MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-486K08
Chromosome	10 (Build37)
Map Location	81,066,204 - 81,066,841
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Scamp4, Csnk1g2, Btbd2, Mknk2, Mobkl2a, 9030607L17Rik, Ap3d1, Dot1l, Plekhj1, Sf3a2, Amh, Jsrp1, Oaz1, BC072620, Lsm7, 3110056O03Rik, Tmprss9, Timm13, Lmnb2, Gadd45b, Gng7, LOC100042403, Diras1, Slc39a3, Sgta, Thop1, Creb3l3, Map2k2, Zbtb7a, Pias4, Eef2, Dapk3, Itgb1bp3, Atcay, 9130206N08Rik, Matk, Mrpl54, Apba3, Tjp3, Pip5k1c, 2510012J08Rik, Tbxa2r, Gipc3, Hmg20b, F630110N24Rik, 4930404N11Rik, Fzr1, Dohh, 2210404O07Rik, Nfic, Brunol5, Ncln, Edg6, Gna15, Gna11, Aes, Tle2, Tle6
Downstream gene	BC025920, Sirt6, Ankrd24, LOC100040916, EG666448, EG666458, LOC666711, LOC382388, LOC100040944, EG210583, EG666738, EG666501, 1700123A16Rik, LOC666753, EG666537, BC062127, EG666542, EG666548, EG666790, LOC666571, AL117821, BC062115, 4933439G19Rik, BC024063, AU041133, LOC100042712, B230315N10Rik, LOC100042718, EG237412, LOC666611, Gm1553, LOC544716
Link	Open Mouse BAC browser

Click to get alignment info.

name	Scamp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56214 MGI:1928947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk1g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103236 MGI:1920014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208198 MGI:1933831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 124 ESTs, 22 Proteins

name	Mknk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17347 MGI:894279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobkl2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208228 MGI:3050117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030607L17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71564 MGI:1918814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap3d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11776 MGI:107734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dot1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208266 MGI:2143886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78670 MGI:1925920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20222 MGI:104912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11705 MGI:88006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jsrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71912 MGI:1916700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oaz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18245 MGI:109433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC072620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237403 MGI:3609246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66094 MGI:1913344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110056O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73218 MGI:1920468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432478 MGI:3612246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30055 MGI:1353432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmnb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16907 MGI:96796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gadd45b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17873 MGI:107776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gng7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14708 MGI:95787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Diras1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208666 MGI:2183442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106947 MGI:2147269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52551 MGI:1098703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50492 MGI:1354165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creb3l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208677 MGI:2384786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26396 MGI:1346867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16969 MGI:1335091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pias4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59004 MGI:2136940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eef2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13629 MGI:95288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13144 MGI:1203520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb1bp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69564 MGI:1916814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atcay (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16467 MGI:2448730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130206N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103406 MGI:2143792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17179 MGI:99259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66047 MGI:1913297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apba3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57267 MGI:1888527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tjp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27375 MGI:1351650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18717 MGI:1298224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510012J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70312 MGI:1917562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbxa2r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21390 MGI:98496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gipc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209047 MGI:2387006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmg20b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15353 MGI:1341190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F630110N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73822 MGI:3604804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930404N11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432479 MGI:1921072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fzr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56371 MGI:1926790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dohh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102115 MGI:1915964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210404O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72273 MGI:1919523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 1 Protein

name	Nfic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18029 MGI:109591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Brunol5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319586 MGI:2442333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins

name	Ncln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103425 MGI:1926081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13611 MGI:1333809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gna15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14676 MGI:95770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gna11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14672 MGI:95766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aes (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14797 MGI:95806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tle2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21886 MGI:104635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tle6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114606 MGI:2149593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025920 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268319 MGI:2670983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50721 MGI:1354161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70615 MGI:1890394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040916 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG666448 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666448 MGI:3645531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 927 ESTs, 9 Proteins

name	EG666458 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666458 MGI:3648799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 9 Proteins pseudo : _no_value

name	LOC382388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100040944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein

name	EG210583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210583 MGI:3644409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs

name	EG666738 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666738 MGI:3647363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 979 ESTs, 9 Proteins

name	EG666501 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666501 MGI:3647467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 982 ESTs, 9 Proteins

name	1700123A16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73610 MGI:1920860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs

name	LOC666753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 9 Proteins pseudo : _no_value

name	EG666537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666537 MGI:3644502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	BC062127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331188 MGI:3696710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666542 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666542 MGI:3647888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG666548 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666548 MGI:3647883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 927 ESTs, 9 Proteins

name	EG666790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666790 MGI:3648461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 764 ESTs, 9 Proteins

name	LOC666571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	AL117821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404580 MGI:3034336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	BC062115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408062 MGI:3040689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933439G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414080 MGI:3041160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC024063 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666584 MGI:2670978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein

name	AU041133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216177 MGI:2143755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC100042712 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	B230315N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237411 MGI:3621440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100042718 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG237412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237412 MGI:3643133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	LOC666611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	Gm1553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432480 MGI:2686399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 1 Protein

name	LOC544716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 167 ESTs, 12 Proteins pseudo : _no_value

name	Scamp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46593030 GeneID:56214 MGI:1928947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 4 transcript_id : NM_019575.4

name	Csnk1g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527223 GeneID:103236 MGI:1920014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, gamma 2 transcript_id : NM_134002.1

name	Btbd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388451 GeneID:208198 MGI:1933831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 124 ESTs, 22 Proteins product : BTB (POZ) domain containing 2, transcript variant 3 transcript_id : XM_001000710.1

