MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-332L04
Chromosome	10 (Build37)
Map Location	120,922,571 - 121,029,716
singlet/doublet	doublet
Overlap gene	LOC100043500, Tbk1, Xpot
Upstream gene	LOC100042902, Msrb3, LOC100043488, Lemd3, Wif1, LOC100042911, 4930505D03Rik, LOC100043498, Gns, Rassf3
Downstream gene	D930020B18Rik, BC048403, Srgap1, EG216394, LOC668272, Tmem5, LOC100043513, LOC668275, Avpr1a
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Msrb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320183 MGI:2443538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Lemd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380664 MGI:3580376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24117 MGI:1344332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042911 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4930505D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74694 MGI:1921944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 43 ESTs, 2 Proteins

name	LOC100043498 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 271 ESTs, 10 Proteins pseudo : _no_value

name	Gns (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75612 MGI:1922862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rassf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192678 MGI:2179722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56480 MGI:1929658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpot (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73192 MGI:1920442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D930020B18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216393 MGI:2442001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270802 MGI:2670984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117600 MGI:2152936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG216394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216394 MGI:3648715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins

name	LOC668272 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Tmem5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216395 MGI:2384919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043513 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC668275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 133 ESTs, 22 Proteins pseudo : _no_value

name	Avpr1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54140 MGI:1859216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042902 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261085 GeneID:100042902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042902 transcript_id : XM_001479027.1

name	Msrb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793434 GeneID:320183 MGI:2443538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine sulfoxide reductase B3 transcript_id : NM_177092.3

name	LOC100043488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261195 GeneID:100043488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043488 transcript_id : XM_001480758.1

name	Lemd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487118 GeneID:380664 MGI:3580376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LEM domain containing 3 transcript_id : NM_001081193.1

name	Wif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755998 GeneID:24117 MGI:1344332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wnt inhibitory factor 1 transcript_id : NM_011915.1

name	LOC100042911 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261087 GeneID:100042911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042911 transcript_id : XM_001479048.1

name	4930505D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261089 GeneID:74694 MGI:1921944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 43 ESTs, 2 Proteins product : RIKEN cDNA 4930505D03 gene transcript_id : XM_137322.8

name	Gns (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803025 GeneID:75612 MGI:1922862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosamine (N-acetyl)-6-sulfatase transcript_id : NM_029364.2

name	Rassf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129986 GeneID:192678 MGI:2179722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 3 transcript_id : NM_138956.3

name	LOC100043500 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261198 GeneID:100043500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043500 transcript_id : XM_001480773.1

name	Tbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366446 GeneID:56480 MGI:1929658
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TANK-binding kinase 1 transcript_id : NM_019786.3

name	Xpot (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486685 GeneID:73192 MGI:1920442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin, tRNA (nuclear export receptor for tRNAs) transcript_id : NM_001081056.1

name	D930020B18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119433658 GeneID:216393 MGI:2442001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D930020B18 gene transcript_id : NM_177335.3

name	BC048403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41055589 GeneID:270802 MGI:2670984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048403 transcript_id : NM_173022.2

name	Srgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486649 GeneID:117600 MGI:2152936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLIT-ROBO Rho GTPase activating protein 1 transcript_id : NM_001081037.1

name	EG216394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261091 GeneID:216394 MGI:3648715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : predicted gene, EG216394 transcript_id : XM_137324.2

name	LOC668272 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261093 GeneID:668272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical LOC668272 transcript_id : XM_001479108.1

name	Tmem5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346448 GeneID:216395 MGI:2384919
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 5 transcript_id : NM_153059.1

name	LOC100043513 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261201 GeneID:100043513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043513 transcript_id : XM_001480792.1

name	Avpr1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33149328 GeneID:54140 MGI:1859216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin receptor 1A transcript_id : NM_016847.2

name	LOC100042902 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261086 GeneID:100042902
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479077.1

name	Msrb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893017 CCDS:CCDS24208.1 GeneID:320183 MGI:2443538
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0000318 - protein-methionine-R-oxide reductase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] GO_process : GO:0030091 - protein repair [Evidence ISS] codon_start : 1 product : methionine-R-sulfoxide reductase B3 protein_id : NP_796066.1

