MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-243J12
Chromosome	10 (Build37)
Map Location	60,063,897 - 60,199,792
singlet/doublet	doublet
Overlap gene	Cdh23, Slc29a3
Upstream gene	LOC100039225, Cbara1, EG664907, LOC664936, Dnajb12, Ddit4, D10Ertd641e, Ascc1, Spock2, Chst3, LOC100039080, Psap, 4632428N05Rik
Downstream gene	Unc5b, Pcbd1, Sgpl1, 1700021K02Rik, Adamts14, Prf1, EG237361, X99384, Nodal, Eif4ebp2, D830039M14Rik, Lrrc20, Npffr1, Ppa1, Sar1a, Tysnd1, Aifm2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cbara1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216001 MGI:2384909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664907 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664907 MGI:3647495
definition	note : predicted gene, EG664907 pseudo : _no_value

name	LOC664936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 9 Proteins pseudo : _no_value

name	Dnajb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56709 MGI:1931881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddit4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74747 MGI:1921997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D10Ertd641e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52717 MGI:1289325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ascc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69090 MGI:1916340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spock2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94214 MGI:1891351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53374 MGI:1858224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Psap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19156 MGI:97783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22295 MGI:1890219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632428N05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74048 MGI:1921298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc29a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71279 MGI:1918529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107449 MGI:894703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13180 MGI:94873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20397 MGI:1261415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65971 MGI:1923820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 6 mRNAs

name	Adamts14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237360 MGI:2179942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18646 MGI:97551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG237361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237361 MGI:3645354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 674 ESTs, 8 Proteins

name	X99384 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27355 MGI:1351623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nodal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18119 MGI:97359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4ebp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13688 MGI:109198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830039M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320949 MGI:2445111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs

name	Lrrc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216011 MGI:2387182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npffr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237362 MGI:2685082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 Proteins

name	Ppa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67895 MGI:97831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sar1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20224 MGI:98230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tysnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71767 MGI:1919017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 5 Proteins

name	Aifm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71361 MGI:1918611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100039225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260896 GeneID:100039225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039225 transcript_id : XM_001472485.1

name	Cbara1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130037 GeneID:216001 MGI:2384909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding atopy-related autoantigen 1 transcript_id : NM_144822.2

name	Dnajb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982700 GeneID:56709 MGI:1931881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 12 transcript_id : NM_019965.2

name	Ddit4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348052 GeneID:74747 MGI:1921997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA-damage-inducible transcript 4 transcript_id : NM_029083.2

name	D10Ertd641e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130312 GeneID:52717 MGI:1289325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, ERATO Doi 641, expressed transcript_id : NM_025514.2

name	Ascc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037140 GeneID:69090 MGI:1916340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating signal cointegrator 1 complex subunit 1 transcript_id : NM_026937.1

name	Spock2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254122 GeneID:94214 MGI:1891351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2 transcript_id : NM_052994.2

name	Chst3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328238 GeneID:53374 MGI:1858224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate (chondroitin 6/keratan) sulfotransferase 3 transcript_id : NM_016803.2

name	Psap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328184 GeneID:19156 MGI:97783
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prosaposin transcript_id : NM_011179.2

name	Cdh23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517679 GeneID:22295 MGI:1890219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 23 (otocadherin) transcript_id : NM_023370.2

name	4632428N05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349860 GeneID:74048 MGI:1921298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632428N05 gene transcript_id : NM_028732.3

name	Slc29a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347496 GeneID:71279 MGI:1918529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 29 (nucleoside transporters), member 3 transcript_id : NM_023596.3

name	Unc5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861261 GeneID:107449 MGI:894703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-5 homolog B (C. elegans) transcript_id : NM_029770.2

name	Pcbd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892664 GeneID:13180 MGI:94873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 transcript_id : NM_025273.2

name	Sgpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543693 GeneID:20397 MGI:1261415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine phosphate lyase 1 transcript_id : NM_009163.2

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079690 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017433.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079688 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017419.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079698 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017441.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079694 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_023064.3

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079696 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017409.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079692 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017407.1

name	Adamts14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487464 GeneID:237360 MGI:2179942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 transcript_id : NM_001081127.1

name	Prf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34808711 GeneID:18646 MGI:97551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : perforin 1 (pore forming protein) transcript_id : NM_011073.2

name	EG237361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388218 GeneID:237361 MGI:3645354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 674 ESTs, 8 Proteins product : predicted gene, EG237361 transcript_id : XM_137118.7

name	X99384 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305364 GeneID:27355 MGI:1351623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence X99384 transcript_id : NM_013753.1

name	Nodal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62996442 GeneID:18119 MGI:97359
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nodal transcript_id : NM_013611.3