name	Mknk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892866 GeneID:17347 MGI:894279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP kinase-interacting serine/threonine kinase 2 transcript_id : NM_021462.3

name	Mobkl2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249074 GeneID:208228 MGI:3050117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MOB1, Mps One Binder kinase activator-like 2A (yeast) transcript_id : NM_172457.2

name	9030607L17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886472 GeneID:71564 MGI:1918814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030607L17 gene transcript_id : NM_027829.3

name	Ap3d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671564 GeneID:11776 MGI:107734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 3, delta 1 subunit transcript_id : NM_007460.1

name	Dot1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556380 GeneID:208266 MGI:2143886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DOT1-like, histone H3 methyltransferase (S. cerevisiae) transcript_id : NM_199322.1

name	Plekhj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469026 GeneID:78670 MGI:1925920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family J member 1 transcript_id : NM_023900.1

name	Sf3a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296887 GeneID:20222 MGI:104912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3a, subunit 2 transcript_id : NM_013651.3

name	Amh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861193 GeneID:11705 MGI:88006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anti-Mullerian hormone transcript_id : NM_007445.2

name	Jsrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363261 GeneID:71912 MGI:1916700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctional sarcoplasmic reticulum protein 1 transcript_id : NM_028001.2

name	Oaz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93141218 GeneID:18245 MGI:109433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine decarboxylase antizyme transcript_id : NM_008753.4

name	BC072620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701455 GeneID:237403 MGI:3609246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC072620 transcript_id : NM_001013758.1

name	Lsm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73808095 GeneID:66094 MGI:1913344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_025349.2

name	3110056O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116805337 GeneID:73218 MGI:1920468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110056O03 gene transcript_id : NM_175195.3

name	Tmprss9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157516 GeneID:432478 MGI:3612246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 9 transcript_id : NM_001081688.1

name	Timm13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386021 GeneID:30055 MGI:1353432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 13 homolog (yeast) transcript_id : NM_013895.3

name	Lmnb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195685 GeneID:16907 MGI:96796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lamin B2 transcript_id : NM_010722.5

name	Gadd45b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678979 GeneID:17873 MGI:107776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest and DNA-damage-inducible 45 beta transcript_id : NM_008655.1

name	Gng7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579918 GeneID:14708 MGI:95787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 7 subunit transcript_id : NM_010319.3

name	Gng7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579914 GeneID:14708 MGI:95787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 7 subunit transcript_id : NM_001038655.1

name	Diras1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254099 GeneID:208666 MGI:2183442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIRAS family, GTP-binding RAS-like 1 transcript_id : NM_145217.2

name	Slc39a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527367 GeneID:106947 MGI:2147269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 3 transcript_id : NM_134135.1

name	Sgta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313587 GeneID:52551 MGI:1098703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha transcript_id : NM_024499.1

name	Thop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801686 GeneID:50492 MGI:1354165
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thimet oligopeptidase 1 transcript_id : NM_022653.3

name	Creb3l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802442 GeneID:208677 MGI:2384786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein 3-like 3 transcript_id : NM_145365.3

name	Map2k2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581583 GeneID:26396 MGI:1346867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 2 transcript_id : NM_023138.3

name	Zbtb7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647237 GeneID:16969 MGI:1335091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 7a transcript_id : NM_010731.3

name	Pias4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378150 GeneID:59004 MGI:2136940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 4 transcript_id : NM_021501.3

name	Eef2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859481 GeneID:13629 MGI:95288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 2 transcript_id : NM_007907.1

name	Dapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681132 GeneID:13144 MGI:1203520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death-associated kinase 3 transcript_id : NM_007828.1

name	Itgb1bp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803550 GeneID:69564 MGI:1916814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 1 binding protein 3 transcript_id : NM_027120.2

name	Atcay (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372103 GeneID:16467 MGI:2448730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxia, cerebellar, Cayman type homolog (human) transcript_id : NM_178662.3

name	9130206N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802279 GeneID:103406 MGI:2143792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130206N08 gene transcript_id : NM_001034895.2

name	Matk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754645 GeneID:17179 MGI:99259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : megakaryocyte-associated tyrosine kinase transcript_id : NM_010768.1

name	Mrpl54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385694 GeneID:66047 MGI:1913297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L54 transcript_id : NM_025317.2

name	Apba3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055381 GeneID:57267 MGI:1888527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family A, member 3 transcript_id : NM_018758.1

name	Tjp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052810 GeneID:27375 MGI:1351650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tight junction protein 3 transcript_id : NM_013769.2

name	Pip5k1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679322 GeneID:18717 MGI:1298224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma transcript_id : NM_008844.1

name	2510012J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583672 GeneID:70312 MGI:1917562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510012J08 gene transcript_id : NM_027381.1

name	Tbxa2r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378599 GeneID:21390 MGI:98496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thromboxane A2 receptor transcript_id : NM_009325.3

name	Gipc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507362 GeneID:209047 MGI:2387006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GIPC PDZ domain containing family, member 3 transcript_id : NM_148951.1

name	Hmg20b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365672 GeneID:15353 MGI:1341190
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group 20 B transcript_id : NM_010440.2

name	F630110N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378800 GeneID:73822 MGI:3604804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F630110N24 gene transcript_id : NM_028657.2

name	4930404N11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347338 GeneID:432479 MGI:1921072
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930404N11 gene transcript_id : NM_001014836.2

name	Fzr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789958 GeneID:56371 MGI:1926790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fizzy/cell division cycle 20 related 1 (Drosophila) transcript_id : NM_019757.1

name	Dohh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527181 GeneID:102115 MGI:1915964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyhypusine hydroxylase/monooxygenase transcript_id : NM_133964.1