name	LOC100043488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261196 GeneID:100043488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480808.1

name	Lemd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487119 GeneID:380664 MGI:3580376
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : integral inner nuclear membrane protein MAN1 product : LEM domain containing 3 protein_id : NP_001074662.1

name	Wif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755999 CCDS:CCDS24209.1 GeneID:24117 MGI:1344332
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0017147 - Wnt-protein binding [Evidence ISS] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : Wnt inhibitory factor 1 protein_id : NP_036045.1

name	LOC100042911 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261088 GeneID:100042911
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479098.1

name	4930505D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261090 GeneID:74694 MGI:1921944
definition	codon_start : 1 product : hypothetical protein LOC74694 protein_id : XP_137322.8

name	Gns (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789239 CCDS:CCDS24210.1 GeneID:75612 MGI:1922862
definition	GO_function : GO:0008449 - N-acetylglucosamine-6-sulfatase activity [Evidence IEA]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] GO_process : GO:0030203 - glycosaminoglycan metabolism [Evidence IEA] codon_start : 1 product : glucosamine (N-acetyl)-6-sulfatase protein_id : NP_083640.1

name	Rassf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20336742 CCDS:CCDS24211.1 GeneID:192678 MGI:2179722
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Ras association domain family 3 product : Ras association (RalGDS/AF-6) domain family 3 protein_id : NP_620406.1

name	LOC100043500 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261199 GeneID:100043500
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480823.1

name	Tbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981041 CCDS:CCDS24212.1 GeneID:56480 MGI:1929658
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TANK binding kinase TBK1 product : TANK-binding kinase 1 protein_id : NP_062760.2

name	Xpot (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486686 GeneID:73192 MGI:1920442
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : exportin, tRNA (nuclear export receptor for tRNAs) protein_id : NP_001074525.1

name	D930020B18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119433659 GeneID:216393 MGI:2442001
definition	codon_start : 1 product : hypothetical protein LOC216393 protein_id : NP_796309.2

name	BC048403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41055590 CCDS:CCDS24213.1 GeneID:270802 MGI:2670984
definition	codon_start : 1 product : hypothetical protein LOC270802 protein_id : NP_766610.2

name	Srgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486650 GeneID:117600 MGI:2152936
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005100 - Rho GTPase activator activity [Evidence IDA]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0016477 - cell migration [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Rho GTPase activating protein 13 product : SLIT-ROBO Rho GTPase activating protein 1 protein_id : NP_001074506.1

name	EG216394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261092 GeneID:216394 MGI:3648715
definition	codon_start : 1 product : similar to SUMO-1-specific protease protein_id : XP_137324.2

name	LOC668272 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261094 GeneID:668272
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479158.1

name	Tmem5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346449 CCDS:CCDS24214.1 GeneID:216395 MGI:2384919
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : transmembrane protein 5 protein_id : NP_694699.1

name	LOC100043513 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261202 GeneID:100043513
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480842.1

name	Avpr1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33149329 CCDS:CCDS24215.1 GeneID:54140 MGI:1859216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : V1a arginine vasopressin receptor; vascular/hepatic-type arginine vasopressin receptor; antidiuretic hormone receptor 1a product : arginine vasopressin receptor 1A protein_id : NP_058543.2

name	LOC100043498 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261197 GeneID:100043498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 271 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_034829.1

name	LOC668275 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261200 GeneID:668275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 133 ESTs, 22 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034838.1