name	Eif4ebp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129916 GeneID:13688 MGI:109198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E binding protein 2 transcript_id : NM_010124.2

name	Lrrc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956307 GeneID:216011 MGI:2387182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 20 transcript_id : NM_153542.1

name	Npffr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82933095 GeneID:237362 MGI:2685082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 Proteins product : neuropeptide FF receptor 1 transcript_id : XM_137119.4

name	Ppa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802132 GeneID:67895 MGI:97831
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrophosphatase (inorganic) 1 transcript_id : NM_026438.3

name	Sar1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130548 GeneID:20224 MGI:98230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAR1 gene homolog A (S. cerevisiae) transcript_id : NM_009120.2

name	Tysnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388223 GeneID:71767 MGI:1919017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 5 Proteins product : trypsin domain containing 1, transcript variant 1 transcript_id : XM_125636.3

name	Aifm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359615 GeneID:71361 MGI:1918611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 2 transcript_id : NM_001039194.2

name	Aifm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130271 GeneID:71361 MGI:1918611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 2 transcript_id : NM_178058.3

name	Aifm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418884 GeneID:71361 MGI:1918611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 2 transcript_id : NM_153779.1

name	LOC100039225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260897 GeneID:100039225
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472535.1

name	Cbara1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450201 GeneID:216001 MGI:2384909
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calcium binding atopy-related autoantigen 1 protein_id : NP_659071.1

name	Dnajb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982701 CCDS:CCDS23867.1 GeneID:56709 MGI:1931881
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : DnaJ homolog 10 product : DnaJ (Hsp40) homolog, subfamily B, member 12 protein_id : NP_064349.2

name	Ddit4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312868 CCDS:CCDS23868.1 GeneID:74747 MGI:1921997
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : dexamethasone-induced gene 2 product : HIF-1 responsive RTP801 protein_id : NP_083359.1

name	D10Ertd641e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384936 CCDS:CCDS23869.1 GeneID:52717 MGI:1289325
definition	codon_start : 1 product : hypothetical protein LOC52717 protein_id : NP_079790.1

name	Ascc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037141 CCDS:CCDS23870.1 GeneID:69090 MGI:1916340
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating signal cointegrator 1 complex subunit 1 protein_id : NP_081213.1

name	Spock2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16506279 GeneID:94214 MGI:1891351
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence ISS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0007416 - synaptogenesis [Evidence ISS] codon_start : 1 note : testican-2; granule cell antiserum positive 26 product : sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2 protein_id : NP_443720.1

name	Chst3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949014 CCDS:CCDS23871.1 GeneID:53374 MGI:1858224
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008459 - chondroitin 6-sulfotransferase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : chondroitin 6-sulfotransferase product : carbohydrate (chondroitin 6/keratan) sulfotransferase 3 protein_id : NP_058083.1

name	Psap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328185 GeneID:19156 MGI:97783
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : snoRNA MBII-198 product : prosaposin protein_id : NP_035309.2

name	Cdh23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517680 GeneID:22295 MGI:1890219
definition	GO_component : GO:0005932 - basal body [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0001917 - photoreceptor inner segment [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0016339 - calcium-dependent cell-cell adhesion [Evidence ISS]; GO:0007155 - cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0048839 - inner ear development [Evidence IMP]; GO:0048563 - post-embryonic organ morphogenesis [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IMP]; GO:0050953 - sensory perception of light stimulus [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IGI] codon_start : 1 note : otocadherin; bustling; waltzer; modifier of deaf waddler; age related hearing loss 1; bobby product : cadherin 23 protein_id : NP_075859.2

name	4632428N05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386340 GeneID:74048 MGI:1921298
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : Gi24 receptor product : Gi24 receptor precursor protein_id : NP_083008.1

name	Slc29a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963743 GeneID:71279 MGI:1918529
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : equilibrative nucleoside transporter 3 protein_id : NP_076085.1

name	Unc5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861262 CCDS:CCDS23872.1 GeneID:107449 MGI:894703
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : unc5 homolog (C. elegans) 2 product : unc-5 homolog B protein_id : NP_084046.2

name	Pcbd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384608 GeneID:13180 MGI:94873
definition	GO_component : GO:0005634 - nucleus [Evidence IPI] GO_function : GO:0008124 - 4-alpha-hydroxytetrahydrobiopterin dehydratase activity [Evidence IEA]; GO:0004505 - phenylalanine 4-monooxygenase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051291 - protein heterooligomerization [Evidence IPI]; GO:0051289 - protein homotetramerization [Evidence IPI] codon_start : 1 note : dimerization cofactor of hepatocyte nuclear factor-1-alpha; 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) product : pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 protein_id : NP_079549.1

name	Sgpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543694 GeneID:20397 MGI:1261415
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0008117 - sphinganine-1-phosphate aldolase activity [Evidence IEA] [Evidence ISS]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0019752 - carboxylic acid metabolism [Evidence IEA]; GO:0006672 - ceramide metabolism [Evidence ISS]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0030149 - sphingolipid catabolism [Evidence ISS] codon_start : 1 note : sphingosine-1-phosphate lyase 1 product : sphingosine phosphate lyase 1 protein_id : NP_033189.2

