MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-308N24
Chromosome	10 (Build37)
Map Location	40,078,880 - 40,235,679
singlet/doublet	doublet
Overlap gene	Cdc2l6, LOC666374
Upstream gene	Fyn, LOC629337, Traf3ip2, LOC667964, EG667970, E130307A14Rik, Rev3l, EG666304, LOC213332, 4930547M16Rik, LOC667982, 2010001E11Rik, LOC667994, LOC100041085, BC021785, AI317395, EG666342, Slc16a10, Bxdc1, 2410016F19Rik, Amd1, Amd2, LOC668051
Downstream gene	Slc22a16, Ddo, 9030224M15Rik, Cdc40, Wasf1, Gpr6, A530089I17Rik, LOC633979, Zbtb24, Mical1, Smpd2, Ppil6
Link	Open Mouse BAC browser

Click to get alignment info.

name	Fyn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14360 MGI:95602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	Traf3ip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103213 MGI:2143599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	EG667970 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667970 MGI:3643313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	E130307A14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327744 MGI:3036287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Rev3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19714 MGI:1337131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666304 MGI:3644140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs pseudo : _no_value

name	LOC213332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:213332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 7 Proteins pseudo : _no_value

name	4930547M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75299 MGI:1922549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	LOC667982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	2010001E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72045 MGI:1919295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins

name	LOC667994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	LOC100041085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	BC021785 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215928 MGI:2446139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI317395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215929 MGI:2143575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666342 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666342 MGI:3643695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 238 ESTs, 25 Proteins

name	Slc16a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72472 MGI:1919722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bxdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67239 MGI:1914489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2410016F19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67371 MGI:1914621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11702 MGI:88004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11703 MGI:1333111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668051 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 91 ESTs, 4 Proteins pseudo : _no_value

name	Cdc2l6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78334 MGI:1925584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Slc22a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70840 MGI:1918090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70503 MGI:1925528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030224M15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327747 MGI:3045338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71713 MGI:1918963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs, 4 Proteins

name	Wasf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83767 MGI:1890563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140741 MGI:2155249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530089I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103199 MGI:2143585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC633979 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Zbtb24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268294 MGI:3039618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mical1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171580 MGI:2385847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20598 MGI:1278330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppil6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73075 MGI:1920325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	Fyn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679878 GeneID:14360 MGI:95602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fyn proto-oncogene transcript_id : NM_008054.1

name	Traf3ip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129914 GeneID:103213 MGI:2143599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Traf3 interacting protein 2 transcript_id : NM_134000.3

name	EG667970 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388034 GeneID:667970 MGI:3643313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG667970 transcript_id : XM_993616.1

name	E130307A14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260694 GeneID:327744 MGI:3036287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA E130307A14 gene transcript_id : XM_001475662.1

name	Rev3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384575 GeneID:19714 MGI:1337131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae) transcript_id : NM_011264.2

name	4930547M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260727 GeneID:75299 MGI:1922549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930547M16 gene, transcript variant 1 transcript_id : XM_001476789.1

name	4930547M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260729 GeneID:75299 MGI:1922549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930547M16 gene, transcript variant 2 transcript_id : XM_001476807.1

name	2010001E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388038 GeneID:72045 MGI:1919295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins product : RIKEN cDNA 2010001E11 gene transcript_id : XM_125582.4

name	BC021785 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802987 GeneID:215928 MGI:2446139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021785 transcript_id : NM_001001489.2

name	AI317395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365883 GeneID:215929 MGI:2143575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI317395 transcript_id : NM_144821.3

name	EG666342 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260732 GeneID:666342 MGI:3643695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 237 ESTs, 25 Proteins product : predicted gene, EG666342 transcript_id : XM_986849.2

name	Slc16a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349884 GeneID:72472 MGI:1919722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 10 transcript_id : NM_028247.2

name	Bxdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347518 GeneID:67239 MGI:1914489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brix domain containing 1 transcript_id : NM_023323.3

name	Bxdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347520 GeneID:67239 MGI:1914489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brix domain containing 1 transcript_id : NM_001042556.1

name	2410016F19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803375 GeneID:67371 MGI:1914621
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410016F19 gene transcript_id : NM_026113.3

name	Amd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130299 GeneID:11702 MGI:88004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S-adenosylmethionine decarboxylase 1 transcript_id : NM_009665.3

name	Amd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567327 GeneID:11703 MGI:1333111
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S-adenosylmethionine decarboxylase 2 transcript_id : NM_007444.2

name	Cdc2l6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383910 GeneID:78334 MGI:1925584
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 2-like 6 (CDK8-like) transcript_id : NM_198164.2