clone name	MSMg01-455P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-332L04.b	B6Ng01-332L04.g
ACC	GA118722	GA118723
length	1,112	1,051
definition	B6Ng01-332L04.b	B6Ng01-332L04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(120,922,571 - 120,923,696)	(121,028,675 - 121,029,716)
sequence	gaattccagacaagcacacacataatcaatagaattccagacaagcacac acataatcaatagaattccagacaagcacacacataatcaatagaattcc agcttctctcagaaagcaaaaccacaccaacacttattattttggcaaat ataaagggttctcaaaagtcctcggagatcaaaagtcccgagagccgttc atcaaatagttggaggtcttactaggtgagcacactttgatgaggaaagt actgtgtttttgagactaggtctgactgggtatcctagcctagcctcaga ctcaccagatagttaaagataaccctgggctcctcctcttcctcttcctc ttcctcttcctcttcctcttcctcttcctcttcctccccctcctttcctt ctcccctctcccccttccccccaagcatctcactatgtagctccagctgt catggatctcactctatagaccaggctggcctcaaacgcacagagacctg cctgcttctgcctcctgagctaccacacgtgggaaccctgaacttctggt cctgctactgtcacctccaagtgttgggattgtaagtgtgtgccaccatg ctccatctatgtggtgctgcggatcagggtgctcacccctcttatttcca ccgaattggcactgtgtccaagacaataccacacacaactgaagaaaccc tatagaaagggggaaatgtaaagtacttgctatgtttttgtttttttttt tttttcagaaaccttttccgtaaagaaggcctcttggccttccctgaaca tcacttgagcgcttactgtatactagacactgttctgttctagaactttg atctgtgggaactcactgactccttattacttcccggggcgaccctgacc aaagggcagtgtgtgcagccaggaatgacagggttatcttcacaccttga ggtcacctccgaaccactgtgtaccttgtccgtggggtcagtcacttgag gaagagtcagtcagcctcaaagaaaaaaaatcaggtttctgcgcccacaa tgatttactcgtattgactacatctgatgcagagatgtgcgtttggtgag ggatgaaaatat	gaattcttaaatcaagagctggaggtgggtcagtggtagaacactgccta gcacgtacaattcctgggttcaattcctagcatggcaaaacacccacaag gaaactaaatagaagttaactagcatttgccttccttcagttgtgcattg tctcttgttagttaccagccgaaggaagcatgcttttcttaagtttgggg gaagcatccacagaaacgaggaaagcatcttcggaagtagccgaagcctt gcttaggtggggttgctgtgggccctgcactgcaagcttgtgctgagtct gtctgcgtgtgcatcacactgacagaggctcggctcagcttccagtgaca gccgtttcttgggattagtaccttaattttctttccttttatgaaacttt aaagttctttatgaaatgcagcagtggaaaactgactaacaaatcgaatg taaagttgggaatgttcggttctgtgtgtgtagacacataagctgtgggg taacaatcaaaactttcatagatatctttcatagatagccattacatttc tttaaatatttcaatgccaatgtgtattctataagagaatagcttcctaa ttaagtcggtttagaagcaggtgctggtgtcaacacattttttataaaaa ataaattctacatagtgaaatataccaagtcttttccagaattattacaa agagcctccttttcccaccttagggttttttttttttcttaagaattttt tacattatgtatgtaagtattctatctgcttttacatctgcatgccagaa agggggggggggcatcagatgccattacagatggttgtgagccaccccgt ggttgctgggaaataaacctcaggaagcgtgtccattaacccataatggc ctgaaccatctctccctgctagcaatgtttctaggtgattggaaaccggt aatttggtgccgttgttttccagagctggcttgtcacttgctgactggct tccgtatatcttctcagtgtccttcccatcttccagcagagctgacgaga t
quality values	Open. Hide. 46 23 35 41 62 62 31 12 56 47 51 31 47 51 62 56 62 42 62 47 54 43 59 51 51 59 59 43 30 34 23 18 27 23 46 43 59 59 43 59 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 54 54 62 62 62 59 62 62 59 62 62 59 59 59 62 51 43 48 45 50 36 56 51 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 56 48 28 42 43 48 56 59 59 59 62 59 62 62 59 62 59 62 62 59 59 59 46 46 49 42 56 62 59 62 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 51 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 62 62 62 62 56 41 62 62 62 62 42 41 62 62 62 62 62 62 62 62 62 36 31 62 62 52 62 62 62 62 62 54 62 54 62 62 46 50 54 58 52 58 58 54 58 58 54 52 54 54 49 54 58 58 52 58 54 52 58 52 58 58 54 37 45 46 39 52 54 30 26 47 