name	2210404O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388495 GeneID:72273 MGI:1919523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 1 Protein product : RIKEN cDNA 2210404O07 gene, transcript variant 1 transcript_id : XM_125703.7

name	Nfic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370350 GeneID:18029 MGI:109591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/C transcript_id : NM_026756.2

name	Nfic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370341 GeneID:18029 MGI:109591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/C transcript_id : NM_008688.3

name	Brunol5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260950 GeneID:319586 MGI:2442333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : bruno-like 5, RNA binding protein (Drosophila), transcript variant 1 transcript_id : XM_618789.4

name	Ncln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351942 GeneID:103425 MGI:1926081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicalin homolog (zebrafish) transcript_id : NM_134009.2

name	Edg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753717 GeneID:13611 MGI:1333809
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation, G-protein-coupled receptor 6 transcript_id : NM_010102.1

name	Gna15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328487 GeneID:14676 MGI:95770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha 15 transcript_id : NM_010304.3

name	Gna11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384965 GeneID:14672 MGI:95766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha 11 transcript_id : NM_010301.3

name	Aes (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370816 GeneID:14797 MGI:95806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amino-terminal enhancer of split transcript_id : NM_010347.3

name	Tle2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789970 GeneID:21886 MGI:104635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin-like enhancer of split 2, homolog of Drosophila E(spl) transcript_id : NM_019725.1

name	Tle6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131148 GeneID:114606 MGI:2149593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin-like enhancer of split 6, homolog of Drosophila E(spl) transcript_id : NM_053254.2

name	Sirt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795585 GeneID:50721 MGI:1354161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) transcript_id : NM_181586.2

name	Ankrd24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68264923 GeneID:70615 MGI:1890394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 24 transcript_id : NM_027480.2

name	LOC100040916 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260951 GeneID:100040916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Adam6 protein transcript_id : XM_001475480.1

name	EG666448 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261046 GeneID:666448 MGI:3645531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 927 ESTs, 9 Proteins product : predicted gene, EG666448 transcript_id : XM_983917.2

name	EG666458 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130498371 GeneID:666458 MGI:3648799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666458 transcript_id : NM_001082620.1

name	LOC100040944 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260953 GeneID:100040944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001475544.1

name	EG210583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260955 GeneID:210583 MGI:3644409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs product : predicted gene, EG210583 transcript_id : XM_001475574.1

name	EG666738 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261050 GeneID:666738 MGI:3647363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 979 ESTs, 9 Proteins product : predicted gene, EG666738 transcript_id : XM_001002232.2

name	EG666501 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388473 GeneID:666501 MGI:3647467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 982 ESTs, 9 Proteins product : predicted gene, EG666501 transcript_id : XM_984283.1

name	1700123A16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388477 GeneID:73610 MGI:1920860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : RIKEN cDNA 1700123A16 gene transcript_id : XM_984400.1

name	BC062127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49615104 GeneID:331188 MGI:3696710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC062127 transcript_id : NM_199062.1

name	EG666542 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260957 GeneID:666542 MGI:3647888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666542 transcript_id : XM_984461.2

name	EG666548 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261054 GeneID:666548 MGI:3647883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 927 ESTs, 9 Proteins product : predicted gene, EG666548 transcript_id : XM_984537.2

name	EG666790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388506 GeneID:666790 MGI:3648461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 764 ESTs, 9 Proteins product : predicted gene, EG666790 transcript_id : XM_001002269.1

name	AL117821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261056 GeneID:404580 MGI:3034336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : expressed sequence AL117821 transcript_id : XM_001479742.1

name	BC062115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665708 GeneID:408062 MGI:3040689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC062115 transcript_id : NM_001024626.2

name	4933439G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260959 GeneID:414080 MGI:3041160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4933439G19 gene transcript_id : XM_001475681.1

name	BC024063 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260961 GeneID:666584 MGI:2670978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : cDNA sequence BC024063 transcript_id : XM_984750.2

name	AU041133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388490 GeneID:216177 MGI:2143755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : expressed sequence AU041133 transcript_id : XM_125803.5

name	B230315N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261059 GeneID:237411 MGI:3621440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA B230315N10 gene transcript_id : XM_001479757.1

name	LOC100042718 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261061 GeneID:100042718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042718 transcript_id : XM_001479763.1

name	Gm1553 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261063 GeneID:432480 MGI:2686399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 1 Protein product : gene model 1553, (NCBI) transcript_id : XM_001479767.1

name	Scamp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625033 CCDS:CCDS24028.1 GeneID:56214 MGI:1928947
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 4 protein_id : NP_062521.1

name	Csnk1g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527224 CCDS:CCDS24029.1 GeneID:103236 MGI:1920014
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : casein kinase 1, gamma 2 protein_id : NP_598763.1

name	Btbd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261030 GeneID:208198 MGI:1933831
definition	codon_start : 1 product : BTB (POZ) domain containing 2 isoform 3 protein_id : XP_001000710.2

name	Mknk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946852 CCDS:CCDS24030.1 GeneID:17347 MGI:894279
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 note : G protein-coupled receptor kinase 7 product : MAP kinase-interacting serine/threonine kinase 2 protein_id : NP_067437.1

name	Mobkl2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249075 GeneID:208228 MGI:3050117
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : MOB1, Mps One Binder kinase activator-like 2A protein_id : NP_766045.2

name	9030607L17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89886473 GeneID:71564 MGI:1918814
definition	codon_start : 1 product : hypothetical protein LOC71564 protein_id : NP_082105.3