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079691 CCDS:CCDS23873.1 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 1 protein_id : NP_001017433.1

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079689 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 2 protein_id : NP_001017419.1

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079695 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 3 is encoded by transcript variant 3; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 3 protein_id : NP_075551.3 transl_except : (pos:60638093..60638095,aa:Met)

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079693 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 5 is encoded by transcript variant 5; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 5 protein_id : NP_001017407.1 transl_except : (pos:60638093..60638095,aa:Met)

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079699 CCDS:CCDS23874.1 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 4 is encoded by transcript variant 4; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 4 protein_id : NP_001017441.1 transl_except : (pos:60638093..60638095,aa:Met)

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079697 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 6 is encoded by transcript variant 6; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 6 protein_id : NP_001017409.1 transl_except : (pos:60638093..60638095,aa:Met)

name	Adamts14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487465 GeneID:237360 MGI:2179942
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0017074 - procollagen N-endopeptidase activity [Evidence IDA] GO_process : GO:0030199 - collagen fibril organization [Evidence IDA] codon_start : 1 note : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14 product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 protein_id : NP_001074596.1

name	Prf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34808712 CCDS:CCDS23875.1 GeneID:18646 MGI:97551
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : pore forming protein product : perforin 1 protein_id : NP_035203.2

name	EG237361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933068 GeneID:237361 MGI:3645354
definition	codon_start : 1 product : similar to ribosomal protein L27a-like protein_id : XP_137118.4

name	X99384 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305365 CCDS:CCDS23877.1 GeneID:27355 MGI:1351623
definition	codon_start : 1 exception : mismatches in translation product : paladin protein_id : NP_038781.1

name	Nodal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305317 CCDS:CCDS23878.1 GeneID:18119 MGI:97359
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0016477 - cell migration [Evidence IMP]; GO:0042074 - cell migration involved in gastrulation [Evidence IDA]; GO:0007368 - determination of left/right symmetry [Evidence IMP] [Evidence IGI] [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0001947 - heart looping [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0002085 - repression of premature neural plate formation [Evidence IMP]; GO:0019827 - stem cell maintenance [Evidence IMP] [Evidence IGI]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence ISS] codon_start : 1 exception : mismatches in translation note : early embryo mesoderm formation; transgenic lethal 413.d product : nodal protein_id : NP_038639.1

name	Eif4ebp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753742 CCDS:CCDS23879.1 GeneID:13688 MGI:109198
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008190 - eukaryotic initiation factor 4E binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0019933 - cAMP-mediated signaling [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045947 - negative regulation of translational initiation [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence TAS] codon_start : 1 product : eukaryotic translation initiation factor 4E binding protein 2 protein_id : NP_034254.1

name	Lrrc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956308 CCDS:CCDS23881.1 GeneID:216011 MGI:2387182
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 20 protein_id : NP_705770.1

name	Npffr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933096 GeneID:237362 MGI:2685082
definition	codon_start : 1 product : similar to RFamide-related peptide receptor protein_id : XP_137119.4

name	Ppa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754065 CCDS:CCDS23882.1 GeneID:67895 MGI:97831
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016462 - pyrophosphatase activity [Evidence IDA] GO_process : GO:0006796 - phosphate metabolism [Evidence IC] codon_start : 1 product : pyrophosphatase protein_id : NP_080714.2

name	Sar1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703344 CCDS:CCDS23883.1 GeneID:20224 MGI:98230
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0016529 - sarcoplasmic reticulum [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 note : SAR1a gene homolog 1 product : SAR1a gene homolog protein_id : NP_033146.1

name	Tysnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260906 GeneID:71767 MGI:1919017
definition	codon_start : 1 product : trypsin domain containing 1 isoform 1 protein_id : XP_125636.3

name	Aifm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418885 GeneID:71361 MGI:1918611
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence ISS]; GO:0050660 - FAD binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death product : apoptosis-inducing factor (AIF)-like mitchondrion-associated inducer of death isoform 1 protein_id : NP_722474.1

name	Aifm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861162 CCDS:CCDS23884.1 GeneID:71361 MGI:1918611
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence ISS]; GO:0050660 - FAD binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death product : apoptosis-inducing factor (AIF)-like mitchondrion-associated inducer of death isoform 2 protein_id : NP_001034283.1

