MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-051N06
Chromosome	10 (Build37)
Map Location	61,412,456 - 61,412,590
singlet/doublet	singlet
Overlap gene	Col13a1
Upstream gene	Pcbd1, Sgpl1, 1700021K02Rik, Adamts14, Prf1, EG237361, X99384, Nodal, Eif4ebp2, D830039M14Rik, Lrrc20, Npffr1, Ppa1, Sar1a, Tysnd1, Aifm2, H2afy2, LOC100039284
Downstream gene	EG436164, EG432466, 2010107G23Rik, Neurog3, Tspan15, Tacr2, Hk1, 2210417K05Rik, Hkdc1, Supv3l1, Vps26a, Srgn, 2510003E04Rik, Ddx21, Ddx50, Stox1, Ccar1, Cxxc6, Slc25a16, Dna2l
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pcbd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13180 MGI:94873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20397 MGI:1261415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65971 MGI:1923820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 6 mRNAs

name	Adamts14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237360 MGI:2179942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18646 MGI:97551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG237361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237361 MGI:3645354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 674 ESTs, 8 Proteins

name	X99384 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27355 MGI:1351623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nodal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18119 MGI:97359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4ebp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13688 MGI:109198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830039M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320949 MGI:2445111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs

name	Lrrc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216011 MGI:2387182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npffr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237362 MGI:2685082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 Proteins

name	Ppa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67895 MGI:97831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sar1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20224 MGI:98230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tysnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71767 MGI:1919017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 5 Proteins

name	Aifm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71361 MGI:1918611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	H2afy2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404634 MGI:3037658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Col13a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12817 MGI:1277201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436164 MGI:3644575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 109 ESTs, 12 Proteins pseudo : _no_value

name	EG432466 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432466 MGI:3643173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 526 ESTs, 6 Proteins pseudo : _no_value

name	2010107G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69894 MGI:1917144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neurog3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11925 MGI:893591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70423 MGI:1917673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tacr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21337 MGI:98477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15275 MGI:96103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210417K05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70162 MGI:1917412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Hkdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216019 MGI:2384910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supv3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338359 MGI:2441711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps26a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30930 MGI:1353654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19073 MGI:97756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510003E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72320 MGI:1919570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56200 MGI:1860494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94213 MGI:2182303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216021 MGI:2684909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 3 Proteins

name	Ccar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67500 MGI:1914750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxxc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52463 MGI:1098693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 133 ESTs, 2 Proteins

name	Slc25a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73132 MGI:1920382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dna2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327762 MGI:2443732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892664 GeneID:13180 MGI:94873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 transcript_id : NM_025273.2

name	Sgpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543693 GeneID:20397 MGI:1261415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine phosphate lyase 1 transcript_id : NM_009163.2

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079690 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017433.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079688 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017419.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079698 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017441.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079694 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_023064.3

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079696 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017409.1

name	1700021K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079692 GeneID:65971 MGI:1923820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K02 gene transcript_id : NM_001017407.1

name	Adamts14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487464 GeneID:237360 MGI:2179942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 transcript_id : NM_001081127.1

name	Prf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34808711 GeneID:18646 MGI:97551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : perforin 1 (pore forming protein) transcript_id : NM_011073.2

name	EG237361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388218 GeneID:237361 MGI:3645354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 674 ESTs, 8 Proteins product : predicted gene, EG237361 transcript_id : XM_137118.7

name	X99384 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305364 GeneID:27355 MGI:1351623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence X99384 transcript_id : NM_013753.1

name	Nodal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62996442 GeneID:18119 MGI:97359
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nodal transcript_id : NM_013611.3

name	Eif4ebp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129916 GeneID:13688 MGI:109198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E binding protein 2 transcript_id : NM_010124.2

name	Lrrc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956307 GeneID:216011 MGI:2387182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 20 transcript_id : NM_153542.1

name	Npffr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82933095 GeneID:237362 MGI:2685082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 Proteins product : neuropeptide FF receptor 1 transcript_id : XM_137119.4

name	Ppa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802132 GeneID:67895 MGI:97831
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrophosphatase (inorganic) 1 transcript_id : NM_026438.3

name	Sar1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130548 GeneID:20224 MGI:98230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAR1 gene homolog A (S. cerevisiae) transcript_id : NM_009120.2

name	Tysnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388223 GeneID:71767 MGI:1919017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 5 Proteins product : trypsin domain containing 1, transcript variant 1 transcript_id : XM_125636.3