name	Ap3d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671565 GeneID:11776 MGI:107734
definition	GO_component : GO:0005802 - Golgi trans face [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP]; GO:0048007 - antigen processing and presentation, exogenous lipid antigen via MHC class Ib [Evidence IMP]; GO:0006886 - intracellular protein transport [Evidence IMP] [Evidence TAS]; GO:0051138 - positive regulation of NK T cell differentiation [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : adaptor-related protein complex AP-3, delta subunit; adaptor-related protein complex 3, delta subunit product : adaptor-related protein complex 3, delta 1 subunit protein_id : NP_031486.1

name	Dot1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556381 GeneID:208266 MGI:2143886
definition	GO_function : GO:0042054 - histone methyltransferase activity [Evidence IDA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0045735 - nutrient reservoir activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : histone methyltransferase DOT1L product : histone H3 methyltransferase DOT1 protein_id : NP_955354.1

name	Plekhj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469027 GeneID:78670 MGI:1925920
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : guanine nucleotide releasing protein x protein_id : NP_076389.1

name	Sf3a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10800150 GeneID:20222 MGI:104912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence TAS] codon_start : 1 exception : mismatches in translation note : spliceosomal protein gene 62; splicing factor 3a, subunit 2, 66kD product : splicing factor 3a, subunit 2 protein_id : NP_038679.2

name	Amh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861194 CCDS:CCDS24033.1 GeneID:11705 MGI:88006
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005160 - transforming growth factor beta receptor binding [Evidence ISS] GO_process : GO:0008406 - gonad development [Evidence IEA]; GO:0007506 - gonadal mesoderm development [Evidence IEA]; GO:0001655 - urogenital system development [Evidence ISS] codon_start : 1 note : Mullerian inhibiting substance; anti-Muellerian hormone product : anti-Mullerian hormone protein_id : NP_031471.2

name	Jsrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312578 CCDS:CCDS24034.1 GeneID:71912 MGI:1916700
definition	GO_component : GO:0016529 - sarcoplasmic reticulum [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006941 - striated muscle contraction [Evidence ISS] codon_start : 1 product : JP-45 protein protein_id : NP_082277.1

name	Oaz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110677 GeneID:18245 MGI:109433
definition	GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008073 - ornithine decarboxylase inhibitor activity [Evidence TAS] GO_process : GO:0006595 - polyamine metabolism [Evidence TAS] codon_start : 1 note : protein translation is dependent on +1 polyamine-induced ribosomal frameshift; antizyme 1 product : ornithine decarboxylase antizyme 1 protein_id : NP_032779.1 ribosomal_slippage : _no_value

name	BC072620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701456 CCDS:CCDS24035.1 GeneID:237403 MGI:3609246
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC237403 protein_id : NP_001013780.1

name	Lsm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384714 GeneID:66094 MGI:1913344
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence ISS]; GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM7 homolog, U6 small nuclear RNA associated protein_id : NP_079625.1

name	3110056O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116805338 GeneID:73218 MGI:1920468
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : protein SPP-like 2B product : signal peptide peptidase-like 2B protein_id : NP_780404.2

name	Tmprss9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157517 GeneID:432478 MGI:3612246
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : polyserase-1; polyserine protease-1; polyserase-I product : transmembrane protease, serine 9 protein_id : NP_001075157.1

name	Timm13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305581 GeneID:30055 MGI:1353432
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : translocase of inner mitochondrial membrane 9 homolog protein_id : NP_038923.1

name	Lmnb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195686 CCDS:CCDS24037.1 GeneID:16907 MGI:96796
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0005638 - lamin filament [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : lamin B2 protein_id : NP_034852.2

name	Gadd45b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678980 CCDS:CCDS24038.1 GeneID:17873 MGI:107776
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000186 - activation of MAPKK activity [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 note : myeloid differentiation primary response gene 118 product : growth arrest and DNA-damage-inducible 45 beta protein_id : NP_032681.1

name	Gng7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579915 CCDS:CCDS24039.1 GeneID:14708 MGI:95787
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IMP] [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007168 - receptor guanylyl cyclase signaling pathway [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 7 subunit protein_id : NP_001033744.1

name	Gng7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579919 CCDS:CCDS24039.1 GeneID:14708 MGI:95787
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IMP] [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007168 - receptor guanylyl cyclase signaling pathway [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 7 subunit protein_id : NP_034449.2

name	Diras1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644583 CCDS:CCDS24040.1 GeneID:208666 MGI:2183442
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : small GTP-binding tumor suppressor 1 product : DIRAS family, GTP-binding RAS-like 1 protein_id : NP_660252.1

name	Slc39a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527368 CCDS:CCDS24041.1 GeneID:106947 MGI:2147269
definition	GO_function : GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 product : solute carrier family 39 (zinc transporter), member 3 protein_id : NP_598896.1

name	Sgta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313588 GeneID:52551 MGI:1098703
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : small glutamine-rich tetratricopeptide repeat (TPR) containing protein protein_id : NP_078775.1

name	Thop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981237 CCDS:CCDS24042.1 GeneID:50492 MGI:1354165
definition	EC_number : 3.4.24.15 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006518 - peptide metabolism [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA] codon_start : 1 exception : mismatches in translation note : endopeptidase 24.15 product : thimet oligopeptidase 1 protein_id : NP_073144.2

name	Creb3l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703728 CCDS:CCDS24043.1 GeneID:208677 MGI:2384786
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : cAMP responsive element binding protein 3-like 3 protein_id : NP_663340.1

name	Map2k2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560267 CCDS:CCDS24044.1 GeneID:26396 MGI:1346867
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : protein kinase, mitogen activated, kinase 2, p45; MAP kinase kinase 2; MAP kinase/Erk kinase product : mitogen activated protein kinase kinase 2 protein_id : NP_075627.2

