagcaagctgagcaagccaagggaagcaagccagt aagtcacatccttccatggcctctgcatcagctcctgcttcctgacctgc ttgagttccagtccttgacttcctttggtgatgaacagcaatgtggaagt gtaaggtgaataaaccctttcctccccaacttgcttcttggtcatgatgt ttgtgcagaatagaaaccctgactagacactcagttaacattgcaatgat tttctagctaagagagttgtattgctataacatgtgtagactcagagact agatgtactttaacctggccttcttaaactacttctctcagtccacgtgc tttat	gaattcacatttctgaaacgaagcagcgctttctggaagggacgctccac ccatgtaacgtgttgatgtgccctcacacgtgcgttaccaaccttcccaa gcctcgccagaaacagccaggttagtacctaacagcgaggccgcctggcc ttgacgggctggctgcagtgggtgtagctgcattggatcttgcaggagtc agtacccccacctccttgggcctggggttgagttaaggatcagactgggt gtgtgcacctgctcctggctcacgaaatgggatgctgctggtgcagctgc ctgttggtacccacctgcctcctggtaatcagttttaatgatacattcaa gggtacattaatgtctgcaaggagatgtaggctctggatccaagaagccc ctggtagccactagggttttaggaattggagtttctcaagggttaatttc atgtttctgatttaacacaaaaaataagtataaaggccagtttagctagc acaatcagtttgttattaatttgtatatgtaaatatttaggaaaagctag cttccttttactgactactgaatacataagtataacacacttcaaggatt ctggtttacacatgaaatatagcatagctataaaacattatttggttagc atcccaagaatatggtacatggcatagtttatatttgagagtgatctgag ttcttacacttaaagaaaagtattaatacccaggtacattttaaaataac aacagttatatatgtaagtaaagccatggggcattacggattagaagttc ccagctcggcatttggaatctgtttgcagaagttggaccagcctcgatga ttgttgggaacctggtttgctggaaaaaggatcgcacaggcctctgggag agagctggcccacctgggaggacagcgaccaggctcgcaaggtaccgggc atctcctgggggcagtggcatccagacagtgcagtgcgaggctcctctct ctgcacagttctgttctggcagacgtgctgcagtgcggctccacaccact cctgaaccaccctctgttctgcctgctgatgctaagtgagag
quality values	Open. Hide. 58 31 29 31 62 31 18 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 45 31 32 25 24 24 34 45 36 34 62 54 54 62 62 62 59 59 62 62 62 59 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 59 59 59 30 32 54 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 49 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 62 62 62 62 62 62 62 62 62 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 56 56 62 62 62 62 62 62 62 62 62 54 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 54 58 54 54 54 54 54 54 58 54 54 58 58 54 58 54 52 52 48 54 54 54 52 54 58 54 45 46 40 52 39 54 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 47 36 37 52 52 47 52 46 58 52 58 49 58 58 34 58 51 48 48 48 58 58 50 58 51 58 42 58 50 58 58 47 58 40 37 51 49 51 58 58 45 46 54 48 58 58 49 58 58 46 49 58 54 53 58 58 51 33 40 50 41 58 50 53 51 54 51 58 51 51 41 50 50 54 42 58 50 58 51 50 54 54 39 53 50 33 49 53 49 53 51 37 53 50 58 58 39 35 46 49 50 37 42 38 44 50 50 35 19 37 50 58 50 41 46 32 49 32 39 33 30 50 50 46 16 35 42 35 40 29 39 46 49 53 41 39 52 37 54 15 40 49 54 54 54 54 45 39 22 42 47 51 34 37 49 54 37 35 40 25 27 26 54 54 54 54 44 42 16 54 52 39 35 42 39 45 37 49 30 23 32 19 18 45 54 31 42 23 42 27 41 39 31 40 33 33 54 40 32 40 37 52 32 45 35 43 42 39 34 31 25 27 23 52 40 33 40 36 32 53 31 51 21 27 15 35 30 27 33 32 47 29 46 8 43 27 13 18 30 30 28 17 25 46 33 25 