name	Aifm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017355 CCDS:CCDS23884.1 GeneID:71361 MGI:1918611
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence ISS]; GO:0050660 - FAD binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death product : apoptosis-inducing factor (AIF)-like mitchondrion-associated inducer of death isoform 2 protein_id : NP_835159.1

name	LOC100039080 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039080
definition	number : 3 pseudo : _no_value

name	LOC100039080 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039080
definition	number : 2 pseudo : _no_value

name	LOC100039080 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039080
definition	number : 1 pseudo : _no_value

name	LOC664936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260890 GeneID:664936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_030603.1

name	D830039M14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260905 GeneID:320949 MGI:2445111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs product : RIKEN cDNA D830039M14 gene transcript_id : XR_035206.1

clone name	MSMg01-406F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345I09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-500H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-293N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001C05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-243J12.b	B6Ng01-243J12.g
ACC	GA052936	GA052937
length	1,138	1,119
definition	B6Ng01-243J12.b	B6Ng01-243J12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(60,063,897 - 60,065,022)	(60,198,700 - 60,199,792)
sequence	gaattctcatttcactttgtctctcgaatgcttaggagtggatctgctaa gctatagatttactccacattaaacttattgagacgtcatcccatggcct tggatggtgcctgcactattttctgttcccaccagcagtggctaaaactg gagttcttgttcgtggtagggcatccagggattcacagttcctggaggtt ctgatgatggtgtgaaaggggctgggaagatgatcacagcagcttcagtt gatactgtgtctccctcggtgcagcacacaccccagcctagcctccaacg gtcagactccacagttctttgccagagtcagctcatgcaacacacaggcc agaaggaccagggaactgattgatacccctggtgttgggactcagtgacg ggccgtggacggtgacaaagataaatgctgtggtctcagtgtgccctcta aagcttgtgagttagaagctaacccctatctcctaattgctgccactggg ggatgaggccttcaggaagcagtcagaaaccagacggggtgaggcccgtg caaaggcactaacggcttcacaagaagttgatagccctgagctagcactt tgtctctctcaccacattcatcatcgtgatatgatgcggggtgaagaccc tcaccatatatgggcaccagcctccagaactgcgctatgaacctcccttc tttataagttagccagtccgtgtggttactctattacagcggcaggaatt ccaaccttccttgcctcatatccctgcccctttcccagggttcctgccct ctcaccttagtcaaccacctggctatgatgctgtggacaatcacccaggc tcctttcataccatcattagagccccccagcacctgtcaatcactggacg tcctaccacgaacaagaacgccagctctcaatcaatccatcacaaggtct gtttctgagaaaaaaccccaaaggcgtgcatcttgagcccatgggtgaat gcttgctactgccggacgctgctggttccagctggcttggtgggggtgct tagacacaacttcctagaccagtgtcccctcttcctctcttcagagacgg attgttgcagcatgttatagaagcccctagaagtggtt	gaattccatttgaagagtggtcctctggttcctggctttcacaccggagg acagcagatgaaaatggctctccttatcacactgccagtgaagcacgtac cccctgccctggctaggagtggcctgtgcacactcatgggccactgggag actgctggtaccagctactcctcaaccaggctctgtccatagttgggggt ctgtcacttacctaccttggaggtttagggggtgctgacgccatcgggaa gaaggttggaaatctgcccactgctgttcaccatgctaccctcaatccag catggttttgtggtgccgggcacagagtgtagggtctcacatatgccagg caagcactcggccaccgagccacactccagcccatctgtcctcttgaaag taatctctgcttgaccactcaccacttccatctatcccctggggccaata gaggcaagagttttctttttaacactgtgtagagctcttagcctgtgtaa atacccattgtacgaggagagacagtgcctacattcctggtcaccccaca gacaaagaggagaggtatcaagccccaacatttgctgccttggggcagaa gaatatgacagtccctataggaagagtgtgacttgcatagatcgtctgca agagcctcttgaaagacttgtcttgtaagggtccataattcgccaaagaa tgataccccatgattcgccaaagaatgatacccctgactaaaaatagtat gtaaccgtaaagagtgttttagaatgctgcagaaagtctagcatgttggg gtctcccatttaccaagacagagagacaaccaagtgagcttgcaggcctg atttaaagcacattagggaattctgggggtaggtgatctctatgttaatc tgttggggtcccagttctatggacattcccattaccaggatgtggggggc ctggaaacttggctagggaagtcttggatactgtggcttgaaggaagtag ctgaaggaagtctggggaatggtctgcttgacctccattgtcccttggcc tcagggccaggtggtgggggcagcttgagacctgaagctgccttggcctt gaacttgcccaagttcttg