name	Zbtb7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647238 GeneID:16969 MGI:1335091
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence NAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0035035 - histone acetyltransferase binding [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051216 - cartilage development [Evidence NAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : POK erythroid myeloid ontogenic factor; leukemia/lymphoma related factor product : zinc finger and BTB domain containing 7 protein_id : NP_034861.3

name	Pias4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249349 GeneID:59004 MGI:2136940
definition	GO_component : GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019789 - SUMO ligase activity [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence NAS] GO_process : GO:0007275 - development [Evidence NAS]; GO:0007259 - JAK-STAT cascade [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : protein inhibitor of activated STAT PIASy product : protein inhibitor of activated STAT, 4 protein_id : NP_067476.2

name	Eef2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859482 GeneID:13629 MGI:95288
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation elongation factor 2 protein_id : NP_031933.1

name	Dapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681133 CCDS:CCDS24045.1 GeneID:13144 MGI:1203520
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA] codon_start : 1 note : ZIP kinase product : death-associated kinase 3 protein_id : NP_031854.1

name	Itgb1bp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625739 CCDS:CCDS24046.1 GeneID:69564 MGI:1916814
definition	GO_component : GO:0005622 - intracellular [Evidence IPI] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045662 - negative regulation of myoblast differentiation [Evidence IDA]; GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : muscle-specific beta 1 integrin binding protein protein_id : NP_081396.1

name	Atcay (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520029 CCDS:CCDS24047.1 GeneID:16467 MGI:2448730
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : hesitant; jittery product : ataxia, cerebellar, Cayman type homolog protein_id : NP_848777.1

name	9130206N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702252 GeneID:103406 MGI:2143792
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : hypothetical protein LOC103406 protein_id : NP_001030067.1

name	Matk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754646 CCDS:CCDS24048.1 GeneID:17179 MGI:99259
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Csk homologous kinase product : megakaryocyte-associated tyrosine kinase protein_id : NP_034898.1

name	Mrpl54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384682 CCDS:CCDS24049.1 GeneID:66047 MGI:1913297
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : mitochondrial ribosomal protein L54 protein_id : NP_079593.1

name	Apba3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055382 CCDS:CCDS24050.1 GeneID:57267 MGI:1888527
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : adapter protein X11gamma; neuron-specific X11L2 protein; neuronal munc18-1-interacting protein 3; Mint 3 product : amyloid beta (A4) precursor protein-binding, family A, member 3 protein_id : NP_061228.1

name	Tjp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052811 CCDS:CCDS24051.1 GeneID:27375 MGI:1351650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 product : tight junction protein 3 protein_id : NP_038797.2

name	Pip5k1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679323 GeneID:18717 MGI:1298224
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0046488 - phosphatidylinositol metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma protein_id : NP_032870.1

name	2510012J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583673 GeneID:70312 MGI:1917562
definition	codon_start : 1 product : hypothetical protein LOC70312 protein_id : NP_081657.1

name	Tbxa2r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678233 CCDS:CCDS24053.1 GeneID:21390 MGI:98496
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0045987 - positive regulation of smooth muscle contraction [Evidence IDA]; GO:0019229 - regulation of vasoconstriction [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Tp receptor product : thromboxane A2 receptor protein_id : NP_033351.1

name	Gipc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507363 CCDS:CCDS24054.1 GeneID:209047 MGI:2387006
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] codon_start : 1 note : regulator of G-protein signaling 19 interacting protein 3; PDZ-domain protein Gipc3 product : GIPC PDZ domain containing family, member 3 protein_id : NP_683753.1

name	Hmg20b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528488 CCDS:CCDS24055.1 GeneID:15353 MGI:1341190
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence NAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence NAS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0006323 - DNA packaging [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence NAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : high mobility group protein 20 B; BRCA2-associated factor 35 product : high mobility group 20 B protein_id : NP_034570.1

name	F630110N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111937 GeneID:73822 MGI:3604804
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73822 protein_id : NP_082933.1

name	4930404N11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62460384 CCDS:CCDS24056.1 GeneID:432479 MGI:1921072
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC432479 protein_id : NP_001014836.1

name	Fzr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789959 CCDS:CCDS24057.1 GeneID:56371 MGI:1926790
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 function : cell cycle regulator note : fizzy-related protein; frizzy-related protein 1 product : Fzr1 protein protein_id : NP_062731.1

name	Dohh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527182 GeneID:102115 MGI:1915964
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0019135 - deoxyhypusine monooxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008612 - hypusine biosynthesis from peptidyl-lysine [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HEAT-like (PBS lyase) repeat containing 1 protein_id : NP_598725.1

name	2210404O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20862791 GeneID:72273 MGI:1919523
definition	codon_start : 1 product : hypothetical protein LOC72273 isoform 1 protein_id : XP_125703.1

name	Nfic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370351 GeneID:18029 MGI:109591
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; nuclear factor 1-C2 product : nuclear factor I/C isoform b protein_id : NP_081032.2

name	Nfic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679042 CCDS:CCDS24058.1 GeneID:18029 MGI:109591
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; nuclear factor 1-C2 product : nuclear factor I/C isoform a protein_id : NP_032714.1

name	Brunol5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388455 GeneID:319586 MGI:2442333
definition	codon_start : 1 product : bruno-like 5, RNA binding protein isoform 1 protein_id : XP_618789.3

name	Ncln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469043 GeneID:103425 MGI:1926081
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : nicalin homolog protein_id : NP_598770.1