52 54 52 54 58 50 42 58 49 52 48 52 54 45 52 48 52 54 52 45 21 54 52 48 58 54 54 54 54 46 43 50 58 49 58 48 47 52 46 49 32 51 49 45 46 31 51 51 46 41 45 39 48 30 48 42 50 32 50 50 58 58 58 50 40 58 50 48 50 44 49 51 46 49 52 50 49 50 49 39 58 54 54 54 58 54 40 36 47 22 29 54 44 53 32 32 42 52 58 40 43 52 40 37 46 27 43 50 54 51 25 22 58 58 58 58 58 58 58 58 58 43 50 50 43 13 20 29 21 51 47 26 41 40 32 50 54 52 45 52 32 29 39 50 40 31 51 32 6 18 10 46 37 39 44 37 37 37 25 22 44 53 24 46 15 24 32 42 17 27 26 42 31 37 38 45 45 42 32 28 40 31 28 16 31 21 32 32 52 28 34 32 20 33 27 32 23 42 25 32 29 32 47 25 34 27 28 39 24 48 28 31 34 21 34 34 31 34 47 8 9 18 26 28 31 41 15 27 40 17 33 28 31 26 26 32 25 25 31 33 25 17 20 33 27 29 21 36 33 48 31 31 30 17 40 33 22 48 46 37 23 8 27 21 42 32 32 31 31 25 31 12 46 31 31 48 29 21 27 21 30 26 23 26 14 27 31 31 23 32 24 17 13 30 30 33 31 30 25 24 24 7 33 24 20 39 21 24 18 21 31 27 10 10 14 31 10 6 6 9 14 7 35 11 10 12 17 19 16 8 6 7 13 23 29 22 13 16 9 27 13 24 20 21 13 20 11 25 11 6 27 17 7 11 28 39 36 16 5 24 8 6 9 14 16 6 8 22 15 31 23 22 4 16 21 21 10 9 7 9 6 5 31 22 19 24 9 15 24 16 28 7 5 14 38 28 29 33 34 27 18 20 28 19 15 8 11 33 7 27 15 15 21 7 16 38 14 9 6 18 27 19 17 15 7 34 16 23 24 7 5 5 3 4 5 18 14 24 10 10 3 3 6 8 8 7 13 23 13 8 6 9 3 7 4 10 4 5 17 16 16 12 22 21 5 6 7 4 6 8 7 27 17 8 9 12 20 16 30 20 5 4 3	Open. Hide. 62 47 39 47 62 62 20 26 17 15 15 21 19 14 19 21 50 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 62 62 62 62 59 62 62 62 62 59 51 34 40 45 40 28 35 50 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 51 54 42 43 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 54 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 54 62 62 62 62 62 47 42 62 62 62 43 62 62 49 47 62 62 54 62 52 62 62 52 58 52 58 45 41 58 46 58 58 58 52 58 54 58 58 48 54 58 58 52 58 54 52 58 48 58 54 54 46 58 58 32 54 39 21 49 52 58 54 58 52 43 52 58 54 52 41 38 41 52 54 52 54 58 58 58 58 54 52 49 58 58 58 58 58 52 52 41 58 54 54 58 52 54 46 52 39 53 42 54 51 58 58 58 50 46 50 50 53 52 50 46 42 45 50 41 39 58 58 51 50 41 40 42 58 38 40 50 46 42 25 39 41 25 58 50 46 58 39 41 58 44 42 43 49 58 58 53 31 50 29 23 42 50 58 50 48 27 58 25 18 58 58 58 58 58 58 58 49 46 43 51 42 53 29 28 52 21 51 42 35 58 58 58 58 31 31 50 18 52 53 42 34 53 42 39 37 50 34 41 41 39 52 32 34 40 42 33 39 49 52 34 52 29 20 42 54 38 32 37 34 49 45 39 39 39 32 37 37 29 21 22 16 51 54 37 32 54 54 54 54 54 54 54 54 51 40 11 29 34 33 34 11 41 24 32 37 21 21 25 28 26 35 15 16 23 9 9 19 16 42 31 14 16 29 22 34 28 13 25 52 52 39 33 26 38 40 46 18 30 21 33 32 40 23 11 52 16 53 10 52 8 14 31 29 31 21 31 18 22 30 19 26 17 20 33 31 36 19 12 15 27 10 11 42 30 18 7 6 14 14 26 37 32 7 8 23 18 11 9 9 36 29 26 18 21 30 26 46 46 29 9 25 17 32 28 25 33 22 11 20 19 31 46 29 31 21 21 11 17 26 30 20 15 30 7 18 10 23 30 7 26 7 26 11 26 8 17 37 31 10 8 12 23 10 46 22 7 5 8 6 32 39 32 10 18 25 9 37 9 6 10 11 19 11 18 11 36 6 6 7 24 15 7 11 15 15 20 21 9 7 17 23 15 16 18 33 31 26 31 9 6 25 15 16 6 21 19 6 13 4 5 5 13 4 10 29 5 4 5 31 24 23 13 11 23 11 15 16 9 6 30 6 4 5 15 6 4 9 28 7 8 25 6 8 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_120922571_120923696
seq2: B6Ng01-332L04.b_46_1157

