MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-312G09
Chromosome	10 (Build37)
Map Location	82,169,783 - 82,294,695
singlet/doublet	doublet
Overlap gene	Hcfc2, Nfyb, 1700028I16Rik
Upstream gene	LOC666711, LOC382388, LOC100040944, EG210583, EG666738, EG666501, 1700123A16Rik, LOC666753, EG666537, BC062127, EG666542, EG666548, EG666790, LOC666571, AL117821, BC062115, 4933439G19Rik, BC024063, AU041133, LOC100042712, B230315N10Rik, LOC100042718, EG237412, LOC666611, Gm1553, LOC544716, 1190007I07Rik, Tdg, Glt8d2
Downstream gene	Txnrd1, Eid3, EG216185, Chst11, Slc41a2, D10Wsu102e, LOC666748, Aldh1l2, A230046K03Rik, Appl2, 1500009L16Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 9 Proteins pseudo : _no_value

name	LOC382388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100040944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein

name	EG210583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210583 MGI:3644409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs

name	EG666738 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666738 MGI:3647363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 979 ESTs, 9 Proteins

name	EG666501 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666501 MGI:3647467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 982 ESTs, 9 Proteins

name	1700123A16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73610 MGI:1920860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs

name	LOC666753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 9 Proteins pseudo : _no_value

name	EG666537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666537 MGI:3644502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	BC062127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331188 MGI:3696710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666542 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666542 MGI:3647888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG666548 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666548 MGI:3647883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 927 ESTs, 9 Proteins

name	EG666790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666790 MGI:3648461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 764 ESTs, 9 Proteins

name	LOC666571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	AL117821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404580 MGI:3034336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	BC062115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408062 MGI:3040689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933439G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414080 MGI:3041160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC024063 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666584 MGI:2670978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein

name	AU041133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216177 MGI:2143755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC100042712 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	B230315N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237411 MGI:3621440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100042718 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG237412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237412 MGI:3643133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	LOC666611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	Gm1553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432480 MGI:2686399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 1 Protein

name	LOC544716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 167 ESTs, 12 Proteins pseudo : _no_value

name	1190007I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544717 MGI:3698433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs

name	Tdg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21665 MGI:108247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Glt8d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74782 MGI:1922032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcfc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67933 MGI:1915183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfyb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18045 MGI:97317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700028I16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70003 MGI:1917253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Txnrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50493 MGI:1354175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Eid3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66341 MGI:1913591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG216185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216185 MGI:3648850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 41 ESTs, 7 Proteins

name	Chst11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58250 MGI:1927166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc41a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338365 MGI:2442940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D10Wsu102e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28109 MGI:106381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666748 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Aldh1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216188 MGI:2444680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230046K03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319277 MGI:2441787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Appl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216190 MGI:2384914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500009L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69784 MGI:1917034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs

name	LOC100040944 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260953 GeneID:100040944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001475544.1

name	EG210583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260955 GeneID:210583 MGI:3644409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs product : predicted gene, EG210583 transcript_id : XM_001475574.1

name	EG666738 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261050 GeneID:666738 MGI:3647363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 979 ESTs, 9 Proteins product : predicted gene, EG666738 transcript_id : XM_001002232.2

name	EG666501 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388473 GeneID:666501 MGI:3647467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 982 ESTs, 9 Proteins product : predicted gene, EG666501 transcript_id : XM_984283.1

name	1700123A16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388477 GeneID:73610 MGI:1920860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : RIKEN cDNA 1700123A16 gene transcript_id : XM_984400.1

name	BC062127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49615104 GeneID:331188 MGI:3696710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC062127 transcript_id : NM_199062.1

name	EG666542 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260957 GeneID:666542 MGI:3647888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666542 transcript_id : XM_984461.2

name	EG666548 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261054 GeneID:666548 MGI:3647883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 927 ESTs, 9 Proteins product : predicted gene, EG666548 transcript_id : XM_984537.2

name	EG666790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388506 GeneID:666790 MGI:3648461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 764 ESTs, 9 Proteins product : predicted gene, EG666790 transcript_id : XM_001002269.1

name	AL117821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261056 GeneID:404580 MGI:3034336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : expressed sequence AL117821 transcript_id : XM_001479742.1

name	BC062115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665708 GeneID:408062 MGI:3040689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC062115 transcript_id : NM_001024626.2

name	4933439G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260959 GeneID:414080 MGI:3041160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4933439G19 gene transcript_id : XM_001475681.1