name	Slc22a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625793 GeneID:70840 MGI:1918090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 16 transcript_id : NM_027572.1

name	Ddo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801737 GeneID:70503 MGI:1925528
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D-aspartate oxidase transcript_id : NM_027442.4

name	9030224M15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371642 GeneID:327747 MGI:3045338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030224M15 gene transcript_id : NM_177793.3

name	Cdc40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94387950 GeneID:71713 MGI:1918963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs, 4 Proteins product : cell division cycle 40 homolog (yeast), transcript variant 1 transcript_id : XM_483893.3

name	Wasf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982605 GeneID:83767 MGI:1890563
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WASP family 1 transcript_id : NM_031877.2

name	Gpr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39979619 GeneID:140741 MGI:2155249
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 6 transcript_id : NM_199058.1

name	A530089I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527219 GeneID:103199 MGI:2143585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530089I17 gene transcript_id : NM_133999.1

name	Zbtb24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542229 GeneID:268294 MGI:3039618
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 24 transcript_id : NM_153398.2

name	Mical1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19923870 GeneID:171580 MGI:2385847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated monoxygenase, calponin and LIM domain containing 1 transcript_id : NM_138315.1

name	Smpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539780 GeneID:20598 MGI:1278330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 2, neutral transcript_id : NM_009213.2

name	Ppil6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94387954 GeneID:73075 MGI:1920325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : peptidylprolyl isomerase (cyclophilin)-like 6, transcript variant 1 transcript_id : XM_891672.2

name	Fyn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679879 CCDS:CCDS23788.1 GeneID:14360 MGI:95602
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0015631 - tubulin binding [Evidence IDA] GO_process : GO:0030900 - forebrain development [Evidence IGI] [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0042552 - myelination [Evidence TAS]; GO:0001764 - neuron migration [Evidence IMP] [Evidence IGI]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IDA] codon_start : 1 exception : mismatches in translation function : protein tyrosine kinase note : Src Kinase p59 product : protein-tyrosine kinase fyn protein_id : NP_032080.1

name	Traf3ip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542077 CCDS:CCDS23789.1 GeneID:103213 MGI:2143599
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001783 - B cell apoptosis [Evidence IMP]; GO:0006959 - humoral immune response [Evidence IMP]; GO:0048305 - immunoglobulin secretion [Evidence IMP] codon_start : 1 product : Traf3 interacting protein 2 protein_id : NP_598761.2

name	EG667970 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388035 GeneID:667970 MGI:3643313
definition	codon_start : 1 product : hypothetical protein protein_id : XP_998710.1

name	E130307A14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260695 GeneID:327744 MGI:3036287
definition	codon_start : 1 product : hypothetical protein LOC327744 protein_id : XP_001475712.1

name	Rev3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859616 CCDS:CCDS23790.1 GeneID:19714 MGI:1337131
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like protein_id : NP_035394.1

name	4930547M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260730 GeneID:75299 MGI:1922549
definition	codon_start : 1 product : hypothetical protein LOC75299 isoform 2 protein_id : XP_001476857.1

name	4930547M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260728 GeneID:75299 MGI:1922549
definition	codon_start : 1 product : hypothetical protein LOC75299 isoform 1 protein_id : XP_001476839.1

name	2010001E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388039 GeneID:72045 MGI:1919295
definition	codon_start : 1 product : hypothetical protein LOC72045 protein_id : XP_125582.3

name	BC021785 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47894381 CCDS:CCDS23791.1 GeneID:215928 MGI:2446139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC215928 protein_id : NP_001001489.1

name	AI317395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450199 GeneID:215929 MGI:2143575
definition	codon_start : 1 product : hypothetical protein LOC215929 protein_id : NP_659070.1

name	EG666342 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94387946 GeneID:666342 MGI:3643695
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_991943.1

name	Slc16a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794382 GeneID:72472 MGI:1919722
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : solute carrier family 16 (monocarboxylic acid transporters), member 10 protein_id : NP_082523.1

name	Bxdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347519 GeneID:67239 MGI:1914489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : brix domain containing 1 isoform 1 protein_id : NP_075812.3

name	Bxdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347521 GeneID:67239 MGI:1914489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : brix domain containing 1 isoform 2 protein_id : NP_001036021.1

name	2410016F19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754091 CCDS:CCDS23794.1 GeneID:67371 MGI:1914621
definition	codon_start : 1 product : hypothetical protein LOC67371 protein_id : NP_080389.2

name	Amd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567326 GeneID:11702 MGI:88004
definition	GO_function : GO:0004014 - adenosylmethionine decarboxylase activity [Evidence IDA]; GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0008295 - spermidine biosynthesis [Evidence IDA]; GO:0006597 - spermine biosynthesis [Evidence IDA] codon_start : 1 product : S-adenosylmethionine decarboxylase 1 protein_id : NP_033795.1