name	Edg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753718 CCDS:CCDS24059.1 GeneID:13611 MGI:1333809
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : endothelial differentiation, G-protein-coupled receptor 6 protein_id : NP_034232.1

name	Gna15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754010 CCDS:CCDS24060.1 GeneID:14676 MGI:95770
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS] [Evidence NAS] GO_function : GO:0005525 - GTP binding [Evidence IEA] [Evidence NAS]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IGI] [Evidence IEA] GO_process : GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IMP]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha 15 protein_id : NP_034434.1

name	Gna11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754004 CCDS:CCDS24061.1 GeneID:14672 MGI:95766
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS] [Evidence ISS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IMP]; GO:0007215 - glutamate signaling pathway [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0048066 - pigmentation during development [Evidence IMP]; GO:0001508 - regulation of action potential [Evidence IDA]; GO:0045634 - regulation of melanocyte differentiation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : guanine nucleotide binding protein, alpha 11 protein_id : NP_034431.1

name	Aes (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754072 CCDS:CCDS24062.1 GeneID:14797 MGI:95806
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IGI] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0040008 - regulation of growth [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : related to Drosophila groucho product : amino-terminal enhancer of split protein_id : NP_034477.1

name	Tle2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789971 CCDS:CCDS24063.1 GeneID:21886 MGI:104635
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : groucho-related protein; transducin-like enhancer of split 2 product : transducin-like enhancer protein 2 protein_id : NP_062699.1

name	Tle6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716583 CCDS:CCDS24064.1 GeneID:114606 MGI:2149593
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : Groucho-related protein 6; transducin-like enhancer of split 6 product : transducin-like enhancer protein 6 protein_id : NP_444484.1

name	Sirt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712018 CCDS:CCDS24066.1 GeneID:50721 MGI:1354161
definition	codon_start : 1 note : silent mating type information regulation 2, homolog 6 product : sirtuin 6 protein_id : NP_853617.1

name	Ankrd24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181301 GeneID:70615 MGI:1890394
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : ankyrin repeat domain 24 protein_id : NP_081756.3

name	LOC100040916 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260952 GeneID:100040916
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475530.1

name	EG666448 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388464 GeneID:666448 MGI:3645531
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_989011.1

name	EG666458 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130498372 GeneID:666458 MGI:3648799
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : predicted gene, EG666458 protein_id : NP_001076089.1

name	LOC100040944 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260954 GeneID:100040944
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001475594.1

name	EG210583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260956 GeneID:210583 MGI:3644409
definition	codon_start : 1 product : similar to EG210583 protein protein_id : XP_001475624.1

name	EG666738 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388502 GeneID:666738 MGI:3647363
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_001002232.1

name	EG666501 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388474 GeneID:666501 MGI:3647467
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_989377.1

name	1700123A16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388478 GeneID:73610 MGI:1920860
definition	codon_start : 1 product : hypothetical protein LOC73610 protein_id : XP_989494.1

name	BC062127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49615105 GeneID:331188 MGI:3696710
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC331188 protein_id : NP_951017.1

name	EG666542 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260958 GeneID:666542 MGI:3647888
definition	codon_start : 1 product : similar to EG210583 protein protein_id : XP_989555.2

name	EG666548 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388483 GeneID:666548 MGI:3647883
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_989631.1

name	EG666790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388507 GeneID:666790 MGI:3648461
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_001002269.1

name	AL117821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261057 GeneID:404580 MGI:3034336
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479792.1

name	BC062115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665709 GeneID:408062 MGI:3040689
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC408062 protein_id : NP_001019797.2

name	4933439G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260960 GeneID:414080 MGI:3041160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475731.1

name	BC024063 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260962 GeneID:666584 MGI:2670978
definition	codon_start : 1 product : hypothetical protein LOC666584 protein_id : XP_989844.2

name	AU041133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83027472 GeneID:216177 MGI:2143755
definition	codon_start : 1 product : hypothetical protein protein_id : XP_125803.2

name	B230315N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261060 GeneID:237411 MGI:3621440
definition	codon_start : 1 product : hypothetical protein LOC237411 protein_id : XP_001479807.1

name	LOC100042718 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261062 GeneID:100042718
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479813.1

name	Gm1553 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261064 GeneID:432480 MGI:2686399
definition	codon_start : 1 product : hypothetical protein LOC432480 protein_id : XP_001479817.1

name	LOC100042403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042403
definition	number : 1 pseudo : _no_value

name	LOC382388 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382388
definition	number : 1 pseudo : _no_value

name	EG666537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666537
definition	number : 1 pseudo : _no_value

name	BC025920 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260887 GeneID:268319 MGI:2670983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025920 transcript_id : XR_035082.1

name	LOC666711 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261049 GeneID:666711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_035695.1

name	LOC666753 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261053 GeneID:666753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034346.1

name	LOC666571 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261055 GeneID:666571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to uracil DNA glycosylase pseudo : _no_value transcript_id : XR_034355.1

name	LOC100042712 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261058 GeneID:100042712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to brain protein 44 pseudo : _no_value transcript_id : XR_034367.1

name	EG237412 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260963 GeneID:237412 MGI:3643133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : predicted gene, EG237412 transcript_id : XR_035281.1

name	LOC666611 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260964 GeneID:666611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to mitogen activated protein kinase kinase kinase 7 pseudo : _no_value transcript_id : XR_032433.1

name	LOC544716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261065 GeneID:544716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 167 ESTs, 12 Proteins product : similar to clathrin adaptor protein mu3A pseudo : _no_value transcript_id : XR_034379.1