name	BC024063 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260961 GeneID:666584 MGI:2670978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : cDNA sequence BC024063 transcript_id : XM_984750.2

name	AU041133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388490 GeneID:216177 MGI:2143755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : expressed sequence AU041133 transcript_id : XM_125803.5

name	B230315N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261059 GeneID:237411 MGI:3621440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA B230315N10 gene transcript_id : XM_001479757.1

name	LOC100042718 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261061 GeneID:100042718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042718 transcript_id : XM_001479763.1

name	Gm1553 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261063 GeneID:432480 MGI:2686399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 1 Protein product : gene model 1553, (NCBI) transcript_id : XM_001479767.1

name	1190007I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388493 GeneID:544717 MGI:3698433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs product : RIKEN cDNA 1190007I07 gene transcript_id : XM_985039.1

name	Tdg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755753 GeneID:21665 MGI:108247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymine DNA glycosylase transcript_id : NM_011561.1

name	Tdg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388766 GeneID:21665 MGI:108247
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymine DNA glycosylase transcript_id : NM_172552.2

name	Glt8d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802292 GeneID:74782 MGI:1922032
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase 8 domain containing 2 transcript_id : NM_029102.2

name	Hcfc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487040 GeneID:67933 MGI:1915183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : host cell factor C2 transcript_id : NM_001081218.1

name	Nfyb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909330 GeneID:18045 MGI:97317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transcription factor-Y beta transcript_id : NM_010914.2

name	1700028I16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260967 GeneID:70003 MGI:1917253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 1700028I16 gene transcript_id : XM_001475840.1

name	Txnrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224446 GeneID:50493 MGI:1354175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 1 transcript_id : NM_001042523.1

name	Txnrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224441 GeneID:50493 MGI:1354175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 1 transcript_id : NM_001042513.1

name	Txnrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224443 GeneID:50493 MGI:1354175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 1 transcript_id : NM_015762.2

name	Txnrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224444 GeneID:50493 MGI:1354175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 1 transcript_id : NM_001042514.1

name	Eid3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988413 GeneID:66341 MGI:1913591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EP300 interacting inhibitor of differentiation 3 transcript_id : NM_025499.2

name	EG216185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260969 GeneID:216185 MGI:3648850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 41 ESTs, 7 Proteins product : predicted gene, EG216185 transcript_id : XM_122081.6

name	Chst11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76559941 GeneID:58250 MGI:1927166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate sulfotransferase 11 transcript_id : NM_021439.2

name	Slc41a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349904 GeneID:338365 MGI:2442940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 2 transcript_id : NM_177388.3

name	D10Wsu102e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195802 GeneID:28109 MGI:106381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, Wayne State University 102, expressed transcript_id : NM_026579.2

name	Aldh1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956315 GeneID:216188 MGI:2444680
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 1 family, member L2 transcript_id : NM_153543.1

name	A230046K03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090571 GeneID:319277 MGI:2441787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230046K03 gene transcript_id : NM_001033375.2

name	Appl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803546 GeneID:216190 MGI:2384914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 transcript_id : NM_145220.2

name	1500009L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388505 GeneID:69784 MGI:1917034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs product : RIKEN cDNA 1500009L16 gene transcript_id : XM_899407.2

name	LOC100040944 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260954 GeneID:100040944
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001475594.1

name	EG210583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260956 GeneID:210583 MGI:3644409
definition	codon_start : 1 product : similar to EG210583 protein protein_id : XP_001475624.1

name	EG666738 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388502 GeneID:666738 MGI:3647363
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_001002232.1

name	EG666501 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388474 GeneID:666501 MGI:3647467
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_989377.1

name	1700123A16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388478 GeneID:73610 MGI:1920860
definition	codon_start : 1 product : hypothetical protein LOC73610 protein_id : XP_989494.1

name	BC062127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49615105 GeneID:331188 MGI:3696710
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC331188 protein_id : NP_951017.1

name	EG666542 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260958 GeneID:666542 MGI:3647888
definition	codon_start : 1 product : similar to EG210583 protein protein_id : XP_989555.2

name	EG666548 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388483 GeneID:666548 MGI:3647883
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_989631.1

name	EG666790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388507 GeneID:666790 MGI:3648461
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_001002269.1

name	AL117821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261057 GeneID:404580 MGI:3034336
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479792.1

name	BC062115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665709 GeneID:408062 MGI:3040689
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC408062 protein_id : NP_001019797.2