name	Aifm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359615 GeneID:71361 MGI:1918611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 2 transcript_id : NM_001039194.2

name	Aifm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130271 GeneID:71361 MGI:1918611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 2 transcript_id : NM_178058.3

name	Aifm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418884 GeneID:71361 MGI:1918611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 2 transcript_id : NM_153779.1

name	H2afy2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892300 GeneID:404634 MGI:3037658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2A histone family, member Y2 transcript_id : NM_207000.2

name	LOC100039284 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260898 GeneID:100039284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : similar to TBP-associated factor 4 transcript_id : XM_001472609.1

name	Col13a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131174 GeneID:12817 MGI:1277201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XIII, alpha 1 transcript_id : NM_007731.2

name	2010107G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364488 GeneID:69894 MGI:1917144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010107G23 gene transcript_id : NM_027251.3

name	Neurog3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351623 GeneID:11925 MGI:893591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurogenin 3 transcript_id : NM_009719.5

name	Tspan15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347497 GeneID:70423 MGI:1917673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 15 transcript_id : NM_197996.2

name	Tacr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802904 GeneID:21337 MGI:98477
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tachykinin receptor 2 transcript_id : NM_009314.3

name	Hk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388724 GeneID:15275 MGI:96103
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexokinase 1 transcript_id : NM_010438.2

name	2210417K05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260911 GeneID:70162 MGI:1917412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2210417K05 gene transcript_id : XM_001474070.1

name	Hkdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703835 GeneID:216019 MGI:2384910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexokinase domain containing 1 transcript_id : NM_145419.1

name	Supv3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340650 GeneID:338359 MGI:2441711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of var1, 3-like 1 (S. cerevisiae) transcript_id : NM_181423.2

name	Vps26a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130955 GeneID:30930 MGI:1353654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 26 homolog A (yeast) transcript_id : NM_133672.2

name	Srgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129990 GeneID:19073 MGI:97756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serglycin transcript_id : NM_011157.2

name	2510003E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384370 GeneID:72320 MGI:1919570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510003E04 gene transcript_id : NM_028197.2

name	Ddx21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384373 GeneID:56200 MGI:1860494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 transcript_id : NM_019553.2

name	Ddx50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351139 GeneID:94213 MGI:2182303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 transcript_id : NM_053183.2

name	Stox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388229 GeneID:216021 MGI:2684909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 3 Proteins product : storkhead box 1 transcript_id : XM_125685.5

name	Ccar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801893 GeneID:67500 MGI:1914750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle and apoptosis regulator 1 transcript_id : NM_026201.2

name	Cxxc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260917 GeneID:52463 MGI:1098693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 133 ESTs, 2 Proteins product : CXXC finger 6, transcript variant 1 transcript_id : XM_125673.7

name	Slc25a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340837 GeneID:73132 MGI:1920382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 transcript_id : NM_175194.2

name	Dna2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376001 GeneID:327762 MGI:2443732
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA2 DNA replication helicase 2-like (yeast) transcript_id : NM_177372.2

name	Pcbd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384608 GeneID:13180 MGI:94873
definition	GO_component : GO:0005634 - nucleus [Evidence IPI] GO_function : GO:0008124 - 4-alpha-hydroxytetrahydrobiopterin dehydratase activity [Evidence IEA]; GO:0004505 - phenylalanine 4-monooxygenase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051291 - protein heterooligomerization [Evidence IPI]; GO:0051289 - protein homotetramerization [Evidence IPI] codon_start : 1 note : dimerization cofactor of hepatocyte nuclear factor-1-alpha; 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) product : pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 protein_id : NP_079549.1

name	Sgpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543694 GeneID:20397 MGI:1261415
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0008117 - sphinganine-1-phosphate aldolase activity [Evidence IEA] [Evidence ISS]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0019752 - carboxylic acid metabolism [Evidence IEA]; GO:0006672 - ceramide metabolism [Evidence ISS]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0030149 - sphingolipid catabolism [Evidence ISS] codon_start : 1 note : sphingosine-1-phosphate lyase 1 product : sphingosine phosphate lyase 1 protein_id : NP_033189.2

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079691 CCDS:CCDS23873.1 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 1 protein_id : NP_001017433.1

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079689 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 2 protein_id : NP_001017419.1

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079695 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 3 is encoded by transcript variant 3; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 3 protein_id : NP_075551.3 transl_except : (pos:60638093..60638095,aa:Met)