name	Amd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567328 GeneID:11703 MGI:1333111
definition	GO_function : GO:0004014 - adenosylmethionine decarboxylase activity [Evidence IDA]; GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0008295 - spermidine biosynthesis [Evidence IEA]; GO:0006597 - spermine biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : S-adenosylmethionine decarboxylase 2 protein_id : NP_031470.2

name	Cdc2l6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718981 CCDS:CCDS23795.1 GeneID:78334 MGI:1925584
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cyclin-dependent kinase (CDC2-like) 11 protein_id : NP_937807.1

name	Slc22a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625794 CCDS:CCDS23796.1 GeneID:70840 MGI:1918090
definition	codon_start : 1 note : carnitine transporter 2 product : solute carrier family 22 (organic cation transporter), member 16 protein_id : NP_081848.1

name	Ddo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267472 CCDS:CCDS23798.1 GeneID:70503 MGI:1925528
definition	EC_number : 1.4.3.1 GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003884 - D-amino-acid oxidase activity [Evidence IEA]; GO:0008445 - D-aspartate oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006531 - aspartate metabolism [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0007625 - grooming behavior [Evidence IMP]; GO:0042445 - hormone metabolism [Evidence IMP]; GO:0007320 - insemination [Evidence IMP] codon_start : 1 product : D-aspartate oxidase protein_id : NP_081718.2

name	9030224M15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244322 CCDS:CCDS23799.1 GeneID:327747 MGI:3045338
definition	codon_start : 1 product : hypothetical protein LOC327747 protein_id : NP_808461.1

name	Cdc40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765561 GeneID:71713 MGI:1918963
definition	codon_start : 1 product : cell division cycle 40 homolog isoform 1 protein_id : XP_483893.1

name	Wasf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994209 CCDS:CCDS23801.1 GeneID:83767 MGI:1890563
definition	GO_component : GO:0030027 - lamellipodium [Evidence IDA]; GO:0005741 - mitochondrial outer membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : WASP family 1 protein_id : NP_114083.1

name	Gpr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979620 CCDS:CCDS23802.1 GeneID:140741 MGI:2155249
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 6 protein_id : NP_951013.1

name	A530089I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527220 CCDS:CCDS23803.1 GeneID:103199 MGI:2143585
definition	codon_start : 1 product : Sac domain-containing inositol phosphatase 3 protein_id : NP_598760.1

name	Zbtb24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542230 CCDS:CCDS23804.1 GeneID:268294 MGI:3039618
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence NAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence NAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : BMP-induced factor 1; brain specific protein 1 product : zinc finger protein 450 protein_id : NP_700447.2

name	Mical1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923871 GeneID:171580 MGI:2385847
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005882 - intermediate filament [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 note : CasL interacting molecule MICAL; NEDD9 interacting protein with calponin homology and LIM domains product : microtubule associated monoxygenase, calponin and LIM domain containing 1 protein_id : NP_612188.1

name	Smpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678031 CCDS:CCDS23805.1 GeneID:20598 MGI:1278330
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence IMP] codon_start : 1 note : neutral sphingomyelinase 1 product : sphingomyelin phosphodiesterase 2, neutral protein_id : NP_033239.1

name	Ppil6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82932250 GeneID:73075 MGI:1920325
definition	codon_start : 1 product : peptidylprolyl isomerase (cyclophilin)-like 6 isoform 1 protein_id : XP_896765.1

name	LOC629337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629337
definition	number : 2 pseudo : _no_value

name	LOC629337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629337
definition	number : 1 pseudo : _no_value

name	LOC667982 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667982
definition	number : 1 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 1 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 2 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 3 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 4 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 5 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 6 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 7 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 8 pseudo : _no_value

name	LOC667994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667994
definition	number : 9 pseudo : _no_value

name	LOC666374 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666374
definition	number : 1 pseudo : _no_value

name	LOC667964 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260693 GeneID:667964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to C130022K22Rik protein pseudo : _no_value transcript_id : XR_032344.1

name	EG666304 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94387944 GeneID:666304 MGI:3644140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs product : predicted gene, EG666304 pseudo : _no_value transcript_id : XR_001938.1

name	LOC213332 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260696 GeneID:213332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 7 Proteins product : similar to Na+ dependent glucose transporter 1 pseudo : _no_value transcript_id : XR_032385.1

name	LOC100041085 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260697 GeneID:100041085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to Na+ dependent glucose transporter 1 pseudo : _no_value transcript_id : XR_032415.1