seq1  GAATTCCAGACAAGCACACACATAATCAATAGAATTCCAGACAAGCACAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGACAAGCACACACATAATCAATAGAATTCCAGACAAGCACAC  50

seq1  ACATAATCAATAGAATTCCAGACAAGCACACACATAATCAATAGAATTCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATAATCAATAGAATTCCAGACAAGCACACACATAATCAATAGAATTCC  100

seq1  AGCTTCTCTCAGAAAGCAAAACCACACCAACACTTATTATTTTGGCAAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTCTCTCAGAAAGCAAAACCACACCAACACTTATTATTTTGGCAAAT  150

seq1  ATAAAGGGTTCTCAAAAGTCCTCGGAGATCAAAAGTCCCGAGAGCCGTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAGGGTTCTCAAAAGTCCTCGGAGATCAAAAGTCCCGAGAGCCGTTC  200

seq1  ATCAAATAGTTGGAGGTCTTACTAGGTGAGCACACTTTGATGAGGAAAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAATAGTTGGAGGTCTTACTAGGTGAGCACACTTTGATGAGGAAAGT  250

seq1  ACTGTGTTTTTGAGACTAGGTCTGACTGGGTATCCTAGCCTAGCCTCAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTGTTTTTGAGACTAGGTCTGACTGGGTATCCTAGCCTAGCCTCAGA  300

seq1  CTCACCAGATAGTTAAAGATAACCCTGGGCTCCTCCTCTTCCTCTTCCTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACCAGATAGTTAAAGATAACCCTGGGCTCCTCCTCTTCCTCTTCCTC  350

seq1  TTCCTCTTCCTCTTCCTCTTCCTCTTCCTCTTCCTCCCCCTCCTTTCCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCTTCCTCTTCCTCTTCCTCTTCCTCTTCCTCCCCCTCCTTTCCTT  400

seq1  CTCCCCTCTCCCCCTTCCCCCCAAGCATCTCACTATGTAGCTCCAGCTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCCTCTCCCCCTTCCCCCCAAGCATCTCACTATGTAGCTCCAGCTGT  450

seq1  CATGGATCTCACTCTATAGACCAGGCTGGCCTCAAACGCACAGAGACCTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGATCTCACTCTATAGACCAGGCTGGCCTCAAACGCACAGAGACCTG  500

seq1  CCTGCTTCTGCCTCCTGAGCTACCACACGTGGGAACCCTGAACTTCTGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTTCTGCCTCCTGAGCTACCACACGTGGGAACCCTGAACTTCTGGT  550

seq1  CCTGCTACTGTCACCTCCAAGTGTTGGGATTGTAAGTGTGTGCCACCATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTACTGTCACCTCCAAGTGTTGGGATTGTAAGTGTGTGCCACCATG  600

seq1  CTCCATCTATGTGGTGCTGCGGATCAGGGTGCTCACCCCTCTTATTTCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCATCTATGTGGTGCTGCGGATCAGGGTGCTCACCCCTCTTATTTCCA  650