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079693 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 5 is encoded by transcript variant 5; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 5 protein_id : NP_001017407.1 transl_except : (pos:60638093..60638095,aa:Met)

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079699 CCDS:CCDS23874.1 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 4 is encoded by transcript variant 4; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 4 protein_id : NP_001017441.1 transl_except : (pos:60638093..60638095,aa:Met)

name	1700021K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079697 GeneID:65971 MGI:1923820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 exception : alternative start codon note : isoform 6 is encoded by transcript variant 6; stromal protein associated with thymii and lymph nodes; thymus and testis specific nuclear protein product : stromal protein associated with thymii and lymph nodes isoform 6 protein_id : NP_001017409.1 transl_except : (pos:60638093..60638095,aa:Met)

name	Adamts14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487465 GeneID:237360 MGI:2179942
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0017074 - procollagen N-endopeptidase activity [Evidence IDA] GO_process : GO:0030199 - collagen fibril organization [Evidence IDA] codon_start : 1 note : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14 product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 protein_id : NP_001074596.1

name	Prf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34808712 CCDS:CCDS23875.1 GeneID:18646 MGI:97551
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : pore forming protein product : perforin 1 protein_id : NP_035203.2

name	EG237361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933068 GeneID:237361 MGI:3645354
definition	codon_start : 1 product : similar to ribosomal protein L27a-like protein_id : XP_137118.4

name	X99384 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305365 CCDS:CCDS23877.1 GeneID:27355 MGI:1351623
definition	codon_start : 1 exception : mismatches in translation product : paladin protein_id : NP_038781.1

name	Nodal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305317 CCDS:CCDS23878.1 GeneID:18119 MGI:97359
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0016477 - cell migration [Evidence IMP]; GO:0042074 - cell migration involved in gastrulation [Evidence IDA]; GO:0007368 - determination of left/right symmetry [Evidence IMP] [Evidence IGI] [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0001947 - heart looping [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0002085 - repression of premature neural plate formation [Evidence IMP]; GO:0019827 - stem cell maintenance [Evidence IMP] [Evidence IGI]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence ISS] codon_start : 1 exception : mismatches in translation note : early embryo mesoderm formation; transgenic lethal 413.d product : nodal protein_id : NP_038639.1

name	Eif4ebp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753742 CCDS:CCDS23879.1 GeneID:13688 MGI:109198
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008190 - eukaryotic initiation factor 4E binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0019933 - cAMP-mediated signaling [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045947 - negative regulation of translational initiation [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence TAS] codon_start : 1 product : eukaryotic translation initiation factor 4E binding protein 2 protein_id : NP_034254.1

name	Lrrc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956308 CCDS:CCDS23881.1 GeneID:216011 MGI:2387182
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 20 protein_id : NP_705770.1

name	Npffr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933096 GeneID:237362 MGI:2685082
definition	codon_start : 1 product : similar to RFamide-related peptide receptor protein_id : XP_137119.4

name	Ppa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754065 CCDS:CCDS23882.1 GeneID:67895 MGI:97831
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016462 - pyrophosphatase activity [Evidence IDA] GO_process : GO:0006796 - phosphate metabolism [Evidence IC] codon_start : 1 product : pyrophosphatase protein_id : NP_080714.2

name	Sar1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703344 CCDS:CCDS23883.1 GeneID:20224 MGI:98230
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0016529 - sarcoplasmic reticulum [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 note : SAR1a gene homolog 1 product : SAR1a gene homolog protein_id : NP_033146.1

name	Tysnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260906 GeneID:71767 MGI:1919017
definition	codon_start : 1 product : trypsin domain containing 1 isoform 1 protein_id : XP_125636.3

name	Aifm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418885 GeneID:71361 MGI:1918611
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence ISS]; GO:0050660 - FAD binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death product : apoptosis-inducing factor (AIF)-like mitchondrion-associated inducer of death isoform 1 protein_id : NP_722474.1

name	Aifm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861162 CCDS:CCDS23884.1 GeneID:71361 MGI:1918611
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence ISS]; GO:0050660 - FAD binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death product : apoptosis-inducing factor (AIF)-like mitchondrion-associated inducer of death isoform 2 protein_id : NP_001034283.1

name	Aifm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017355 CCDS:CCDS23884.1 GeneID:71361 MGI:1918611
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence ISS]; GO:0050660 - FAD binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death product : apoptosis-inducing factor (AIF)-like mitchondrion-associated inducer of death isoform 2 protein_id : NP_835159.1