24 15 43 29 46 33 32 33 33 32 30 37 42 34 20 28 31 31 39 45 35 33 21 46 20 21 28 33 42 42 30 32 29 31 28 31 31 29 31 25 33 25 31 30 30 30 13 31 31 33 42 30 21 24 34 34 21 31 26 32 24 33 32 37 43 22 42 38 26 31 34 27 25 18 38 7 8 19 27 10 10 35 19 14 15 47 8 14 37 23 30 25 18 31 31 43 32 33 21 32 31 24 23 31 23 26 26 22 30 24 18 29 10 29 19 6 23 6 13 12 27 26 21 47 22 25 41 22 34 44 33 36 28 14 20 35 25 16 7 22 21 19 21 21 29 30 19 19 14 11 22 16 24 31 31 24 32 32 21 29 32 40 27 33 31 34 25 14 29 23 16 22 30 28 32 39 22 10 28 11 21 33 22 16 28 33 9 16 15 20 24 28 16 16 16 16 14 13 11 23 21 19 15 19 19 20 9 24 28 28 28 47 34 28 23 16 27 27 29 28 14 19 5 3 5 11 6 22 10 13 20 25 5 9 21 28 19 13 10 8 5 3 3 8 10 6 6 8 16 8 22 13 4 21 7 5 19 4 22 9 13 16 8 25 15 7 5 3 6 15 17 18 4 5 25 17 3 6 7 6 6 16 11 6 3 5 5 2 8 14 14 23 10 7 15 16 7 5 12 16 7 6 4 9 9 10 9 6 3 3 7 19 5 1 2 1	Open. Hide. 62 47 56 47 62 47 51 62 47 62 62 39 38 21 22 28 27 34 22 22 50 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 54 54 62 56 56 54 54 59 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 46 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 52 62 54 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 46 58 54 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 54 54 54 48 47 52 41 43 52 52 52 54 54 54 54 52 54 58 54 54 49 58 47 58 58 58 58 51 58 52 58 58 58 58 58 54 58 51 50 48 49 51 48 48 54 54 45 47 51 58 58 39 37 58 52 58 58 58 58 58 44 50 51 43 58 49 58 58 58 49 35 58 53 53 51 51 51 51 51 54 33 54 54 52 53 53 50 50 44 44 49 51 49 44 44 58 50 58 49 50 51 41 50 42 40 51 41 47 39 35 50 50 58 49 37 35 35 58 39 41 53 53 41 51 54 54 49 40 49 52 29 36 49 51 42 53 39 49 51 54 54 54 42 54 42 53 53 47 31 45 51 41 49 36 49 51 42 44 42 28 42 38 47 52 54 30 54 51 40 54 54 54 49 31 42 42 42 45 45 42 53 42 49 35 31 42 38 49 37 31 41 23 51 49 53 40 30 49 49 51 42 33 38 40 21 28 46 31 34 37 17 32 52 40 47 33 47 35 32 32 52 32 53 35 52 36 31 31 29 28 42 31 51 51 45 29 31 31 43 35 31 28 30 34 30 36 38 22 51 30 29 31 45 29 51 46 33 25 45 45 31 30 31 30 24 43 46 33 29 32 33 24 32 31 31 32 31 32 33 27 27 31 24 38 34 30 33 31 42 31 32 32 28 29 18 33 43 36 29 16 24 31 33 41 21 28 31 27 27 30 46 30 25 31 27 32 27 26 33 19 48 8 24 31 27 17 22 36 48 46 46 18 18 15 23 31 31 27 33 21 27 19 11 15 10 16 38 31 30 29 44 24 24 9 31 6 22 19 33 42 27 30 16 30 31 16 15 14 26 10 41 11 32 26 23 26 9 15 15 28 16 24 18 22 32 15 14 20 15 21 32 34 16 16 20 32 18 31 25 18 19 48 26 12 15 33 32 32 14 16 9 16 31 37 39 30 15 11 17 5 12 30 24 27 32 12 18 17 4 19 7 8 8 9 15 16 7 13 8 25 22 11 30 9 21 13 27 24 13 28 17 22 20 27 20 24 27 16 15 13 11 24 11 16 25 11 16 8 13 30 9 9 21 7 21 10 28 11 8 15 21 27 15 16 23 27 13 9 14 3 9 21 10 11 8 5 5 6 8 19 16 3 9 10 5 17 4 10 10 12 20 16 15 14 28 4 11 13 9 15 7 16 20 4 15 6 16 16 16 12 17 8 15 4 15 20 17 8 9 3 2 2 6 5 11 1