seq1  CCGAATTGGCACTGTGTCCAAGACAATACCACACACAACTGAAGAAACCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGAATTGGCACTGTGTCCAAGACAATACCACACACAACTGAAGAAACCC  700

seq1  TATAGAAAGGGGGAAATGTAAAGTACTTGCTATGTTTTTGTTTTTTTTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGAAAGGGGGAAATGTAAAGTACTTGCTATGTTTTTGTTTTTTTTTT  750

seq1  TTTTTCAGAAACCTTTTCCGTAAAGAAGGCCTCTTGGCCTTCCCTGAACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTCAGAAACCTTTTCCGTAAAGAAGGCCTCTTGGCCTTCCCTGAACA  800

seq1  TCACTTGAGCGCTTACTGTATACTAGACACTGTTCTGTTCTAGAACTTTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTGAGCGCTTACTGTATACTAGACACTGTTCTGTTCTAGAACTTTG  850

seq1  ATCTGTGGGAACTCACTGACTCCTTATTAACTTCCCGGGGCGACCCTGAC  900
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  ATCTGTGGGAACTCACTGACTCCTTATT-ACTTCCCGGGGCGACCCTGAC  899

seq1  CAAAGGGCAGTGTGTGCAGCCAGGAATGACAGGGTTATCTTCACACC-TG  949
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  CAAAGGGCAGTGTGTGCAGCCAGGAATGACAGGGTTATCTTCACACCTTG  949

seq1  AGGTCACCTTCGAACCACTGTGTACCTTGCCCGTGGGGCCCAGTCACTTG  999
      ||||||||| ||||||||||||||||||| ||||||||  ||||||||||
seq2  AGGTCACCTCCGAACCACTGTGTACCTTGTCCGTGGGG-TCAGTCACTTG  998

seq1  AGGGAAAGAGTCAGCCAGCCTCAAAGAAAAAAAATCCAGGTTTCTGCCGC  1049
      |||  ||||||||| |||||||||||||||||||| |||||||||| |||
seq2  AGG--AAGAGTCAGTCAGCCTCAAAGAAAAAAAAT-CAGGTTTCTG-CGC  1044

seq1  CCACAAATGATTTACTCGGTATTGACTTAACATCTGATGCAAGAGATGTT  1099
      |||| |||||||||||| |||||||||  ||||||||||| ||||||| |
seq2  CCAC-AATGATTTACTC-GTATTGACT--ACATCTGATGC-AGAGATG-T  1088

seq1  GCGTTTGTGTGAGGGGATGAGAAATAT  1126
      ||||||| |||| ||||||| ||||||
seq2  GCGTTTG-GTGA-GGGATGA-AAATAT  1112

seq1: chr10_121028675_121029716
seq2: B6Ng01-332L04.g_70_1120 (reverse)

seq1  ATCT-GTCAGCCTGGCTGGGAGATGGGAAGGGACACTGAGGAAGATTAAC  49
      |||| ||||||   ||||| ||||||||| ||||||||| ||||||  ||
seq2  ATCTCGTCAGCTCTGCTGGAAGATGGGAA-GGACACTGA-GAAGATATAC  48

seq1  GGAAGCC-GTCAGC-AGTGACCAGCCAGCTCTGG-AAACAACGGGCACAA  96
      ||||||| |||||| |||||| |||||||||||| |||||||||   |||
seq2  GGAAGCCAGTCAGCAAGTGACAAGCCAGCTCTGGAAAACAACGGCACCAA  98

seq1  A-TACC-GTTTCCAATCA-CTAGAAACA-TGCTAGCAGGGGAGAGATGGT  142
      | |||| ||||||||||| ||||||||| |||||||| ||||||||||||
seq2  ATTACCGGTTTCCAATCACCTAGAAACATTGCTAGCA-GGGAGAGATGGT  147

seq1  TCA-GCCATTATGGG-TAATGGACACGCTTCCTGAGG-TTAATTCCCAGC  189
      ||| ||||||||||| ||||||||||||||||||||| ||| ||||||||
seq2  TCAGGCCATTATGGGTTAATGGACACGCTTCCTGAGGTTTATTTCCCAGC  197