name	4933439G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260960 GeneID:414080 MGI:3041160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475731.1

name	BC024063 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260962 GeneID:666584 MGI:2670978
definition	codon_start : 1 product : hypothetical protein LOC666584 protein_id : XP_989844.2

name	AU041133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83027472 GeneID:216177 MGI:2143755
definition	codon_start : 1 product : hypothetical protein protein_id : XP_125803.2

name	B230315N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261060 GeneID:237411 MGI:3621440
definition	codon_start : 1 product : hypothetical protein LOC237411 protein_id : XP_001479807.1

name	LOC100042718 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261062 GeneID:100042718
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479813.1

name	Gm1553 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261064 GeneID:432480 MGI:2686399
definition	codon_start : 1 product : hypothetical protein LOC432480 protein_id : XP_001479817.1

name	1190007I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388494 GeneID:544717 MGI:3698433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990133.1

name	Tdg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777685 CCDS:CCDS24070.1 GeneID:21665 MGI:108247
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : thymine DNA glycosylase isoform 2 protein_id : NP_766140.1

name	Tdg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755754 GeneID:21665 MGI:108247
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : thymine DNA glycosylase isoform 1 protein_id : NP_035691.1

name	Glt8d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037389 CCDS:CCDS24071.1 GeneID:74782 MGI:1922032
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase 8 domain containing 2 protein_id : NP_083378.1

name	Hcfc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487041 GeneID:67933 MGI:1915183
definition	codon_start : 1 product : host cell factor 2 protein_id : NP_001074687.1

name	Nfyb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754850 GeneID:18045 MGI:97317
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear transcription factor-Y beta protein_id : NP_035044.1

name	1700028I16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260968 GeneID:70003 MGI:1917253
definition	codon_start : 1 product : hypothetical protein LOC70003 protein_id : XP_001475890.1

name	Eid3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125988414 GeneID:66341 MGI:1913591
definition	codon_start : 1 product : E1A-like inhibitor of differentiation 3 protein_id : NP_079775.2

name	Txnrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110224447 GeneID:50493 MGI:1354175
definition	EC_number : 1.8.1.9 GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016654 - oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; TR alpha product : thioredoxin reductase 1 isoform 1 protein_id : NP_001035988.1 transl_except : (pos:82358782..82358784,aa:Sec)

name	Txnrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110224442 GeneID:50493 MGI:1354175
definition	EC_number : 1.8.1.9 GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016654 - oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; TR alpha product : thioredoxin reductase 1 isoform 2 protein_id : NP_001035978.1 transl_except : (pos:82358782..82358784,aa:Sec)

name	Txnrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110224445 GeneID:50493 MGI:1354175
definition	EC_number : 1.8.1.9 GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016654 - oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 4; TR alpha product : thioredoxin reductase 1 isoform 2 protein_id : NP_001035979.1 transl_except : (pos:82358782..82358784,aa:Sec)

name	Txnrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13569841 CCDS:CCDS24072.1 GeneID:50493 MGI:1354175
definition	EC_number : 1.8.1.9 GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016654 - oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; TR alpha product : thioredoxin reductase 1 isoform 2 protein_id : NP_056577.2 transl_except : (pos:82358782..82358784,aa:Sec)

name	EG216185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260970 GeneID:216185 MGI:3648850
definition	codon_start : 1 product : similar to TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : XP_122081.4

name	Chst11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76559942 CCDS:CCDS24074.1 GeneID:58250 MGI:1927166
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047756 - chondroitin 4-sulfotransferase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0030206 - chondroitin sulfate biosynthesis [Evidence IDA] codon_start : 1 note : chondroitin 4-sulfotransferase product : carbohydrate sulfotransferase 11 protein_id : NP_067414.2

name	Slc41a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893565 CCDS:CCDS24075.1 GeneID:338365 MGI:2442940
definition	codon_start : 1 product : solute carrier family 41, member 2 protein_id : NP_796362.1

name	D10Wsu102e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:44662811 CCDS:CCDS24076.1 GeneID:28109 MGI:106381
definition	codon_start : 1 product : hypothetical protein LOC28109 protein_id : NP_080855.1

name	Aldh1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956316 CCDS:CCDS24077.1 GeneID:216188 MGI:2444680
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0048037 - cofactor binding [Evidence IEA]; GO:0016155 - formyltetrahydrofolate dehydrogenase activity [Evidence IEA]; GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009258 - 10-formyltetrahydrofolate catabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : aldehyde dehydrogenase 1 family, member L2 protein_id : NP_705771.1