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_75599601_75600763
seq2: B6Ng01-236C18.b_41_1195

seq1  GAATTCACTGTGCCTGGGTGCCTAAGTCTCCTGTCACTTATCTGAGATGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTGTGCCTGGGTGCCTAAGTCTCCTGTCACTTATCTGAGATGG  50

seq1  GATCATTTTCTGTTGTCTACTCTGTTGCTAGACCACATCCAAAAGGGATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCATTTTCTGTTGTCTACTCTGTTGCTAGACCACATCCAAAAGGGATC  100

seq1  CCTGCCCCCATAGGCCAGTGCCAGGGGAGCTACTGGTCTGAGACACTGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCCCCATAGGCCAGTGCCAGGGGAGCTACTGGTCTGAGACACTGTA  150

seq1  GAAGGTTCTGTTTTGAGTAAGGAGTAACTAGACCCATGCTGTCAAATTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGTTCTGTTTTGAGTAAGGAGTAACTAGACCCATGCTGTCAAATTCA  200

seq1  AAGTTCAGCAACCAATTTCTAGACAAATACATCTTCTTCCATCTATGATC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTCAGCAACCAATTTCTAGACAAATACATCTTCTTCCATCTATGATC  250

seq1  TTGCTTCTTCTCTCTGTTCCCCACTTGCAGATTGTACCTAGTTGAGTCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTCTTCTCTCTGTTCCCCACTTGCAGATTGTACCTAGTTGAGTCCT  300

seq1  GCTCAATGAACTGTGTCTCTCCTCAGATAAGGTGGCCTGCATTGTACCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAATGAACTGTGTCTCTCCTCAGATAAGGTGGCCTGCATTGTACCTT  350

seq1  CTGAGTGTGAGAAACAGTGTGGCACTGCGGTCGGCTGCACCAACAATGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGTGTGAGAAACAGTGTGGCACTGCGGTCGGCTGCACCAACAATGCC  400

seq1  TACCCCACCCTGGTGCTGGAGTTGATGCCTGATGGTAAGTAACCATCCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCCACCCTGGTGCTGGAGTTGATGCCTGATGGTAAGTAACCATCCAT  450

seq1  AGCATGTCTAGAGGGATACACGGGCCATGAGGAACACATTGGGGAAGACC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATGTCTAGAGGGATACACGGGCCATGAGGAACACATTGGGGAAGACC  500

seq1  CTCTGGCAATCCTTCCATTAATGCAGTCCTACTCATCAGATAATCCTTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGCAATCCTTCCATTAATGCAGTCCTACTCATCAGATAATCCTTGA  550

seq1  GAATCAGTCACAGTCACCCAGTCACCTGCTGGCTGGGTCTGGAGATTGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCAGTCACAGTCACCCAGTCACCTGCTGGCTGGGTCTGGAGATTGCA  600

seq1  GAGAGGAGCTAATTTCTGTTAGAAGAATACTGCCAAGGGTGAATGTCTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGGAGCTAATTTCTGTTAGAAGAATACTGCCAAGGGTGAATGTCTGG  650

seq1  TTATGTCAACTTGACACGAGCTGGAGTTATCACAGATAAAGCCTCCCTTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTCAACTTGACACGAGCTGGAGTTATCACAGATAAAGCCTCCCTTG  700