clone name	MSMg01-181F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092C24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423J18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-486K08.T7 (MSMg01no486_k08.b1)	MSMg01-486K08.TJ (MSMg01no486_k08.g1)
ACC	AG565800	AG565801
length	738	740
length of high quality (start - end)	545 (50 - 594)	644 (80 - 723)
definition	CHROMAT_FILE: MSMg01no486_k08.b1 PHD_FILE: MSMg01no486_k08.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:09:00 2005	CHROMAT_FILE: MSMg01no486_k08.g1 PHD_FILE: MSMg01no486_k08.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:09:00 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GGGGCTTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXC GCGGAATTCCAAACATTGTACCATAACAGAGACTATCTGCAGCTGGCAAA ACCACGCCTCTGCTAGAGCACGAGGCAAATCATTGTCAGCTGCTGGGGAC AGTCCGAAGCAGCCCCACCCCCCACAGACAAAGACACATTCTTAAAATAT TTCTGTATTTTTAAAAGAAGCCTAATGGGGGCTGGCGAGATGGCTCAGTG GGTAAAAGCACTGACTTGCTCTTCCGAAAGTCATGAGTTCAAATCCCAGC AACCACATGGTGGCTCACAACCATGAGATCTGATGCCCTCTGCTGGTCTG AAGTAATCTACATTGTACTTATATGTAATAATAAAATCTTAAAAAAAAAA AAAAAGAAGCCTAATGGGCCTGGTGAGATGGCTCAGTGGGTAAGAGCACC CGACTGCTCTTCCGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTG GCTCACAACCATCAGTAATGAGATCTGACGCCCTCTTCTGGTATGTCTGA AGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAAAAAA AAAAAGAAGCCTAAGGGTTGGAAGAGATGGCTCANCAGTTAAGAGCACTG ACTGCTCCTTCCAAGGGTCCTGATTTCAAACCCCAGCAACCCACTGGTGG GTCCACAAACATCGGTTAAGGGAATCTGACGGCCTCTN	AGTCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGAAATCTGACCCTGCCTCCT GAGTGTCTTACTTAAATTTATTTAATTCCATAGTGTTGTTTTATTACCAC ATTTATTTTCGTTATTTCATTCTTGTTACATATTTATTGCAGGTTCTTTC TTTTTTTTTTTTTTGGTCTTTTTTGTTTGTTTGATTTTTGAGACAGGGTT TCTCTGTGTAGTCCTGGCAGTCCTGAAACTGGCTGGCCTTGCACTCACAG AGATACTCGTACCTCAGGCATGGGCCACCACACCCATCCCATTTTATTTT ATTTTATTTTTCCATTTTTATTAGGTATTTAGCTCATTTACCCATTTTAT TTTTAAATTTATTCTTTCTTTTTTCTTCCTCCAGCCACTCACGATTCTAA ATTTATCCTTATATAAGAATGTGGGCTGGAGAGATGGCTCAGTGGGTAAG AGTATTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACTACA TGGTGGCTCACAACCATCCGTGATGAGGTTTGATACCCTCTTCTGGTGTG TCTGAAGACAGCTATAGTGTACTCACATATAATAAATAGATAAATCTTAA AAAAAAATAAGAACATACATGGACCTTGTGATCCTCTTGAGTCAGCTTCT AGGGATCACTGTAGCTGGGTTCCTAGAAAGCAGAAAGAGG
quality values	Open. Hide. 7 7 6 6 3 6 8 17 15 18 15 15 15 28 34 37 37 32 29 29 19 24 24 25 26 28 37 37 44 30 29 26 26 26 28 34 17 17 11 10 10 11 11 17 19 19 14 14 14 27 41 53 53 36 36 36 36 36 36 33 33 33 33 37 26 25 21 15 11 8 8 8 8 11 19 34 37 37 37 41 50 50 50 57 57 57 59 57 57 57 57 57 57 59 53 53 53 53 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 51 51 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 47 47 47 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 48 48 50 50 50 59 59 59 44 39 39 26 26 30 37 37 41 46 46 46 48 43 43 48 48 50 53 59 59 48 57 59 59 59 59 48 48 48 48 48 57 57 48 53 59 59 59 57 48 48 48 48 50 50 47 59 41 41 41 32 32 39 39 39 41 47 47 47 41 41 39 39 39 47 59 57 53 50 50 48 48 48 47 50 47 47 44 44 39 36 31 35 36 47 39 46 47 47 47 43 41 41 37 41 43 59 41 42 41 41 43 43 43 40 40 43 40 40 41 41 39 39 35 31 36 31 38 38 34 34 39 40 37 31 37 32 37 32 32 35 39 39 34 24 30 28 30 28 39 39 36 36 25 25 25 20 20 32 32 32 32 21 21 12 24 12 24 21 32 32 44 41 41 37 20 19 22 18 17 22 29 32 37 30 30 18 15 15 21 21 19 20 19 19 19 19 19 11 11 11 17 23 26 29 23 18 12 10 9 9 10 9 9 10 10 9 9 8 8 8 8 8 8 16 12 15 3 0 3 11 11 10 10 9 9 7 7 10 8 8 8 13 16 11 10 10 10 10 10 10 9 10 9 16 13 13 13 9 10 10 16 11 10 9 9 8 8 8 9 9 8 8 8 8 8 8 10 11 14 15 12 12 9 9 9 10 10 10 8 8 8 8 8 8 8 10 12 12 11 13 16 11 14 10 13 10 8 8 8 8 8 8 8 8 8 8 8 10 9 9 9 9 8 8 12 12 11 8 10 3 0	Open. Hide. 6 8 6 6 8 6 6 6 8 8 8 8 19 22 31 25 23 22 25 25 32 37 34 34 24 24 24 34 30 31 37 34 34 21 15 11 11 10 9 12 16 17 10 15 15 30 21 37 37 32 32 25 25 37 36 36 37 37 59 46 27 25 11 18 10 10 10 15 16 19 30 41 40 29 28 30 30 29 29 34 36 35 42 43 37 40 47 53 53 53 57 53 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 43 43 35 57 57 59 59 57 57 52 52 43 57 39 39 39 44 44 52 52 52 57 57 44 44 35 35 35 43 43 62 62 62 62 62 62 62 62 62 62 52 52 43 43 43 43 43 62 62 62 62 52 52 52 52 52 62 62 62 62 62 62 62 62 62 62 52 52 52 62 45 52 52 62 62 52 52 52 62 62 52 52 62 43 43 35 35 35 44 44 62 62 52 52 52 52 52 52 44 43 43 43 31 39 39 39 43 39 43 43 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 52 52 52 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 52 43 43 29 29 29 43 43 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 45 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 20 20 20 38 38 35 35 35 44 44 52 52 43 43 16 16 14 23 23 43 43 43 43 38 38 17 17 24 38 44 62 43 43 26 26 12 12 12 38 38 57 57 52 43 43 35 35 35 43 43 52 57 57 43 44 35 35 29 39 39 57 44 43 23 23 23 44 43 52 52 57 57 57 44 43 35 35 37 47 44 57 43 43 37 39 43 43 29 29 29 43 43 52 52 52 52 52 52 52 43 43 38 43 41 31 31 33 43 43 43 29 29 29 36 41 44 43 39 39 41 43 43 43 43 35 35 35 42 41 41 33 33 33 42 35 39 39 43 37 42 19 20 13 19 18 36 36 43 43 43 43 42 37 28 30 30 32 32 20 20 20 28 28 37 32 39 39 59 59 59 43 39 30 30 42 42 48 43 43 40 36 32 35 42 42 59 59 57 59 57 44 43 29 29 19 32 32 34 30 39 28 32 28 30 28 34 34 35 28 25 31 32 20 20 20 28 28 39 37 39 35 35 28 30 20 20 15 18 14 17 19 30 34 26 26 16 16 15 30 26 30 30 37 32 34 16 16 11 12 12 30 30 37 31 31 20 22 13 20 11 8 7 9 9 6 8 10 15 15 23 12 18 13 13 13