name	H2afy2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46250738 CCDS:CCDS23885.1 GeneID:404634 MGI:3037658
definition	GO_component : GO:0001740 - Barr body [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007549 - dosage compensation [Evidence ISS]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : H2A histone family, member Y2 protein_id : NP_996883.1

name	LOC100039284 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260899 GeneID:100039284
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472659.1

name	Col13a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680962 GeneID:12817 MGI:1277201
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005911 - intercellular junction [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : type XIII collagen product : procollagen, type XIII, alpha 1 protein_id : NP_031757.1

name	2010107G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312460 CCDS:CCDS23886.1 GeneID:69894 MGI:1917144
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC69894 protein_id : NP_081527.1

name	Neurog3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560622 CCDS:CCDS23887.1 GeneID:11925 MGI:893591
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IMP]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : atonal homolog 5 product : neurogenin 3 protein_id : NP_033849.2

name	Tspan15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347498 GeneID:70423 MGI:1917673
definition	codon_start : 1 note : transmembrane 4 superfamily member 15 product : tetraspanin 15 protein_id : NP_932113.2

name	Tacr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981975 GeneID:21337 MGI:98477
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tachykinin NK-2 receptor; 7 transmembrane receptor product : tachykinin receptor 2 protein_id : NP_033340.2

name	Hk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754206 GeneID:15275 MGI:96103
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence TAS] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence TAS] codon_start : 1 exception : mismatches in translation note : downeast anemia product : hexokinase 1 protein_id : NP_034568.1

name	2210417K05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260912 GeneID:70162 MGI:1917412
definition	codon_start : 1 product : hypothetical protein LOC70162 protein_id : XP_001474120.1

name	Hkdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703836 CCDS:CCDS23888.1 GeneID:216019 MGI:2384910
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : hexokinase domain containing 1 protein_id : NP_663394.1

name	Supv3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088872 GeneID:338359 MGI:2441711
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : suppressor of var1, 3-like 1 protein_id : NP_852088.1

name	Vps26a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526826 GeneID:30930 MGI:1353654
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005768 - endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0042147 - retrograde transport, endosome to Golgi [Evidence IDA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vacuole protein sorting 26; H beta 58 product : vacuolar protein sorting 26 protein_id : NP_598433.1

name	Srgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6997243 CCDS:CCDS23889.1 GeneID:19073 MGI:97756
definition	codon_start : 1 note : proteoglycan, secretory granule product : proteoglycan 1, secretory granule protein_id : NP_035287.1

name	2510003E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384371 CCDS:CCDS23890.1 GeneID:72320 MGI:1919570
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72320 protein_id : NP_082473.2

name	Ddx21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384374 CCDS:CCDS23891.1 GeneID:56200 MGI:1860494
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence ISS] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21 (RNA helicase II/Gu); RH II/Gu; RH-II/Gualpha product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 protein_id : NP_062426.2

name	Ddx50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716475 CCDS:CCDS23892.1 GeneID:94213 MGI:2182303
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : RH-II/Gubeta; nucleolar protein GU2; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 50 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 protein_id : NP_444413.1

name	Stox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38090490 GeneID:216021 MGI:2684909
definition	codon_start : 1 product : storkhead box 1 protein_id : XP_125685.3

name	Ccar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563288 GeneID:67500 MGI:1914750
definition	GO_component : GO:0005641 - nuclear envelope lumen [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence ISS] codon_start : 1 product : cell division cycle and apoptosis regulator 1 protein_id : NP_080477.1

name	Cxxc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933099 GeneID:52463 MGI:1098693
definition	codon_start : 1 product : CXXC finger 6 isoform 1 protein_id : XP_125673.5

name	Slc25a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424808 CCDS:CCDS23893.1 GeneID:73132 MGI:1920382
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 protein_id : NP_780403.1

name	Dna2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849783 GeneID:327762 MGI:2443732
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DNA2 DNA replication helicase 2-like protein_id : NP_796346.1

name	D830039M14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260905 GeneID:320949 MGI:2445111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs product : RIKEN cDNA D830039M14 gene transcript_id : XR_035206.1

name	EG436164 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260907 GeneID:436164 MGI:3644575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 109 ESTs, 12 Proteins product : predicted gene, EG436164 pseudo : _no_value transcript_id : XR_001738.2

name	EG432466 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84579875 GeneID:432466 MGI:3643173
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 526 ESTs, 6 Proteins product : predicted gene, EG432466 pseudo : _no_value transcript_id : NR_002687.1