name	A230046K03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090572 GeneID:319277 MGI:2441787
definition	codon_start : 1 product : hypothetical protein LOC319277 protein_id : NP_001028547.2

name	Appl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644587 CCDS:CCDS24078.1 GeneID:216190 MGI:2384914
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0010008 - endosome membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS]; GO:0016581 - NuRD complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0017137 - Rab GTPase binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 note : DIP13 beta product : Dip3 beta protein_id : NP_660255.1

name	1500009L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83027529 GeneID:69784 MGI:1917034
definition	codon_start : 1 product : hypothetical protein LOC69784 protein_id : XP_904500.1

name	LOC382388 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382388
definition	number : 1 pseudo : _no_value

name	EG666537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666537
definition	number : 1 pseudo : _no_value

name	LOC666748 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666748
definition	number : 1 pseudo : _no_value

name	LOC666711 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261049 GeneID:666711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_035695.1

name	LOC666753 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261053 GeneID:666753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034346.1

name	LOC666571 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261055 GeneID:666571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to uracil DNA glycosylase pseudo : _no_value transcript_id : XR_034355.1

name	LOC100042712 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261058 GeneID:100042712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to brain protein 44 pseudo : _no_value transcript_id : XR_034367.1

name	EG237412 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260963 GeneID:237412 MGI:3643133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : predicted gene, EG237412 transcript_id : XR_035281.1

name	LOC666611 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260964 GeneID:666611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to mitogen activated protein kinase kinase kinase 7 pseudo : _no_value transcript_id : XR_032433.1

name	LOC544716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261065 GeneID:544716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 167 ESTs, 12 Proteins product : similar to clathrin adaptor protein mu3A pseudo : _no_value transcript_id : XR_034379.1