name	LOC668051 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260733 GeneID:668051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 91 ESTs, 4 Proteins product : similar to nuclear protein-NHP2-like protein pseudo : _no_value transcript_id : XR_032999.1

name	LOC633979 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260699 GeneID:633979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to hCG2030702 pseudo : _no_value transcript_id : XR_032514.1

clone name	MSMg01-081A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-547I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-109F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078F16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-136A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-308N24.b	B6Ng01-308N24.g
ACC	GA101259	GA101260
length	1,102	1,161
definition	B6Ng01-308N24.b	B6Ng01-308N24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(40,078,880 - 40,079,991)	(40,234,515 - 40,235,679)
sequence	gaattcaaggtcatcctctgctacaaagagaggtgcctccggagagaggg agttaaggaaggaaagaggaaagaatctaagttccctaagcattatagac ctacataagcaagtatgcaagccaagtaaaaaacaaactagtcaggaggt ggtggtgcacgcctttaaccccagccctcaggaggcaggtagatctctgg gttcaagactagtctggtctatagaatgagtttccccagtgctttaagtc acttttaaagacacagttaatagtaacggcactgcaggaggtcaggaatg ctgtccaagtctgtgagctcttggcacatgtgcttgagggtctgagttta gttcccagctctgtaagaaagaaagatttcatggtacaaaatgaaatttt acttttgagaaaagcattgctgctgcatcctgcttttgacttagtactgg tgagcatattcaacttactctttttataaagatttatctaatttttatgg gtatctgttctgtgtatgtaggcgactagaggaaggcctgggcatcgtag gggtgaaattacaggtaactctgagctcctcgacttgggtgctaggaact gaactcaggtttttagggagagcatagcaagtctcttgtagctgctgagc tgtctttctagcaaccccccccccccccccgccaccataaagaattaaac aaaattatgtgtgtatgcttgtgtatgtgtaactgtgagcacatgtaggg tcagagggcaatgtggggcctgttgttgcctcccaccatgtggctactgg ggttgaactcagatcgccgtgcttggaggagagcgccttgaaccttctga gctatcactgggccctgacccttgagctcattgaaaataagtatgttact gtcttgataaccgcctgttactcagcttgcaggattgggaggaaggcccc agttcaagggtggtcttgggcacagagaagactgggaccctctgcctgtt ttctcagagctacccttccacttctctctctcacacaaccaccacacaca ccactaccacaagtaatcaatgggaagccaaaggtaaaattagttttagc aa	gaattcagttaaaaccaatgaggtctcttccttagacagaaaagcaaatg gttcttggtagccgcactgatcccaggattctgtgtgtggatactacagt gtgtagcagtccctcctgccctccaaacccatgtactcagtcctctagct tctgatctggtgactgcttgaccacccatatcgctcagggtgtttggcac acgtaaacgtgtcacagtttagtaaagtgactatttgtagtggtgtggca gaatacaggggaagccacaggctgagtggagagttgccagtgacaatggg gcactgtgacttcctcagtctgatggtgacaggaagacacaggtgcttcc tcctgagacaaacagccatgttgaaaggacctcctaaacagacctgtaaa acagccaccaaagggaaccccatagcagagagcagggggaccccccacct gaagcccccgacctctgcttttctgtcccattccctgctgggggccacac agaagccagagaataaggagacctgtgatgacaccgtaaaagtcagcctc ctggggcatgagcagtgcagaggacagactgaagggccaggaggaacaag ccagcctgcacactgtacctaaagcttcaagttcagtgccaagcacgtaa tatatgctgctcccacccctgcctcccgaaacaaacacagcagaagaaag gtgattaagtacaagtgaggtgttaatacatggaaattgtcggaggagag aggaccctgtgacctagagtaagcagaggggtacaatatggagagctcag aaaactgggcctcagcggggtgcagagtgtggtcagcagagaagaacaag agccaggaagcagtagtgagcaccttcatgacaacatgggtgtgcagctt gagcaaagatgacaagatgtcaggagaccagactgcaaaggttggtgatg agtgacggcacagtatgggaaggtcctctctgcagcaggtgccattgggt ccctagtccaaagaacaatagggaacagtctggaggacatgttgtccaga gtgggatgaatgagctagtagtacaaagggaagggaacaaggcatccgga ctgagaacaggtccttaggctggttcctttgcttgttggaagaccaaggg aaaggagtcac