clone name	MSMg01-325B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-293N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-051N06.T7 (MSMg01no051_n06.b1)	MSMg01-051N06.TJ (MSMg01no051_n06.g1)
ACC	AG280477	AG280478
length	1,444	773
length of high quality (start - end)	48 (131 - 178)	135 (176 - 310)
definition	CHROMAT_FILE: MSMg01no051_n06.b1 PHD_FILE: MSMg01no051_n06.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 16:52:04 2005	CHROMAT_FILE: MSMg01no051_n06.g1 PHD_FILE: MSMg01no051_n06.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 16:52:04 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	ATTGGGCGCTATXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCTTCAT ACGGAAAAACACCTTTTACTCCTTATTTGCTTATAGACTTGGTGGTTTAT TTATTTTAAAGTACACTTACCCCCCCCCATTTTATATTTTGAATTTTATC TGAATATTGTTGTCTCCCCGTTTTTTCACTGTCGTGACTTATACCTATTA TAACAACTTATTTTTTGAGGCATGCTCTCTCCTTTACTCAGTTTGGCTAA CTCGATAGCCCCCAAGTTCCCGTTTAGTTTCTGTCCTTGCCTCCCCTCCA TCTTGTTCTAGTGTGTGTTTTTGTCTTTCTACTTTCTTTCTTCTTTTTCC TTTTTCCTTCTTTTTATTATTTTTTTCTTTTTACTTCTCCTTTTTTTTTT CTTTTCCATTTTCTATATCCTATTTTCTTTTTTTATCTTTTTCCTCTCCC TTTTTTTTTTTTTCCCCCCCCCCCTTTTCTCCTTTTCTTTCTCTTCCCAA CCAAAAATAATGTTTTGTTTCTTTTCTTTTTTTTTCTTTTTTTTCTCCTT TTTCTCTCTCTTTCTCTACATCTTTTTTTTTTTATTATTTTTTTTTTTTA TTATTTTTTTTTTTTTCTTTTCTTCTCTATTCTCTTTATTCCTTATTTTT TCTTCTTTCTATTTCTCTCTTTCTTTTTTTTATTTTCCCTTTTTTTTATT ATTTCTTTTTTCTTTTCTCTCCTTTTTGTCTTTTCTTTCTCTTCTTATAT TTTTCTCTTTTTTCTTTTTTTTTCTTTTACTTCTTAGCTATTGTTTCTTT TTCTCCTCTTATTCTTCTTTTCCCTTATTTTTTCTCACTCTTTTTTCTCT TTCCTTCTCTTTTTATCTTATTTTTTTCTTCCTTTTCTTTCCTCTTTCTT TTTCCTTTTTTCCCTTTTTCTTTTTTCTCTTTTTCTCCTTTTTCTTTTTT CCTTCTTTTTTCCTACTCACCTCTCTCTCTCTCTCTTCCACTCTCCTTCT TTCTTTCTCTTTTTCTTTTCATCTGTCTTCTTTTTTTCTTTTCTCTCTCT TCCATCTCTTCTTCTTCTTGTCTTTATCTTTCTCTCTTCTTTCTTCTTCT TTCTCCGTTCCTCTTCTTCTTTTCTCTTTCCTCTTCCTTCTTCTCTCTCT TTTGCTTTTCTCCTTTCTTCTCTACTTCCTCTTCTCTCTTCTCCTTCTTC CTTTTCTTCTTCTCTTCTCCTCCTTTAACCTCTTATATTCTTTCTCTTTT CTTTTTCTTTATTCTCTTTTCTTTTACTAATTCTCCTCTATTTCTTATCT CTTTTTCTTTTTATTATTACATTTTATTTTCTTCTTTTCTTTCTTCTATT TTTTNTTCTTGTTTATTTATTTTCGCCTTCTTCTTTTATTTTTAAATATT TCTTTGTCTTCTTCTTCTCACTTCTTTCTTTTCATTTTCTCTTT	GGTTGTTTTTTTTTGTTTTTTTGGGGGGGGGGGGGGGGNNNTTTNTTTTC CTCTTTATTCCCGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCAATGGAGGGGCCAACTG GCGCCCTGACTGCACTAGCACAGAGCCTTTCTTCGTTTCCCATAGCAACC TACAGTCTGCTTTCTACTAATAGCTGAGATGTAGCCGAGTCTCCTCTCCC TGACACTTCCCATGTGCACAGCACAGCTGGTCAGGAGCTGTCAGAGCAGA TTAATTTGTATAAGATGGAAGCTCATATAGGAAATACATTTTCCAGGATT GAGAGTCCTCATGGAACTGATACTCCTTTTTTGGCTCCTCACGCCACGGC