quality values	Open. Hide. 58 31 27 38 62 52 62 41 23 54 62 62 24 20 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 41 41 19 31 28 27 32 43 43 44 32 54 54 59 62 59 62 62 62 62 54 62 62 62 62 59 62 62 62 62 59 62 62 59 54 62 59 62 59 62 62 62 62 62 42 62 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 59 59 62 62 62 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 56 62 62 47 51 31 38 50 56 62 62 62 62 62 47 51 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 47 39 62 62 54 54 44 46 46 62 62 54 46 58 58 52 52 52 52 52 58 58 58 54 58 58 58 58 58 54 52 58 52 54 58 58 58 58 54 45 42 58 42 41 41 52 54 58 54 52 58 58 48 58 54 54 54 54 54 58 54 54 58 52 54 54 54 49 54 52 54 52 58 58 54 58 58 58 51 54 51 51 51 47 47 58 58 49 40 58 58 48 50 58 52 51 58 58 58 58 58 58 58 54 58 53 58 50 49 42 41 42 53 53 58 58 41 46 58 49 49 58 51 58 52 58 28 37 40 54 58 54 35 58 58 58 58 58 58 51 58 58 50 37 54 37 50 50 58 52 52 50 48 50 53 53 53 52 51 58 58 50 50 34 16 41 39 39 46 49 54 42 52 36 40 58 30 50 58 51 58 49 51 52 39 50 51 58 43 44 54 51 34 27 39 52 53 42 49 49 44 49 40 40 54 40 54 46 53 37 34 39 25 53 52 49 54 52 53 54 33 39 46 41 46 25 21 47 37 47 38 54 45 38 44 42 37 45 28 30 33 37 33 54 33 39 37 44 37 51 33 45 33 52 54 51 32 53 35 46 42 32 53 45 25 30 45 45 45 30 51 49 33 47 32 40 40 33 33 49 32 24 47 38 31 31 53 49 28 42 31 47 21 16 13 9 8 6 29 4 7 5 6 15 23 51 43 26 30 31 29 27 31 33 37 43 31 30 30 51 33 30 30 31 34 36 22 35 39 43 31 31 51 46 31 30 24 33 27 30 28 22 29 24 25 26 46 31 43 31 12 10 47 33 34 31 31 18 12 25 26 43 32 32 35 31 28 31 31 27 38 41 36 41 33 25 19 28 21 22 19 14 30 41 31 27 25 25 41 35 31 32 31 29 25 34 26 25 31 31 34 33 33 20 29 15 27 18 38 26 17 18 27 17 44 26 33 24 28 33 19 25 13 6 12 29 32 22 25 34 22 27 16 27 16 31 29 27 32 20 20 15 14 23 25 8 16 27 20 18 43 28 27 31 25 37 7 6 43 36 31 31 18 12 24 21 10 14 31 13 14 23 19 23 15 27 34 21 34 15 9 14 12 37 14 15 31 12 29 13 14 39 17 8 21 19 30 32 33 7 4 20 16 18 28 11 28 27 19 10 11 17 6 3 9 6 9 9 13 29 27 14 20 7 9 16 14 16 19 14 27 16 18 7 7 14 28 26 14 20 21 9 17 7 3 6 11 9 8 7 4 4 12 13 17 7 16 3 9 7 7 22 6 7 6 6 7 6 10 4 4 3 2 5 25 28 12 4 8 7 5 5 7 12 5 7 11 16 20 8 4 3 2 1 2 4 12 15 9 6 5 16 5 4 4 4 8 7 24 4 11 9 4 3 9 8 9 8 11 17 7 17 26 24 20 4 13 4 5 6 3 4 4 10 17 11	Open. Hide. 62 47 34 44 62 62 47 33 62 62 62 24 30 26 18 28 22 34 34 24 28 45 49 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 59 59 62 59 51 62 62 62 59 43 59 59 38 42 48 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 59 62 62 62 59 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 54 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 56 56 62 54 49 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 56 56 56 46 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 48 62 52 47 42 62 58 54 58 54 58 54 52 52 52 54 54 54 54 54 58 58 58 58 49 54 58 58 58 54 58 58 53 58 54 48 47 47 52 58 39 58 58 39 58 42 43 54 54 54 58 52 52 52 48 48 52 36 41 52 43 50 54 58 58 58 58 58 58 40 58 58 54 58 58 58 58 51 54 52 58 54 27 58 40 52 53 51 49 58 50 51 50 51 52 47 41 48 51 49 47 22 49 58 58 50 58 40 51 58 53 53 49 50 58 51 58 49 46 51 41 52 53 52 51 50 50 52 50 51 42 27 50 50 58 30 48 51 53 46 58 53 53 51 58 50 50 51 31 51 41 58 49 50 51 51 58 33 40 52 39 58 35 37 39 50 34 50 39 50 50 58 41 37 46 31 23 31 39 33 51 28 33 53 42 41 39 39 50 42 50 42 53 47 43 50 35 35 29 31 51 32 51 39 33 54 34 40 52 47 37 32 42 39 31 28 28 28 29 25 42 42 54 54 54 50 53 53 32 42 42 39 50 38 26 46 29 42 33 31 40 47 35 31 26 18 42 51 23 54 54 34 40 31 34 41 32 41 34 53 47 37 40 14 44 54 18 12 30 34 32 32 24 34 32 32 53 41 33 32 46 49 40 27 32 32 26 25 27 16 31 33 26 22 15 19 12 31 26 36 31 32 28 33 28 36 31 39 37 29 32 28 40 27 33 26 36 39 45 21 42 45 33 45 30 31 31 41 42 34 36 31 12 10 37 26 15 30 31 26 42 30 30 30 44 28 14 9 33 18 33 33 40 26 33 34 32 46 47 48 42 31 42 14 48 25 31 30 27 37 31 31 10 13 31 42 19 29 31 31 31 26 31 33 20 11 7 46 41 27 31 38 46 41 31 23 31 9 9 15 16 23 36 38 23 15 11 25 33 18 29 16 16 9 26 9 9 21 17 12 8 7 13 16 16 31 38 41 25 18 25 5 8 25 23 18 8 12 24 9 6 33 11 10 24 23 29 19 31 17 16 6 7 8 10 5 14 23 4 4 5 16 14 21 9 6 13 19 7 22 14 22 22 16 8 23 30 33 6 4 7 16 21 32 31 19 18 9 13 10 19 10 28 20 20 22 38 21 17 10 18 19 11 27 7 9 13 28 19 12 9 5 9 7 21 5 5 7 20 32 17 27 8 8 34 7 16 21 7 13 28 15 6 8 16 12 28 14 6 21 9 6 3 6 17 18 4 6 28 28 19 19 18 13 3 10 15 4 2 2 4 15 5 6 10 12 7 18 4 15 4 6 7 9 14 16 7 6 16 9 7 9 14 14 10 18 5 16 7 16 27 15 5 11 6 3 5 5 9 19 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_60063897_60065022
seq2: B6Ng01-243J12.b_46_1183