clone name	MSMg01-418H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092C24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423J18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169L13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-460K24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-179O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293N17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-312G09.b	B6Ng01-312G09.g
ACC	GA103878	GA103879
length	1,005	1,053
definition	B6Ng01-312G09.b	B6Ng01-312G09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(82,293,678 - 82,294,695)	(82,169,783 - 82,170,838)
sequence	gaattcagtttttgtttttgtttttgttttttttactgcttttgcctatg aattttacagcttttttttttttcatctctagggtatagtctaccagggc tagtcatttttatctagtgtaatgggaggttctgccttctctttgcagtg tgtgtgtgtgtgtgtattactagttaattttgtgtgacttgttgaaaaaa gtcctctgttggtatttttttacatccatggtgaaaaccaattgaccata agtgaagttattcatcataggcacaccatggcttctcttaggctgagttt acaccaaatcaggtaatttccccaaacaggaagccagacttccatctttc attttatgttctttgaagtatatgttaggtcatgaatatgtaataattat tataaaagcaattttaaagccaattaattaaaactaaactctactaccca cagccaaacattcagcagagcttggggaatcctggacaagggggcgggga gggggagacggtaggcttcacaggggtcaagaacttatatcacatcacaa gaaaacccacagaatcaactagcctgggctcacaggggctcacagggatt gaaccaacagccagggaaccatcaacatccagggagccagagcctgaatg gctttttacaccaaatattaaaaatacagagaaagggccagggagacagt tcaacggagagcactcacctagcacacgcaagaatctgagctcagttctg gttactgtaaaaagcaaatgtggatggggttggaagactggatggatgga gagtggacagagagacagataaaaatgcaaatgacatagaaaattccctt gacatttggatactggtgatgtgactttaaatgcttatgggaaaaaattt gtgtaaagtgttaattgcccccccaaaaaataaaataaataaaagcaaaa ataaaaaaaagctgggcgtgcatggcgtatgcctttatccagcactggga gcaga	gaattcatttcctggaagaatatgtatgctcttaaccattgagccatctc tccagcccctaaactttgaaatcttctgatcagaaatgttttgctttctc tccttgtacttgagtaaaatattaataggaaattgaatggattggtacaa gtgacattttggaattgggagatagctcaacaggctaagctcttgccagt tggaggaccttgggtttggatgtccagaacctacataaaaaatatcatgt aattccagctgatagcaggcagaaacagaaaaactctgggcaagagtttt tcttgccaaaaccaaccaagtttcaggttcaggaacagactgcctcagtt gtacgaggcagagagtgactgaggggaacccagtgccattctcctgttta tgcatgtgcacatatatgtgcccgcatgtatgtgcccacatgtacatgca tttgcagagaaaacaaaagtgtgttaaaaaataggtcacagattaatgaa agcttttcaagaaaagaagctggttagaacaaagttagtgtcggtttcta agttaaagacacgttttaggatagtgctgtgacattttgtagtgtgccaa gaaagctgcgaaggaagcagtgcttattccagatagcagtggcatcaaat attggccaaaatcgtgaccataataactgttatctagtgctgtgtaataa actaatgatacaaaatagtaacttgtattgtgttcacagacactgtaagt aagatgattagggcacagaagacatggctaaaccctttagtgagaaacct taaatggtcatccccacatctgatagttaactgaggtaactgaaaggata gattcaactgggctatcacctaacaagcctctacaaatggcttttttttt tcttttttttcttttttcttggagaacaggatcttcaaatagaacctggc tggcttggactatgtagctaagaagtaaccctgaacttcttgtcaccctg tgtaccttggtgactgctgagaatatacgcatgtgtcactgtgcctagat gtg
quality values	Open. Hide. 49 31 18 29 62 31 38 49 62 62 62 62 54 47 54 62 62 62 54 41 47 62 62 62 62 47 54 62 62 62 62 59 59 35 45 59 43 38 34 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 44 59 56 42 43 54 46 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 54 62 54 54 62 59 59 59 51 56 62 59 56 59 59 62 56 62 54 62 62 62 62 62 62 62 62 62 56 59 56 46 59 59 62 62 62 62 59 56 51 62 51 62 56 62 59 62 59 62 59 62 62 62 62 62 62 59 62 62 62 59 59 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 59 56 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 56 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 59 56 59 62 54 54 62 62 62 59 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 54 34 50 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 56 62 50 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 46 43 36 39 62 62 62 62 35 32 47 54 62 62 56 62 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 52 54 52 62 54 52 52 43 62 54 52 54 54 62 48 62 62 62 42 42 62 54 52 62 52 52 62 47 42 62 43 54 54 58 54 52 52 54 54 58 52 58 54 58 54 27 47 52 47 58 58 58 58 58 58 47 54 52 54 58 58 28 25 58 52 58 54 42 54 27 54 54 52 52 58 41 37 58 58 58 58 52 39 58 36 54 48 47 52 52 46 58 48 52 52 49 58 58 42 31 49 49 35 37 51 23 51 58 50 58 38 47 34 51 49 32 54 58 58 58 38 39 46 29 52 50 36 58 50 46 40 32 30 52 58 58 58 50 52 32 50 37 27 51 19 58 58 50 42 58 35 35 50 37 23 49 49 27 20 34 21 40 36 53 52 39 29 34 50 50 51 38 14 47 31 45 31 39 53 42 32 49 49 45 33 26 49 30 39 40 42 38 39 26 51 42 54 35 37 52 40 40 51 13 41 52 40 40 32 49 42 40 40 47 54 32 33 31 33 31 46 35 37 54 54 54 40 33 37 32 54 32 31 52 32 36 32 34 35 45 53 52 46 31 32 32 52 33 36 21 28 17 35 37 33 9 13 33 25 14 17 31 34 33 23 46 16 31 33 18 18 19 26 28 33 22 31 19 24 25 16 29 31 15 29 41 31 41 28 31 30 33 33 46 38 31 31 18 12 9 16 34 33 37 46 26 19 31 27 32 46 31 24 33 31 11 13 27 41 46 35 35 25 18 21 21 26 28 36 31 11 31 19 12 41 32 25 23 21 37 33 18 14 36 26 15 32 29 15 25 25 18 20 36 17 27 36 36 41 36 26 14 36 22 28 22 17 23 5 27 32 24 27 34 21 30 18 14 25 21 21 18 24 20 31 16 24 23 19 39 30 31 24 23 17 18 17 31 23 6 17 21 22 17 29 36 16 13 10 4 6 3 26 19 3 6 11 11 7 17 3 6 27 13 8 5 16 24 38 16 12 8 11 20 8 5 7 28 9 6 4 11 9 16 26 9 14 15 28 10 9 17 16 27 7 12 7 6 16 24 12 26 6 21 14 4 6 5 10	Open. Hide. 62 44 36 44 62 47 32 62 62 62 46 45 45 38 27 38 43 28 38 44 46 62 59 59 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 59 59 62 62 59 59 54 36 50 50 48 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 54 42 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 54 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 54 54 58 52 58 58 58 54 54 58 58 58 58 54 52 58 58 58 58 58 54 58 49 58 51 42 58 51 58 58 51 58 58 54 58 46 50 49 58 58 58 58 58 53 58 50 58 58 53 58 43 45 40 58 51 58 58 58 53 51 58 54 50 41 38 49 29 58 58 50 50 53 58 50 53 58 58 58 41 50 39 46 43 47 41 40 58 46 53 53 53 53 49 52 51 44 53 53 53 51 32 38 51 54 51 51 49 54 32 37 28 40 58 58 51 50 52 51 51 58 39 40 49 40 49 42 58 50 50 50 51 49 54 49 40 49 50 50 41 51 37 39 54 38 51 54 53 54 37 44 54 52 44 26 42 53 45 40 45 52 54 38 37 40 53 23 54 54 39 39 52 32 45 53 37 42 44 53 54 35 39 47 39 51 52 52 40 47 45 35 53 40 53 47 33 29 39 33 41 34 42 53 41 27 25 51 32 41 24 45 41 31 40 34 24 36 33 33 40 45 31 26 51 51 37 31 24 31 42 31 51 35 31 25 51 33 31 51 40 28 51 31 42 29 31 45 41 27 42 48 31 25 46 31 18 31 46 41 31 31 46 26 42 26 31 31 46 46 40 26 42 31 33 43 29 32 43 31 31 30 37 33 26 33 27 29 31 25 21 18 31 32 33 30 31 31 18 47 6 24 13 27 21 31 32 32 27 42 36 24 18 30 31 31 47 29 21 31 36 34 31 31 21 25 32 23 30 29 16 23 31 30 31 31 32 26 32 24 13 31 26 26 23 28 10 4 15 6 4 4 4 19 31 9 4 4 11 33 11 28 7 4 4 4 5 6 9 37 10 23 3 3 3 3 22 20 19 6 6 15 12 6 9 13 10 23 11 8 6 8 14 32 27 16 27 14 23 11 21 23 16 16 28 20 22 12 11 11 30 21 15 25 27 19 8 10 19 27 22 11 11 24 28 22 13 8 6 16 9 15 11 14 9 22 9 19 8 13 10 8 13 5 6 6 4 15 6 21 9 23 30 15 4 3 2 3 10 13 11 14 6 14 9 4 4 15 18 17 6 9 16 15 9 16 10 22 7 13 5 4 3 1 3 8 15 7 6 4 7 7 3 4 8 4 12 6 17 6 5 4 2 3 12 4 5 5 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_82293678_82294695
seq2: B6Ng01-312G09.b_47_1051 (reverse)