quality values	Open. Hide. 58 31 21 26 58 35 21 36 62 62 62 41 35 54 62 62 62 62 62 62 62 47 56 51 42 62 62 62 62 42 56 15 25 17 25 22 25 28 24 27 28 38 17 38 59 59 49 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 50 46 51 40 28 28 27 48 59 62 54 42 42 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 54 58 41 58 58 58 58 58 58 58 58 45 58 42 58 58 58 54 58 54 54 58 54 58 54 58 42 58 58 58 54 58 58 58 52 54 58 54 54 54 54 58 54 54 58 54 58 58 58 58 58 46 54 54 49 52 54 52 52 58 54 58 54 58 58 58 54 58 58 58 58 48 47 54 54 50 51 54 58 58 58 58 53 53 34 58 51 58 49 58 50 51 41 58 58 58 50 54 50 50 50 49 54 47 49 51 48 49 54 41 46 48 58 54 58 53 53 50 58 58 58 51 54 58 51 32 58 58 54 49 52 58 58 51 46 50 53 53 51 52 52 39 44 43 41 41 41 44 42 39 31 26 29 40 54 51 50 41 39 49 27 40 49 32 52 53 58 51 31 58 50 32 50 52 58 50 47 39 54 54 49 33 32 29 41 54 52 54 41 54 53 45 38 41 52 38 39 51 41 51 53 45 35 54 52 51 27 44 30 32 52 49 37 39 29 13 41 37 52 31 41 52 32 53 33 54 51 25 43 33 27 33 7 54 46 32 40 37 37 45 34 37 51 52 46 26 32 32 41 19 16 26 41 41 28 23 31 34 33 51 29 27 32 37 30 32 32 31 45 31 21 32 31 45 33 47 47 47 45 20 35 29 32 30 39 37 32 26 8 31 31 30 30 30 29 23 31 31 26 29 33 16 29 27 21 31 32 10 51 25 25 26 31 28 22 27 32 31 40 11 21 26 39 29 31 26 36 14 24 26 33 33 31 26 25 10 11 41 14 18 40 22 31 34 26 12 33 18 27 27 38 38 28 32 31 24 31 26 25 9 27 48 48 32 26 30 37 27 32 27 30 34 27 28 21 26 18 29 17 37 36 18 31 30 31 9 32 14 14 23 30 14 20 14 15 11 29 34 31 32 21 6 30 19 17 21 20 17 7 17 42 33 44 7 43 14 37 19 32 15 7 29 29 7 28 24 26 11 13 25 22 27 16 22 26 43 20 12 14 27 11 7 6 11 26 21 13 16 21 17 16 10 33 9 15 27 14 33 17 17 27 30 21 5 13 30 11 11 8 9 11 23 11 19 12 8 33 29 16 7 13 14 13 7 25 5 17 19 10 18 28 8 18 13 3 4 5 6 30 3 4 6 5 5 6 8 26 26 20 8 14 6 13 5 10 13 9 28 10 19 8 21 5 9 5 11 6 14 9 12 23 9 13 24 22 8 9 13 6 16 21 6 8 16 14 4 1 3 9 7 13 11 6 17 4 6 16 30 22 6 5 11 2 20 22 8 12 4 10 2 5 2 12 14 9 9 11 8 21	Open. Hide. 62 49 31 41 62 44 41 62 62 54 20 20 18 22 27 22 17 27 28 32 31 34 43 59 59 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 43 33 48 46 56 62 56 62 59 54 54 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 56 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 51 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 37 37 43 56 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 47 36 56 56 46 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 58 58 58 58 58 43 58 52 54 54 58 58 54 58 58 52 58 54 46 52 58 42 58 58 54 58 58 58 58 58 54 45 38 58 58 58 58 58 49 40 58 58 52 54 54 58 45 58 58 58 58 58 52 54 58 52 49 54 58 54 54 54 54 58 58 58 58 54 54 51 58 58 53 58 51 51 50 58 54 51 39 58 35 47 45 33 52 49 45 40 54 58 58 52 42 58 49 48 58 53 49 58 42 28 58 49 47 50 50 58 52 51 46 41 40 51 58 51 51 51 52 52 51 58 43 58 50 50 48 43 44 50 58 50 50 52 58 49 50 50 46 49 51 51 50 46 50 44 58 49 46 25 58 50 58 39 41 52 47 52 58 53 58 54 58 58 44 46 54 51 52 51 51 51 51 39 38 40 42 44 38 53 51 43 41 46 51 51 42 53 54 30 44 18 37 41 44 40 53 39 49 49 51 26 54 44 32 37 42 40 37 51 39 38 28 35 49 32 50 40 52 42 53 47 41 40 52 45 51 34 54 32 51 42 42 41 41 53 32 41 33 39 49 35 40 54 30 25 47 51 32 40 21 33 51 10 52 32 16 46 23 43 31 32 33 16 12 18 32 41 25 32 25 20 38 32 34 28 24 17 32 31 31 29 47 42 23 35 10 53 51 34 32 31 32 26 41 45 31 30 23 46 27 25 31 26 30 42 32 31 15 51 51 51 33 24 32 31 37 31 29 27 30 33 35 18 40 25 41 46 46 29 32 34 36 24 42 9 26 37 28 32 42 31 32 29 28 30 31 21 34 9 33 31 23 46 27 20 19 26 24 46 21 27 31 25 31 12 22 27 19 32 31 24 31 32 27 31 32 24 22 21 19 27 16 18 18 31 21 31 28 31 32 21 22 34 11 27 36 46 32 32 31 31 31 31 23 21 27 30 22 20 26 19 37 31 44 25 13 27 21 27 31 11 9 26 34 29 21 34 31 32 14 23 7 14 12 31 17 16 20 8 16 16 31 31 33 19 28 12 7 7 7 7 16 24 6 24 32 24 31 29 10 17 21 19 11 11 10 6 4 12 11 15 33 27 20 20 16 10 4 4 25 23 21 20 22 31 16 17 14 10 15 24 24 21 29 15 19 7 6 22 5 13 19 20 28 9 27 15 12 20 33 25 24 26 7 12 13 14 20 40 28 7 22 8 13 16 25 9 8 17 8 11 20 5 6 10 7 17 16 22 8 8 5 3 4 8 7 23 11 17 9 4 3 5 9 15 7 4 10 4 3 3 12 14 2 6 12 12 16 11 12 9 5 18 23 16 13 23 11 18 9 13 21 8 28 4 7 14 14 4 13 8 17 14 10 11 6 8 15 7 6 16 7 23 6 10 10 7 5 3 4 12 9 5 10 5 7 8 22 24 4 6 12 7 8 11 2 2 5 3 4 2 2 2 5 7 5 12 7 4 7 4 5 14 17 7 15 5 3 3 6 21 5 4 3 5 7 4 7 8 13 3 3 5 15 4 3 5 4 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_40078880_40079991
seq2: B6Ng01-308N24.b_49_1150