seq1  GAATTCTCATTTCACTTTGTCTCTCGAATGCTTAGGAGTGGATCTGCTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCATTTCACTTTGTCTCTCGAATGCTTAGGAGTGGATCTGCTAA  50

seq1  GCTATAGATTTACTCCACATTAAACTTATTGAGACGTCATCCCATGGCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATAGATTTACTCCACATTAAACTTATTGAGACGTCATCCCATGGCCT  100

seq1  TGGATGGTGCCTGCACTATTTTCTGTTCCCACCAGCAGTGGCTAAAACTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATGGTGCCTGCACTATTTTCTGTTCCCACCAGCAGTGGCTAAAACTG  150

seq1  GAGTTCTTGTTCGTGGTAGGGCATCCAGGGATTCACAGTTCCTGGAGGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCTTGTTCGTGGTAGGGCATCCAGGGATTCACAGTTCCTGGAGGTT  200

seq1  CTGATGATGGTGTGAAAGGGGCTGGGAAGATGATCACAGCAGCTTCAGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATGATGGTGTGAAAGGGGCTGGGAAGATGATCACAGCAGCTTCAGTT  250

seq1  GATACTGTGTCTCCCTCGGTGCAGCACACACCCCAGCCTAGCCTCCAACG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATACTGTGTCTCCCTCGGTGCAGCACACACCCCAGCCTAGCCTCCAACG  300

seq1  GTCAGACTCCACAGTTCTTTGCCAGAGTCAGCTCATGCAACACACAGGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGACTCCACAGTTCTTTGCCAGAGTCAGCTCATGCAACACACAGGCC  350

seq1  AGAAGGACCAGGGAACTGATTGATACCCCTGGTGTTGGGACTCAGTGACG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGGACCAGGGAACTGATTGATACCCCTGGTGTTGGGACTCAGTGACG  400

seq1  GGCCGTGGACGGTGACAAAGATAAATGCTGTGGTCTCAGTGTGCCCTCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCGTGGACGGTGACAAAGATAAATGCTGTGGTCTCAGTGTGCCCTCTA  450

seq1  AAGCTTGTGAGTTAGAAGCTAACCCCTATCTCCTAATTGCTGCCACTGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTTGTGAGTTAGAAGCTAACCCCTATCTCCTAATTGCTGCCACTGGG  500

seq1  GGATGAGGCCTTCAGGAAGCAGTCAGAAACCAGACGGGGTGAGGCCCGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGAGGCCTTCAGGAAGCAGTCAGAAACCAGACGGGGTGAGGCCCGTG  550