seq1  TCTGCCTCCCAAGTGCTGGGATTAAAGGCATACGCCA-CCACGCCCAGCT  49
      |||| ||||| ||||||||   |||||||||||||||  |||||||||| 
seq2  TCTG-CTCCC-AGTGCTGG--ATAAAGGCATACGCCATGCACGCCCAGC-  45

seq1  TTTTTTTTTTTTTTTTTGCTTTTTATTTTTATTTTTATTTTTTTGGGGGG  99
         |||||||| ||||||||||   | ||||||||   ||||||||||||
seq2  ---TTTTTTTTATTTTTGCTTT---TATTTATTTT--ATTTTTTGGGGGG  87

seq1  GCAATTAACACTTTAACACAAATTTTTTCCCATAAGCATTTAAAGTCACA  149
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  GCAATTAACACTTT-ACACAAATTTTTTCCCATAAGCATTTAAAGTCACA  136

seq1  TCACCAGTATCCAAATGTCAAGGGAA-TTTCTATGTCATTTTGCATTTTT  198
      |||||||||||||||||||||||||| ||||||||||| |||||||||||
seq2  TCACCAGTATCCAAATGTCAAGGGAATTTTCTATGTCA-TTTGCATTTTT  185

seq1  ATCTGTCTCTCTGTCCACTCTCCATCCATCCAGTCTTCCAACCCCATCCA  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGTCTCTCTGTCCACTCTCCATCCATCCAGTCTTCCAACCCCATCCA  235

seq1  CATTTGCTTTTTACAGTAACCAGAACTGAGCTCAGATTCTTGCGTGTGCT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGCTTTTTACAGTAACCAGAACTGAGCTCAGATTCTTGCGTGTGCT  285