seq1  GAATTCAAGGTCATCCTCTGCTACAAAGAGAGGTGCCTCCGGAGAGAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGGTCATCCTCTGCTACAAAGAGAGGTGCCTCCGGAGAGAGGG  50

seq1  AGTTAAGGAAGGAAAGAGGAAAGAATCTAAGTTCCCTAAGCATTATAGAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAAGGAAGGAAAGAGGAAAGAATCTAAGTTCCCTAAGCATTATAGAC  100

seq1  CTACATAAGCAAGTATGCAAGCCAAGTAAAAAACAAACTAGTCAGGAGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACATAAGCAAGTATGCAAGCCAAGTAAAAAACAAACTAGTCAGGAGGT  150

seq1  GGTGGTGCACGCCTTTAACCCCAGCCCTCAGGAGGCAGGTAGATCTCTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGTGCACGCCTTTAACCCCAGCCCTCAGGAGGCAGGTAGATCTCTGG  200

seq1  GTTCAAGACTAGTCTGGTCTATAGAATGAGTTTCCCCAGTGCTTTAAGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAAGACTAGTCTGGTCTATAGAATGAGTTTCCCCAGTGCTTTAAGTC  250

seq1  ACTTTTAAAGACACAGTTAATAGTAACGGCACTGCAGGAGGTCAGGAATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTTAAAGACACAGTTAATAGTAACGGCACTGCAGGAGGTCAGGAATG  300

seq1  CTGTCCAAGTCTGTGAGCTCTTGGCACATGTGCTTGAGGGTCTGAGTTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCCAAGTCTGTGAGCTCTTGGCACATGTGCTTGAGGGTCTGAGTTTA  350

seq1  GTTCCCAGCTCTGTAAGAAAGAAAGATTTCATGGTACAAAATGAAATTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCCAGCTCTGTAAGAAAGAAAGATTTCATGGTACAAAATGAAATTTT  400

seq1  ACTTTTGAGAAAAGCATTGCTGCTGCATCCTGCTTTTGACTTAGTACTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTTGAGAAAAGCATTGCTGCTGCATCCTGCTTTTGACTTAGTACTGG  450

seq1  TGAGCATATTCAACTTACTCTTTTTATAAAGATTTATCTAATTTTTATGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCATATTCAACTTACTCTTTTTATAAAGATTTATCTAATTTTTATGG  500

seq1  GTATCTGTTCTGTGTATGTAGGCGACTAGAGGAAGGCCTGGGCATCGTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATCTGTTCTGTGTATGTAGGCGACTAGAGGAAGGCCTGGGCATCGTAG  550