seq1  CAAAGGCACTAACGGCTTCACAAGAAGTTGATAGCCCTGAGCTAGCACTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGCACTAACGGCTTCACAAGAAGTTGATAGCCCTGAGCTAGCACTT  600

seq1  TGTCTCTCTCACCACATTCATCATCGTGATATGATGCGGGGTGAAGACCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTCTCACCACATTCATCATCGTGATATGATGCGGGGTGAAGACCC  650

seq1  TCACCATATATGGGCACCAGCCTCCAGAACTGCGCTATGAACCTCCCTTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCATATATGGGCACCAGCCTCCAGAACTGCGCTATGAACCTCCCTTC  700

seq1  TTTATAAGTTAGCCAGTCCGTGTGGTTACTCTATTACAGCGGCAGGAATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATAAGTTAGCCAGTCCGTGTGGTTACTCTATTACAGCGGCAGGAATT  750

seq1  CCAACCTTCCTTGCCTCATATCCCTGCCCCTTTCCCAGGGTTCCTGGGCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||  ||
seq2  CCAACCTTCCTTGCCTCATATCCCTGCCCCTTTCCCAGGGTTCCTGCCCT  800

seq1  CTCCCCTTAGTCAACCACCTGGCTATGATGCTGTGGACAATCACCCAGGC  850
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACCTTAGTCAACCACCTGGCTATGATGCTGTGGACAATCACCCAGGC  850

seq1  TCCTTTCATACCATCATTAGAGCCCCCCAGCACCTGTCAATCACTGGACG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTCATACCATCATTAGAGCCCCCCAGCACCTGTCAATCACTGGACG  900

seq1  TCCTACCACGAACAAGAACGCCAGC-CTCAATCAATCCATCACAAGGTCT  949
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TCCTACCACGAACAAGAACGCCAGCTCTCAATCAATCCATCACAAGGTCT  950

seq1  GTTTCTGAG-AAAAACCCCAAAGGCGTGCATC-TGAG-CCAT-GGTGAAT  995
      ||||||||| |||||||||||||||||||||| |||| |||| |||||||
seq2  GTTTCTGAGAAAAAACCCCAAAGGCGTGCATCTTGAGCCCATGGGTGAAT  1000

seq1  GCTTGCTACTGCGGGACGCTGCTGG-TCCAGCTGGC-TGGT-GGGGTGCT  1042
      |||||||||||| |||||||||||| |||||||||| |||| ||||||||
seq2  GCTTGCTACTGCCGGACGCTGCTGGTTCCAGCTGGCTTGGTGGGGGTGCT  1050

seq1  AAGGACACAAACTCCTAGA-CAGTGTCCCCTCCT-CTCTCTTCAGGAGAC  1090
       | |||||||  ||||||| |||||||||||| | ||||||||| |||||
seq2  TA-GACACAACTTCCTAGACCAGTGTCCCCTCTTCCTCTCTTCA-GAGAC  1098

seq1  GGAT--GTGCAGCCATG-TATAGAAGCCCC-AG-AGTGGTT  1126
      ||||   ||||| |||| |||||||||||| || |||||||
seq2  GGATTGTTGCAG-CATGTTATAGAAGCCCCTAGAAGTGGTT  1138

seq1: chr10_60198700_60199792
seq2: B6Ng01-243J12.g_66_1184 (reverse)

seq1  CAAGAAC-TGGGCAAG-TCCAGGC--AAGCAGC-TCAGGTCTCAAAAGCT  45
      ||||||| |||||||| || ||||  | ||||| |||||||||  |||||
seq2  CAAGAACTTGGGCAAGTTCAAGGCCAAGGCAGCTTCAGGTCTC--AAGCT  48

seq1  G--CCCACCACCTGG-CCTGAGGC--AAGGACAATG--GGTC-AGCAG-C  86
      |  |||||||||||| ||||||||  | ||||||||  |||| ||||| |
seq2  GCCCCCACCACCTGGCCCTGAGGCCAAGGGACAATGGAGGTCAAGCAGAC  98

seq1  CA-TCCCCAGACTTCC-TCAGCTACTTCCT--CAGCCACAGTTTCC-AGA  131
      || ||||||||||||| |||||||||||||   ||||||||| ||| |||
seq2  CATTCCCCAGACTTCCTTCAGCTACTTCCTTCAAGCCACAGTATCCAAGA  148

seq1  CTTCCCTAG-CAAGTTTCCAG--CCCCCACATCCTGGTAAT-GGAATGTC  177
      ||||||||| |||||||||||  |||||||||||||||||| ||||||||
seq2  CTTCCCTAGCCAAGTTTCCAGGCCCCCCACATCCTGGTAATGGGAATGTC  198