seq1  AGGTGAGTGCTCTCCGTTGAACTGTCTCCCTGGCCCTTTCTCTGTATTTT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAGTGCTCTCCGTTGAACTGTCTCCCTGGCCCTTTCTCTGTATTTT  335

seq1  TAATATTTGGTGTAAAAAGCCATTCAGGCTCTGGCTCCCTGGATGTTGAT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATATTTGGTGTAAAAAGCCATTCAGGCTCTGGCTCCCTGGATGTTGAT  385

seq1  GGTTCCCTGGCTGTTGGTTCAATCCCTGTGAGCCCCTGTGAGCCCAGGCT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCCCTGGCTGTTGGTTCAATCCCTGTGAGCCCCTGTGAGCCCAGGCT  435

seq1  AGTTGATTCTGTGGGTTTTCTTGTGATGTGATATAAGTTCTTGACCCCTG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGATTCTGTGGGTTTTCTTGTGATGTGATATAAGTTCTTGACCCCTG  485

seq1  TGAAGCCTACCGTCTCCCCCTCCCCGCCCCCTTGTCCAGGATTCCCCAAG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCCTACCGTCTCCCCCTCCCCGCCCCCTTGTCCAGGATTCCCCAAG  535

seq1  CTCTGCTGAATGTTTGGCTGTGGGTAGTAGAGTTTAGTTTTAATTAATTG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCTGAATGTTTGGCTGTGGGTAGTAGAGTTTAGTTTTAATTAATTG  585

seq1  GCTTTAAAATTGCTTTTATAATAATTATTACATATTCATGACCTAACATA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTAAAATTGCTTTTATAATAATTATTACATATTCATGACCTAACATA  635

seq1  TACTTCAAAGAACATAAAATGAAAGATGGAAGTCTGGCTTCCTGTTTGGG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTCAAAGAACATAAAATGAAAGATGGAAGTCTGGCTTCCTGTTTGGG  685

seq1  GAAATTACCTGATTTGGTGTAAACTCAGCCTAAGAGAAGCCATGGTGTGC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATTACCTGATTTGGTGTAAACTCAGCCTAAGAGAAGCCATGGTGTGC  735

seq1  CTATGATGAATAACTTCACTTATGGTCAATTGGTTTTCACCATGGATGTA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATGATGAATAACTTCACTTATGGTCAATTGGTTTTCACCATGGATGTA  785

seq1  AAAAAATACCAACAGAGGACTTTTTTCAACAAGTCACACAAAATTAACTA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAATACCAACAGAGGACTTTTTTCAACAAGTCACACAAAATTAACTA  835

seq1  GTAATACACACACACACACACACTGCAAAGAGAAGGCAGAACCTCCCATT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATACACACACACACACACACTGCAAAGAGAAGGCAGAACCTCCCATT  885

seq1  ACACTAGATAAAAATGACTAGCCCTGGTAGACTATACCCTAGAGATGAAA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTAGATAAAAATGACTAGCCCTGGTAGACTATACCCTAGAGATGAAA  935

seq1  AAAAAAAAAGCTGTAAAATTCATAGGCAAAAGCAGTAAAAAAAACAAAAA  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAGCTGTAAAATTCATAGGCAAAAGCAGTAAAAAAAACAAAAA  985

seq1  CAAAAACAAAAACTGAATTC  1018
      ||||||||||||||||||||
seq2  CAAAAACAAAAACTGAATTC  1005

seq1: chr10_82169783_82170838
seq2: B6Ng01-312G09.g_63_1115

seq1  GAATTCATTTCCTGGAAGAATATGTATGCTCTTAACCATTGAGCCATCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTTCCTGGAAGAATATGTATGCTCTTAACCATTGAGCCATCTC  50

seq1  TCCAGCCCCTAAACTTTGAAATCTTCTGATCAGAAATGTTTTGCTTTCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGCCCCTAAACTTTGAAATCTTCTGATCAGAAATGTTTTGCTTTCTC  100

seq1  TCCTTGTACTTGAGTAAAATATTAATAGGAAATTGAATGGATTGGTACAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGTACTTGAGTAAAATATTAATAGGAAATTGAATGGATTGGTACAA  150

seq1  GTGACATTTTGGAATTGGGAGATAGCTCAACAGGCTAAGCTCTTGCCAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACATTTTGGAATTGGGAGATAGCTCAACAGGCTAAGCTCTTGCCAGT  200