seq1  GGGTGAAATTACAGGTAACTCTGAGCTCCTCGACTTGGGTGCTAGGAACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGAAATTACAGGTAACTCTGAGCTCCTCGACTTGGGTGCTAGGAACT  600

seq1  GAACTCAGGTTTTTAGGGAGAGCATAGCAAGTCTCTTGTAGCTGCTGAGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCAGGTTTTTAGGGAGAGCATAGCAAGTCTCTTGTAGCTGCTGAGC  650

seq1  TGTCTTTCTAGCAACCCCCCCCCCCCCCCCGCCACCATAAAGAATTAAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTTCTAGCAACCCCCCCCCCCCCCCCGCCACCATAAAGAATTAAAC  700

seq1  AAAATTATGTGTGTATGCTTGTGTATGTGTAACTGTGAGCACATGTAGGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTATGTGTGTATGCTTGTGTATGTGTAACTGTGAGCACATGTAGGG  750

seq1  TCAGAGGGCAATGTGGGGCCTGTTGTTGCCTCCCACCATGTGGCTACTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAGGGCAATGTGGGGCCTGTTGTTGCCTCCCACCATGTGGCTACTGG  800

seq1  GGTTGAACTCAGATCGCCGTGCTTGGAGGAGAGCGCCTTGAACCTTCTGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGAACTCAGATCGCCGTGCTTGGAGGAGAGCGCCTTGAACCTTCTGA  850

seq1  GCTATCACT-GGCCCTGACCCTTGAGCTCATTGAAAATAAGTATGTTACT  899
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  GCTATCACTGGGCCCTGACCCTTGAGCTCATTGAAAATAAGTATGTTACT  900

seq1  GTCTTGATAACCGCCTGTTACTCAGCTTGCAGGATTTGGAGGAGGGCCCC  949
      |||||||||||||||||||||||||||||||||||| |||||| ||||||
seq2  GTCTTGATAACCGCCTGTTACTCAGCTTGCAGGATTGGGAGGAAGGCCCC  950

seq1  AGTTCAAGGGTGGTC-TGGGCACAGAG-AGACTGGG-CCCTCTGCCTG-T  995
      ||||||||||||||| ||||||||||| |||||||| ||||||||||| |
seq2  AGTTCAAGGGTGGTCTTGGGCACAGAGAAGACTGGGACCCTCTGCCTGTT  1000

seq1  TTCTCAGAGCTACCCTTCCCACTTTCCTCCTCCTCCTCCACCACCACCAC  1045
      ||||||||||||||||| ||||||     |||   |||      ||| ||
seq2  TTCTCAGAGCTACCCTT-CCACTT-----CTCTCTCTC-----ACACAAC  1039

seq1  CACCACCACCACCACCACCACAAGTAATCCACTGGGAAGGCAAAAGTTAA  1095
      ||||||   |||||| |||||||||||| || |||||| || |||| |||
seq2  CACCACACACACCACTACCACAAGTAAT-CAATGGGAA-GCCAAAGGTAA  1087

seq1  AATATAGTTTTTAGCAA  1112
      ||| ||| |||||||||
seq2  AAT-TAG-TTTTAGCAA  1102

seq1: chr10_40234515_40235679
seq2: B6Ng01-308N24.g_67_1227 (reverse)

seq1  GTGACTCCTTTCTCCTTTGTCTTCCCCAACCAGC-AAGGAACCAAGCCTT  49
      |||||||||||| |||| |||||  ||||| ||| |||||||| |||| |
seq2  GTGACTCCTTTC-CCTTGGTCTT--CCAACAAGCAAAGGAACC-AGCC-T  45

seq1  TAGGCCCTG-TCTCGGTTCCGATGCCTT-TGTCCTTCCCTTTGTACCTAC  97
       ||| |||| |||| || | |||||||| |  ||||||||||||| ||||
seq2  AAGGACCTGTTCTCAGTCCGGATGCCTTGTTCCCTTCCCTTTGTA-CTAC  94

seq1  TAGCTCATTCATCCCACTCTGGGACACATTGTCCTTCCAGACTG-TCCCT  146
      |||||||||||||||||||| |||||   ||||| ||||||||| |||||
seq2  TAGCTCATTCATCCCACTCT-GGACAACATGTCC-TCCAGACTGTTCCCT  142

seq1  ATTGTTCTTTGGACTAGGGA-CCAATGCCACCTGCTGCAGAGAGGACCTT  195
      |||||||||||||||||||| |||||| ||||||||||||||||||||||
seq2  ATTGTTCTTTGGACTAGGGACCCAATGGCACCTGCTGCAGAGAGGACCTT  192