seq1  CATAG-ACTGGGA-CCCAACAGATTAACATAGAGATCACCTA-CCCCAGA  224
      ||||| ||||||| |||||||||||||||||||||||||||| |||||||
seq2  CATAGAACTGGGACCCCAACAGATTAACATAGAGATCACCTACCCCCAGA  248

seq1  ATTCCCTAATGTGCTTTAAATCAGGCCTGCAAGCTCACTTGGTTGTCTCT  274
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCCTAATGTGCTTTAAATCAGGCCTGCAAGCTCACTTGGTTGTCTCT  298

seq1  CTGTCTTGGT-AATGGGAGACCCCAACATGCTAGAC-TTCTGCAGCATTC  322
      |||||||||| ||||||||||||||||||||||||| |||||||||||||
seq2  CTGTCTTGGTAAATGGGAGACCCCAACATGCTAGACTTTCTGCAGCATTC  348

seq1  TAAAACACTCTTTACGGTTACATACTATTTTTAGTCAGGGGTATCATTCT  372
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACACTCTTTACGGTTACATACTATTTTTAGTCAGGGGTATCATTCT  398

seq1  TTGGCGAATCATGGGGTATCATTCTTTGGCGAATTATGGACCCTTACAAG  422
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCGAATCATGGGGTATCATTCTTTGGCGAATTATGGACCCTTACAAG  448

seq1  ACAAGTCTTTCAAGAGGCTCTTGCAGACGATCTATGCAAGTCACACTCTT  472
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTCTTTCAAGAGGCTCTTGCAGACGATCTATGCAAGTCACACTCTT  498

seq1  CCTATAGGGACTGTCATATTCTTCTGCCCCAAGGCAGCAAATGTTGGGGC  522
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATAGGGACTGTCATATTCTTCTGCCCCAAGGCAGCAAATGTTGGGGC  548

seq1  TTGATACCTCTCCTCTTTGTCTGTGGGGTGACCAGGAATGTAGGCACTGT  572
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATACCTCTCCTCTTTGTCTGTGGGGTGACCAGGAATGTAGGCACTGT  598

seq1  CTCTCCTCGTACAATGGGTATTTACACAGGCTAAGAGCTCTACACAGTGT  622
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCCTCGTACAATGGGTATTTACACAGGCTAAGAGCTCTACACAGTGT  648

seq1  TAAAAAGAAAACTCTTGCCTCTATTGGCCCCAGGGGATAGATGGAAGTGG  672
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAAGAAAACTCTTGCCTCTATTGGCCCCAGGGGATAGATGGAAGTGG  698

seq1  TGAGTGGTCAAGCAGAGATTACTTTCAAGAGGACAGATGGGCTGGAGTGT  722
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTGGTCAAGCAGAGATTACTTTCAAGAGGACAGATGGGCTGGAGTGT  748

seq1  GGCTCGGTGGCCGAGTGCTTGCCTGGCATATGTGAGACCCTACACTCTGT  772
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCGGTGGCCGAGTGCTTGCCTGGCATATGTGAGACCCTACACTCTGT  798

seq1  GCCCGGCACCACAAAACCATGCTGGATTGAGGGTAGCATGGTGAACAGCA  822
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCGGCACCACAAAACCATGCTGGATTGAGGGTAGCATGGTGAACAGCA  848

seq1  GTGGGCAGATTTCCAACCTTCTTCCCGATGGCGTCAGCACCCCCTAAACC  872
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGCAGATTTCCAACCTTCTTCCCGATGGCGTCAGCACCCCCTAAACC  898

seq1  TCCAAGGTAGGTAAGTGACAGACCCCCAACTATGGACAGAGCCTGGTTGA  922
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAGGTAGGTAAGTGACAGACCCCCAACTATGGACAGAGCCTGGTTGA  948

seq1  GGAGTAGCTGGTACCAGCAGTCTCCCAGTGGCCCATGAGTGTGCACAGGC  972
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTAGCTGGTACCAGCAGTCTCCCAGTGGCCCATGAGTGTGCACAGGC  998

seq1  CACTCCTAGCCAGGGCAGGGGGTACGTGCTTCACTGGCAGTGTGATAAGG  1022
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCTAGCCAGGGCAGGGGGTACGTGCTTCACTGGCAGTGTGATAAGG  1048

seq1  AGAGCCATTTTCATCTGCTGTCCTCCGGTGTGAAAGCCAGGAACCAGAGG  1072
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCATTTTCATCTGCTGTCCTCCGGTGTGAAAGCCAGGAACCAGAGG  1098

seq1  ACCACTCTTCAAATGGAATTC  1093
      |||||||||||||||||||||
seq2  ACCACTCTTCAAATGGAATTC  1119

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information