AAATGCCGTCATCCTATCCCCGAGAGCAGTTGGCTTCTCCCCTGCTTTAG CTCCCTGATCGTGTCGTCTTTCCCCCCCGCCCCTCCATGGTGTTTATTTC TTATATTTGTACTCACCTTGCTTTCCTTCTTGGTTAGCCTTGGCTCCTAT TTTCCCAGTTTATTCTTTTTTCCCTGTCAAATTCTTCCCCTCTTTGCTTC CCCTGCTCCTCTGTTTCTTCTACTTGTCTCTTTTTCTTTCTCACCTTCTC TCTTGTTTTTTTTTCTTCTTTACTTTCTTCGTATCATCTTCTTGTTCTTC TTCCTTTCCTTTCTTTTCTTATCTTGCTTTTTCTTTCCCTCTTCTTCTTT CTCCCCTTTTTTGTTTTCTTTCN
quality values	Open. Hide. 11 11 11 11 10 11 15 15 9 9 9 9 9 16 15 21 22 22 19 16 14 16 16 19 26 35 36 34 34 34 34 39 40 40 40 28 18 18 13 12 24 27 39 47 37 27 19 11 11 20 23 37 37 46 46 43 27 18 11 9 11 11 16 12 8 9 8 8 8 8 10 19 15 15 13 18 23 25 37 28 28 29 34 34 30 34 43 43 38 29 24 16 16 12 13 19 34 34 30 25 18 9 9 11 12 16 16 16 11 10 10 10 10 10 10 12 12 22 14 9 9 11 12 16 15 20 23 23 14 14 22 23 29 31 35 30 28 24 19 21 35 35 35 39 39 43 43 43 48 48 37 37 28 40 40 43 40 39 39 39 30 30 22 28 32 32 32 20 20 20 31 26 23 25 11 11 11 11 9 12 10 10 10 12 18 20 21 21 22 21 18 11 13 13 17 19 12 11 11 14 11 11 11 21 15 18 22 32 28 23 23 31 32 32 32 18 21 12 12 15 13 11 11 11 11 11 15 22 24 20 20 20 28 30 24 20 15 19 12 13 14 13 24 15 11 10 10 11 12 12 13 14 9 9 12 12 9 9 11 10 8 8 8 8 8 8 8 8 8 10 10 11 11 12 13 12 19 19 18 11 11 18 18 11 11 10 10 8 10 10 6 6 8 10 8 8 7 9 10 11 8 8 8 8 8 11 11 23 20 12 11 11 11 11 18 12 11 10 10 10 17 10 13 11 11 9 8 10 8 8 8 9 9 8 11 10 8 8 8 9 8 8 6 6 8 8 8 8 8 11 11 17 14 16 12 12 10 10 9 9 9 9 10 15 13 13 12 11 11 11 10 10 12 12 12 9 11 10 10 8 8 6 6 8 8 11 12 12 13 11 16 19 20 17 19 16 14 17 8 9 9 9 13 12 11 11 11 10 10 10 10 9 8 8 8 8 12 8 10 9 9 9 9 10 10 14 12 15 21 16 14 10 14 9 10 10 10 10 10 8 8 8 8 8 8 11 11 10 10 8 10 9 11 19 23 33 33 33 27 17 12 10 10 10 13 18 20 19 19 16 18 12 9 9 9 8 8 6 6 8 8 9 10 10 8 8 8 8 8 8 8 13 19 15 15 10 8 8 6 6 6 8 8 12 13 12 9 9 9 9 11 11 10 12 11 6 6 8 8 10 10 22 20 20 11 11 12 22 22 24 18 11 10 12 9 9 11 17 21 15 15 9 10 8 8 8 8 8 9 8 10 10 10 11 8 8 8 13 8 10 10 11 9 9 8 8 8 8 8 6 6 8 8 9 9 9 10 13 12 9 10 13 10 12 10 9 9 9 12 12 11 10 10 10 11 10 10 10 6 6 8 8 10 10 10 15 15 14 12 12 10 9 9 12 12 11 8 6 8 8 8 8 8 9 16 9 9 9 9 8 8 8 8 8 8 8 8 6 6 8 8 10 8 8 10 10 10 12 8 8 6 7 10 10 10 11 10 12 12 15 13 8 10 7 6 8 8 9 15 11 10 11 7 6 8 8 8 10 8 8 8 8 8 10 16 15 13 14 15 15 12 14 14 14 12 10 8 6 6 6 6 8 8 11 10 9 13 12 9 8 8 10 10 8 8 8 8 8 12 8 8 8 10 10 17 11 8 8 6 7 8 8 10 10 10 13 10 11 10 10 10 10 9 8 8 8 8 6 6 10 10 10 8 8 8 8 8 8 10 14 14 14 10 11 10 16 15 15 