seq1  AGGAAATGCCTCCATGAGATCCAGCTGTAAGGCATTTTTTCAATTAGTGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAATGCCTCCATGAGATCCAGCTGTAAGGCATTTTTTCAATTAGTGA  750

seq1  TCAAGGGGGGAGGGTCCCTTGAGGATGGTGCCATCACTGGGCTGGTAGTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGGGGGAGGGTCCCTTGAGGATGGTGCCATCACTGGGCTGGTAGTC  800

seq1  TTAGGTTCTATAAGAGAGCAAGCTGAGCAAGCCAAGGGAAGCAAGCCAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGTTCTATAAGAGAGCAAGCTGAGCAAGCCAAGGGAAGCAAGCCAGT  850

seq1  AAGTCACATCCTTCCATGGCCTCTGCATCAGCTCCTGCTTCCTGACCTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCACATCCTTCCATGGCCTCTGCATCAGCTCCTGCTTCCTGACCTGC  900

seq1  TTGAGTTCCAGTCC-TGACTTCCTTTGGTGATGAACAGCAATGTGGAAGT  949
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  TTGAGTTCCAGTCCTTGACTTCCTTTGGTGATGAACAGCAATGTGGAAGT  950

seq1  GTAAGGTGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGGTGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGT  1000

seq1  TTGTGCAGGAATAGAAACCCTGACTAAGACACTCAGTTAACATTGCAATG  1049
      ||||||| ||||||||||||||||| ||||||||||||||||||||||||
seq2  TTGTGCA-GAATAGAAACCCTGACT-AGACACTCAGTTAACATTGCAATG  1048

seq1  ATTTTCTAGCTAAAGAAGAAGTTGTAATGCTAT-ACATGTGTAGACCCAG  1098
      ||||||||||| ||||   ||||||| |||||| |||||||||||| |||
seq2  ATTTTCTAGCT-AAGA--GAGTTGTATTGCTATAACATGTGTAGACTCAG  1095

seq1  AAGACTAGATGTTAACTTTTACCCTGGCTTCTTTAGACTAACATCTCTCA  1148
       |||||||||||  || |||| |||||| |  ||| ||| || |||||||
seq2  -AGACTAGATGT--AC-TTTAACCTGGCCTTCTTAAACT-ACTTCTCTCA  1140

seq1  GTCCACGTGCTTTAT  1163
      |||||||||||||||
seq2  GTCCACGTGCTTTAT  1155

seq1: chr10_75742444_75743540
seq2: B6Ng01-236C18.g_62_1153 (reverse)

seq1  CTCTCACCTTAGCATTCAGCAGCAGGAACAGAGGGTGG-TCAGGAGTGGT  49
      |||||| ||||||| |||||||   ||||||||||||| |||||||||||
seq2  CTCTCA-CTTAGCA-TCAGCAGGCAGAACAGAGGGTGGTTCAGGAGTGGT  48

seq1  GTGAGCCCGCCACTGCAGCACGTCTGCCAGGAACAGGAACTGTGCAGAGA  99
      |||   ||| ||||||||||||||||||| ||||| ||||||||||||||
seq2  GTGGAGCCG-CACTGCAGCACGTCTGCCA-GAACA-GAACTGTGCAGAGA  95

seq1  GAGGAGCCTCGCACCTGCACTGTCTTGGATGCCACCTGCCCCCAGGAGAT  149
      ||||||||||||| |||||||||| ||||||||| |||||||||||||||
seq2  GAGGAGCCTCGCA-CTGCACTGTC-TGGATGCCA-CTGCCCCCAGGAGAT  142

seq1  GCCCGGTACCTTGCGAGCCTGGTCGCTGTCCT-CCAGGTGGGCCAGCTCT  198
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  GCCCGGTACCTTGCGAGCCTGGTCGCTGTCCTCCCAGGTGGGCCAGCTCT  192

seq1  CTCCCAGAGGCCTGTGCGATCCTTTTTCCAGC-AACCAGGTTCCCAACAA  247
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  CTCCCAGAGGCCTGTGCGATCCTTTTTCCAGCAAACCAGGTTCCCAACAA  242