seq1  CCCATACTGTGGCCGTCACTCATCACCACCCTTTGCAGTCTGGTCTCCTG  245
      |||||||||| ||||||||||||||||| |||||||||||||||||||||
seq2  CCCATACTGT-GCCGTCACTCATCACCAACCTTTGCAGTCTGGTCTCCTG  241

seq1  ACATCTTGTCATCTTTGCTCAAGCTGCACACCCATGTTGTCATGAAGGTG  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTTGTCATCTTTGCTCAAGCTGCACACCCATGTTGTCATGAAGGTG  291

seq1  CTCACTACTGCTTCCTGGCTCTTGTTCTTCTCTGCTGACCACACTCTGCA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTACTGCTTCCTGGCTCTTGTTCTTCTCTGCTGACCACACTCTGCA  341

seq1  CCCCGCTGAGGCCCAGTTTTCTGAGCTCTCCATATTGTACCCCTCTGCTT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCGCTGAGGCCCAGTTTTCTGAGCTCTCCATATTGTACCCCTCTGCTT  391

seq1  ACTCTAGGTCACAGGGTCCTCTCTCCTCCGACAATTTCCATGTATTAACA  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTAGGTCACAGGGTCCTCTCTCCTCCGACAATTTCCATGTATTAACA  441

seq1  CCTCACTTGTACTTAATCACCTTTCTTCTGCTGTGTTTGTTTCGGGAGGC  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACTTGTACTTAATCACCTTTCTTCTGCTGTGTTTGTTTCGGGAGGC  491

seq1  AGGGGTGGGAGCAGCATATATTACGTGCTTGGCACTGAACTTGAAGCTTT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGTGGGAGCAGCATATATTACGTGCTTGGCACTGAACTTGAAGCTTT  541

seq1  AGGTACAGTGTGCAGGCTGGCTTGTTCCTCCTGGCCCTTCAGTCTGTCCT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTACAGTGTGCAGGCTGGCTTGTTCCTCCTGGCCCTTCAGTCTGTCCT  591

seq1  CTGCACTGCTCATGCCCCAGGAGGCTGACTTTTACGGTGTCATCACAGGT  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCACTGCTCATGCCCCAGGAGGCTGACTTTTACGGTGTCATCACAGGT  641

seq1  CTCCTTATTCTCTGGCTTCTGTGTGGCCCCCAGCAGGGAATGGGACAGAA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTATTCTCTGGCTTCTGTGTGGCCCCCAGCAGGGAATGGGACAGAA  691

seq1  AAGCAGAGGTCGGGGGCTTCAGGTGGGGGGTCCCCCTGCTCTCTGCTATG  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGAGGTCGGGGGCTTCAGGTGGGGGGTCCCCCTGCTCTCTGCTATG  741

seq1  GGGTTCCCTTTGGTGGCTGTTTTACAGGTCTGTTTAGGAGGTCCTTTCAA  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTCCCTTTGGTGGCTGTTTTACAGGTCTGTTTAGGAGGTCCTTTCAA  791

seq1  CATGGCTGTTTGTCTCAGGAGGAAGCACCTGTGTCTTCCTGTCACCATCA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGCTGTTTGTCTCAGGAGGAAGCACCTGTGTCTTCCTGTCACCATCA  841

seq1  GACTGAGGAAGTCACAGTGCCCCATTGTCACTGGCAACTCTCCACTCAGC  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGAGGAAGTCACAGTGCCCCATTGTCACTGGCAACTCTCCACTCAGC  891

seq1  CTGTGGCTTCCCCTGTATTCTGCCACACCACTACAAATAGTCACTTTACT  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGCTTCCCCTGTATTCTGCCACACCACTACAAATAGTCACTTTACT  941

seq1  AAACTGTGACACGTTTACGTGTGCCAAACACCCTGAGCGATATGGGTGGT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGTGACACGTTTACGTGTGCCAAACACCCTGAGCGATATGGGTGGT  991

seq1  CAAGCAGTCACCAGATCAGAAGCTAGAGGACTGAGTACATGGGTTTGGAG  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCAGTCACCAGATCAGAAGCTAGAGGACTGAGTACATGGGTTTGGAG  1041

seq1  GGCAGGAGGGACTGCTACACACTGTAGTATCCACACACAGAATCCTGGGA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGAGGGACTGCTACACACTGTAGTATCCACACACAGAATCCTGGGA  1091

seq1  TCAGTGCGGCTACCAAGAACCATTTGCTTTTCTGTCTAAGGAAGAGACCT  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGCGGCTACCAAGAACCATTTGCTTTTCTGTCTAAGGAAGAGACCT  1141

seq1  CATTGGTTTTAACTGAATTC  1165
      ||||||||||||||||||||
seq2  CATTGGTTTTAACTGAATTC  1161

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information