13 13 10 8 8 8 8 11 11 6 7 8 10 9 9 9 10 9 9 9 9 9 9 9 9 7 10 8 10 10 8 8 8 6 6 8 8 9 9 8 8 6 8 8 8 10 8 8 10 10 10 11 10 10 10 10 8 8 8 8 11 10 10 8 8 8 8 6 6 6 6 8 8 8 13 12 8 8 7 7 10 8 8 10 10 10 10 9 7 11 8 10 10 12 17 11 8 9 9 9 9 9 11 11 10 10 8 8 8 8 8 8 8 6 6 10 10 10 10 8 8 8 8 8 8 8 8 8 10 12 12 12 10 12 10 10 9 10 13 11 9 11 9 9 9 11 11 15 19 10 8 6 6 8 8 12 10 10 8 8 8 8 10 10 10 8 8 8 10 7 9 10 10 10 10 8 8 8 10 12 9 9 9 9 9 8 8 8 8 8 8 13 10 11 11 11 9 9 11 9 6 8 8 10 7 6 8 8 10 10 11 13 15 15 17 18 16 12 8 8 6 6 6 7 10 8 8 8 8 10 21 13 10 10 10 10 12 10 10 7 6 8 8 12 12 12 12 10 11 11 17 8 8 6 6 8 8 6 7 8 10 10 9 9 11 10 8 8 12 13 12 8 8 9 8 8 8 6 6 8 8 15 10 11 8 6 6 8 8 8 8 8 10 10 10 8 8 8 7 7 6 6 6 7 7 13 8 8 9 11 9 10 9 12 12 8 8 6 7 10 8 9 9 10 10 12 13 16 14 13 13 11 10 8 15 10 8 8 7 7 8 9 10 17 15 12 11 10 8 6 6 7 10 8 8 6 6 10 10 13 8 8 8 8 8 8 6 7 8 6 6 7 8 9 9 13 10 8 8 8 6 7 11 11 9 9 9 12 12 13 15 13 9 9 10 10 10 10 10 8 8 8 8 8 9 9 9 10 8 8 8 12 8 8 8 13 8 10 10 8 8 8 8 8 8 8 8 6 6 8 10 14 15 14 12 12 11 8 8 6 6 10 10 12 8 8 8 6 7 10 12 16 17 13 10 8 8 8 8 8 8 8 11 11 15 8 8 8 8 8 8 13 15 15 10 11 11 15 12 8 8 10 8 10 8 12 10 10 10 11 14 11 12 10 12 15 12 10 8 8 10 8 8 8 11 10 11 8 8 6 6 6 6 6 6 10 8 10 10 10 8 8 8 8 8 8 6 8 8 8 8 11 13 13 15 8 9 9 9 13 10 8 8 8 8 8 8 8 6 8 6 6 6 6 10 8 14 12 12 12 8 10 12 15 15 11 11 11 10 10 6 6 8 13 10 8 8 10 9 9 9 13 18 15 15 3 0 3 8 6 8 6 6 8 15 11 10 9 14 9 9 9 15 15 9 9 9 9 8 8 6 7 11 13 9 9 13 15 14 14 14 10 8 7 6 6 8 6 8 11 12 13 10 11 8 8 8 8 8 13 11 9 9 10 10 8 10 10 8 8 6 6 8 6 10 10 9 9 8 10 8 8 10 12 8 8 8 8 10 13 13 11 11 11 10 10	Open. Hide. 6 6 6 8 8 8 11 22 24 24 21 16 12 9 9 12 17 19 33 33 29 28 18 24 19 10 10 10 22 22 11 10 10 8 8 7 7 3 0 0 0 3 7 3 0 3 7 7 8 8 8 8 8 10 16 11 9 8 6 6 6 6 6 8 10 8 9 9 10 17 11 9 9 9 17 16 39 37 37 33 33 33 32 39 39 39 39 23 18 8 8 10 8 7 10 9 10 11 12 12 22 21 37 30 39 27 23 11 11 11 18 21 47 47 25 25 9 10 8 8 8 8 25 23 39 32 20 24 28 29 29 24 20 18 18 31 32 31 33 28 28 16 23 11 11 11 25 25 37 35 35 35 37 42 26 27 15 15 9 23 23 33 28 28 20 29 30 18 16 19 29 27 23 12 13 13 30 36 28 30 30 44 27 42 37 37 43 44 57 57 57 57 57 43 43 43 44 44 47 32 32 33 22 22 17 17 17 34 34 54 54 57 57 57 57 57 57 57 52 52 52 52 43 43 32 38 16 32 32 50 42 36 32 27 27 32 43 32 38 16 16 36 32 42 33 42 43 57 57 57 50 43 43 37 37 40 40 32 36 28 23 20 28 27 36 21 18 14 14 15 18 26 13 13 18 28 32 30 30 25 36 32 37 37 37 36 36 25 30 24 24 18 17 30 30 41 37 