seq1  AACCACGGGGTGGCTCACAACCATCTGTAATGGCATCTGATG-CCCCCCC  238
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AACCACGGGGTGGCTCACAACCATCTGTAATGGCATCTGATGCCCCCCCC  247

seq1  CCCTTTCTGGCATGCAGATGTAAAAGCAGATAGAATACTTACATACATAA  288
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTTCTGGCATGCAGATGTAAAAGCAGATAGAATACTTACATACATAA  297

seq1  TGTAAAAAATTCTTAAGAAAAAAAAAAAACCCTAAGGTGGGAAAAGGAGG  338
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAAAAATTCTTAAGAAAAAAAAAAAACCCTAAGGTGGGAAAAGGAGG  347

seq1  CTCTTTGTAATAATTCTGGAAAAGACTTGGTATATTTCACTATGTAGAAT  388
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTGTAATAATTCTGGAAAAGACTTGGTATATTTCACTATGTAGAAT  397

seq1  TTATTTTTTATAAAAAATGTGTTGACACCAGCACCTGCTTCTAAACCGAC  438
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTTTTATAAAAAATGTGTTGACACCAGCACCTGCTTCTAAACCGAC  447

seq1  TTAATTAGGAAGCTATTCTCTTATAGAATACACATTGGCATTGAAATATT  488
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTAGGAAGCTATTCTCTTATAGAATACACATTGGCATTGAAATATT  497

seq1  TAAAGAAATGTAATGGCTATCTATGAAAGATATCTATGAAAGTTTTGATT  538
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGAAATGTAATGGCTATCTATGAAAGATATCTATGAAAGTTTTGATT  547

seq1  GTTACCCCACAGCTTATGTGTCTACACACACAGAACCGAACATTCCCAAC  588
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACCCCACAGCTTATGTGTCTACACACACAGAACCGAACATTCCCAAC  597

seq1  TTTACATTCGATTTGTTAGTCAGTTTTCCACTGCTGCATTTCATAAAGAA  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACATTCGATTTGTTAGTCAGTTTTCCACTGCTGCATTTCATAAAGAA  647

seq1  CTTTAAAGTTTCATAAAAGGAAAGAAAATTAAGGTACTAATCCCAAGAAA  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAAAGTTTCATAAAAGGAAAGAAAATTAAGGTACTAATCCCAAGAAA  697

seq1  CGGCTGTCACTGGAAGCTGAGCCGAGCCTCTGTCAGTGTGATGCACACGC  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCTGTCACTGGAAGCTGAGCCGAGCCTCTGTCAGTGTGATGCACACGC  747

seq1  AGACAGACTCAGCACAAGCTTGCAGTGCAGGGCCCACAGCAACCCCACCT  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAGACTCAGCACAAGCTTGCAGTGCAGGGCCCACAGCAACCCCACCT  797

seq1  AAGCAAGGCTTCGGCTACTTCCGAAGATGCTTTCCTCGTTTCTGTGGATG  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAAGGCTTCGGCTACTTCCGAAGATGCTTTCCTCGTTTCTGTGGATG  847

seq1  CTTCCCCCAAACTTAAGAAAAGCATGCTTCCTTCGGCTGGTAACTAACAA  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCCCAAACTTAAGAAAAGCATGCTTCCTTCGGCTGGTAACTAACAA  897

seq1  GAGACAATGCACAACTGAAGGAAGGCAAATGCTAGTTAACTTCTATTTAG  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACAATGCACAACTGAAGGAAGGCAAATGCTAGTTAACTTCTATTTAG  947

seq1  TTTCCTTGTGGGTGTTTTGCCATGCTAGGAATTGAACCCAGGAATTGTAC  988
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTTGTGGGTGTTTTGCCATGCTAGGAATTGAACCCAGGAATTGTAC  997

seq1  GTGCTAGGCAGTGTTCTACCACTGACCCACCTCCAGCTCTTGATTTAAGA  1038
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTAGGCAGTGTTCTACCACTGACCCACCTCCAGCTCTTGATTTAAGA  1047

seq1  ATTC  1042
      ||||
seq2  ATTC  1051

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information