seq1  TCATCGAGGCTGGTCCAACTTCTGCAAACAGATTCCAAATGCCGAGCTGG  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCGAGGCTGGTCCAACTTCTGCAAACAGATTCCAAATGCCGAGCTGG  292

seq1  GAACTTCTAATCCGTAATGCCCCATGGCTTTACTTACATATATAACTGTT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTTCTAATCCGTAATGCCCCATGGCTTTACTTACATATATAACTGTT  342

seq1  GTTATTTTAAAATGTACCTGGGTATTAATACTTTTCTTTAAGTGTAAGAA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATTTTAAAATGTACCTGGGTATTAATACTTTTCTTTAAGTGTAAGAA  392

seq1  CTCAGATCACTCTCAAATATAAACTATGCCATGTACCATATTCTTGGGAT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGATCACTCTCAAATATAAACTATGCCATGTACCATATTCTTGGGAT  442

seq1  GCTAACCAAATAATGTTTTATAGCTATGCTATATTTCATGTGTAAACCAG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAACCAAATAATGTTTTATAGCTATGCTATATTTCATGTGTAAACCAG  492

seq1  AATCCTTGAAGTGTGTTATACTTATGTATTCAGTAGTCAGTAAAAGGAAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCTTGAAGTGTGTTATACTTATGTATTCAGTAGTCAGTAAAAGGAAG  542

seq1  CTAGCTTTTCCTAAATATTTACATATACAAATTAATAACAAACTGATTGT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCTTTTCCTAAATATTTACATATACAAATTAATAACAAACTGATTGT  592

seq1  GCTAGCTAAACTGGCCTTTATACTTATTTTTTGTGTTAAATCAGAAACAT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGCTAAACTGGCCTTTATACTTATTTTTTGTGTTAAATCAGAAACAT  642

seq1  GAAATTAACCCTTGAGAAACTCCAATTCCTAAAACCCTAGTGGCTACCAG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATTAACCCTTGAGAAACTCCAATTCCTAAAACCCTAGTGGCTACCAG  692

seq1  GGGCTTCTTGGATCCAGAGCCTACATCTCCTTGCAGACATTAATGTACCC  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTTCTTGGATCCAGAGCCTACATCTCCTTGCAGACATTAATGTACCC  742

seq1  TTGAATGTATCATTAAAACTGATTACCAGGAGGCAGGTGGGTACCAACAG  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAATGTATCATTAAAACTGATTACCAGGAGGCAGGTGGGTACCAACAG  792

seq1  GCAGCTGCACCAGCAGCATCCCATTTCGTGAGCCAGGAGCAGGTGCACAC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTGCACCAGCAGCATCCCATTTCGTGAGCCAGGAGCAGGTGCACAC  842

seq1  ACCCAGTCTGATCCTTAACTCAACCCCAGGCCCAAGGAGGTGGGGGTACT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCAGTCTGATCCTTAACTCAACCCCAGGCCCAAGGAGGTGGGGGTACT  892

seq1  GACTCCTGCAAGATCCAATGCAGCTACACCCACTGCAGCCAGCCCGTCAA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCCTGCAAGATCCAATGCAGCTACACCCACTGCAGCCAGCCCGTCAA  942

seq1  GGCCAGGCGGCCTCGCTGTTAGGTACTAACCTGGCTGTTTCTGGCGAGGC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGGCGGCCTCGCTGTTAGGTACTAACCTGGCTGTTTCTGGCGAGGC  992

seq1  TTGGGAAGGTTGGTAACGCACGTGTGAGGGCACATCAACACGTTACATGG  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGAAGGTTGGTAACGCACGTGTGAGGGCACATCAACACGTTACATGG  1042

seq1  GTGGAGCGTCCCTTCCAGAAAGCGCTGCTTCGTTTCAGAAATGTGAATTC  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAGCGTCCCTTCCAGAAAGCGCTGCTTCGTTTCAGAAATGTGAATTC  1092

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information