35 32 32 37 37 30 30 26 32 26 20 14 14 15 15 19 20 23 32 23 18 18 13 13 13 15 24 15 24 12 15 12 12 12 12 12 13 10 8 8 8 13 19 36 34 34 28 23 21 15 15 19 24 24 25 25 21 28 24 35 25 29 19 20 19 19 19 16 17 17 18 23 15 11 11 12 10 10 10 10 13 12 10 8 8 8 8 9 22 25 25 28 13 13 13 24 18 14 13 22 19 28 25 33 29 35 35 35 37 30 24 14 14 14 8 12 8 8 8 12 18 22 16 15 15 11 11 11 12 11 9 9 9 9 9 11 12 12 14 19 19 15 15 8 8 8 8 8 10 30 25 16 10 9 13 11 12 13 24 19 21 16 18 15 15 11 11 11 15 9 11 10 15 13 10 10 11 11 14 10 10 10 10 12 10 8 8 8 8 8 8 8 8 8 9 9 13 13 12 10 8 8 8 8 8 8 8 8 8 11 10 10 8 8 8 6 6 8 8 8 8 6 6 10 8 8 8 10 15 12 15 15 11 12 9 12 11 12 12 8 8 8 12 8 8 8 8 8 8 8 10 9 9 10 8 13 13 10 8 8 8 8 8 11 8 8 8 6 6 8 8 8 8 8 8 8 8 9 9 9 11 11 11 8 8 6 6 8 8 8 8 10 13 10 10 10 9 10 10 10 8 8 8 10 10 10 10 8 8 8 8 10 8 10 10 8 8 8 15 12 12 12 10 10 8 6 6 8 8 6 6 6 6 10 11 12 13 11 9 10 8 8 8 8 8 8 11 8 8 8 8 8 8 8 8 10 6 9 10 10 11 12 13 12 11 11 10 10 10 8 8 8 9 8 8 8 10 10 10 11 8 8 8 8 8 8 8 8 8 8 9 8 8 8 8 6 6 8 8 8 8 8 8 8 10 8 8 8 8 8 10 10 17 20 21 23 19 13 8 8 8 8 10 12 9 8 8 8 10 11 12 15 18 13 14 14 19 22 14 12 12 8 8 8 8 9 13 10 10 9 8 8 8 8 8 8 8 8 10 14 21 18 11 8 7 7 7 8 8 6 6 8 8 8 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no051_n06.g1 MSMg01no051_n06.g1 CHROMAT_FILE:
MSMg01no051_n06.g1 PHD_FILE: MSMg01no051_n06.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 16:52:04 2005
         (135 letters)



>mm_chr10_61412256_61412790
          Length = 535

 Score =  261 bits (135), Expect = 1e-74
 Identities = 135/135 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   cctttcttcgtttcccatagcaacctacagtctgctttctactaatagctgagatgtagc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 cctttcttcgtttcccatagcaacctacagtctgctttctactaatagctgagatgtagc 260

                                                                       
Query: 61  cgagtctcctctccctgacacttcccatgtgcacagcacagctggtcaggagctgtcaga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 cgagtctcctctccctgacacttcccatgtgcacagcacagctggtcaggagctgtcaga 320

                          
Query: 121 gcagattaatttgta 135
           |||||||||||||||
Sbjct: 321 gcagattaatttgta 335


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 135
Length of database: 535
Length adjustment: 8
Effective length of query: 127
Effective length of database: 527
Effective search space:    66929
Effective search space used:    66929
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information