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no486_k08.g1 MSMg01no486_k08.g1 CHROMAT_FILE:
MSMg01no486_k08.g1 PHD_FILE: MSMg01no486_k08.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:09:00 2005
         (644 letters)



>mm_chr10_81066004_81067047
          Length = 1044

 Score = 1156 bits (598), Expect = 0.0
 Identities = 630/648 (97%), Gaps = 14/648 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   agaaatctgaccctgcctcctgagtgtcttacttaaatttatttaattccatagtgttgt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agaaatctgaccctgcctcctgagtgtcttacttaaatttatttaattccatagtgttgt 260

                                                                       
Query: 61  tttattaccacatttattttcgttatttcattcttgttacatatttattgcaggttcttt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tttattaccacatttattttcgttatttcattcttgttacatatttattgcaggttcttt 320

                                                                       
Query: 121 cttttttttttttttg---gtcttttttgtttgtttgatttttgagacagggtttctctg 177
            ||||||||||||||    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tttttttttttttttttttgtcttttttgtttgtttgatttttgagacagggtttctctg 380

                                                                       
Query: 178 tgtagtcctggcagtcctgaaactggctggccttgcactcacagagatactcgtacctca 237
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tgtagtcctggcagtcctgaaactggctggccttgcactcacagagatactcgtacctca 440

                                                                       
Query: 238 ggcatgggccaccacacccatcccattttattttattttatttttccattttt-attagg 296
           ||||||||||||||||||||||||||||||||||          ||||||||| ||||||
Sbjct: 441 ggcatgggccaccacacccatcccattttatttt----------tccattttttattagg 490

                                                                       
Query: 297 tatttagctcatttacccattttatttttaaatttattctttcttttttcttcctccagc 356
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 491 tatttagctcatttacccattttatttttaaatttattctttcttttttcttcctccagc 550

                                                                       
Query: 357 cactcacgattctaaatttatccttatataagaatgtgggctggagagatggctcagtgg 416
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||
Sbjct: 551 cactcacgattctaaatttatccttatttaagaatgtgggctggagagatggctcagcgg 610

                                                                       
Query: 417 gtaagagtattgactgctcttctgaaggtcctgagttcaaatcccagcaactacatggtg 476
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 611 gtaagagtattgactgctcttctgaaggtcctgagttcaaatcccagcaactacatggtg 670

                                                                       
Query: 477 gctcacaaccatccgtgatgaggtttgataccctcttctggtgtgtctgaagacagctat 536
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 671 gctcacaaccatccgtgatgaggtttgataccctcttctggtgtgtctgaagacagctat 730

                                                                       
Query: 537 agtgtactcacatataataaatagataaatcttaaaaaaaaataagaacatacatggacc 596
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 731 agtgtactcacatataataaatagataaatcttaaaaaaaaataagaacatacatggacc 790

                                                           
Query: 597 ttgtgatcctcttgagtcagcttctagggatcactgtagctgggttcc 644
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 ttgtgatcctcttgagtcagcttctagggatcactgtagctgggttcc 838


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 33
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 644
Length of database: 1044
Length adjustment: 10
Effective length of query: 634
Effective length of database: 1034
Effective search space:   655556
Effective search space used:   655556
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information