seq1  TGGAGGACCTTGGGTTTGGATGTCCAGAACCTACATAAAAAATATCATGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGACCTTGGGTTTGGATGTCCAGAACCTACATAAAAAATATCATGT  250

seq1  AATTCCAGCTGATAGCAGGCAGAAACAGAAAAACTCTGGGCAAGAGTTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCCAGCTGATAGCAGGCAGAAACAGAAAAACTCTGGGCAAGAGTTTT  300

seq1  TCTTGCCAAAACCAACCAAGTTTCAGGTTCAGGAACAGACTGCCTCAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCCAAAACCAACCAAGTTTCAGGTTCAGGAACAGACTGCCTCAGTT  350

seq1  GTACGAGGCAGAGAGTGACTGAGGGGAACCCAGTGCCATTCTCCTGTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACGAGGCAGAGAGTGACTGAGGGGAACCCAGTGCCATTCTCCTGTTTA  400

seq1  TGCATGTGCACATATATGTGCCCGCATGTATGTGCCCACATGTACATGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGTGCACATATATGTGCCCGCATGTATGTGCCCACATGTACATGCA  450

seq1  TTTGCAGAGAAAACAAAAGTGTGTTAAAAAATAGGTCACAGATTAATGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCAGAGAAAACAAAAGTGTGTTAAAAAATAGGTCACAGATTAATGAA  500

seq1  AGCTTTTCAAGAAAAGAAGCTGGTTAGAACAAAGTTAGTGTCGGTTTCTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTTTCAAGAAAAGAAGCTGGTTAGAACAAAGTTAGTGTCGGTTTCTA  550

seq1  AGTTAAAGACACGTTTTAGGATAGTGCTGTGACATTTTGTAGTGTGCCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAAAGACACGTTTTAGGATAGTGCTGTGACATTTTGTAGTGTGCCAA  600

seq1  GAAAGCTGCGAAGGAAGCAGTGCTTATTCCAGATAGCAGTGGCATCAAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGCTGCGAAGGAAGCAGTGCTTATTCCAGATAGCAGTGGCATCAAAT  650

seq1  ATTGGCCAAAATCGTGACCATAATAACTGTTATCTAGTGCTGTGTAATAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGCCAAAATCGTGACCATAATAACTGTTATCTAGTGCTGTGTAATAA  700

seq1  ACTAATGATACAAAATAGTAACTTGTATTGTGTTCACAGACACTGTAAGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAATGATACAAAATAGTAACTTGTATTGTGTTCACAGACACTGTAAGT  750

seq1  AAGATGATTAGGGCACAGAAGACATGGCTAAACCCTTTAGTGAGAAACCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATGATTAGGGCACAGAAGACATGGCTAAACCCTTTAGTGAGAAACCT  800

seq1  TAAATGGTCATCCCCACATCTGATAGTTAACTGAGGTAACTG-AAGGATA  849
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TAAATGGTCATCCCCACATCTGATAGTTAACTGAGGTAACTGAAAGGATA  850

seq1  GATTCAACTGGGCTATCACCTAACAAGCCTCTACAAATGGCTTTTTTTTT  899
      |||||||||||||||||||||||||||||||||||||||||    |||||
seq2  GATTCAACTGGGCTATCACCTAACAAGCCTCTACAAATGGC----TTTTT  896

seq1  TTTTTTTTTTTTTTTTTTTTTTTTGGAG-ACAGGATC-TCAAATAGAACC  947
      ||||| |||||||| |||||| |||||| |||||||| |||||||||| |
seq2  TTTTTCTTTTTTTTCTTTTTTCTTGGAGAACAGGATCTTCAAATAGAA-C  945

seq1  CTGGCTGGCTTTGGACTATGTAGCTAAG-AGTAACCTTGAACTTCTGGTC  996
      ||||||||| |||||||||||||||||| ||||||| ||||||||| |||
seq2  CTGGCTGGC-TTGGACTATGTAGCTAAGAAGTAACCCTGAACTTCTTGTC  994

seq1  ACCCTGTTGTACCTT-GTGACTGCTGAGATTATAGGCATGTGTCACTGTG  1045
      |||||| |||||||| ||||||||||||| |||| |||||||||||||||
seq2  ACCCTG-TGTACCTTGGTGACTGCTGAGAATATACGCATGTGTCACTGTG  1043

seq1  CTTGGGATGTG  1056
      | |  ||||||
seq2  CCT-AGATGTG  1053

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information