MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-020N19
Chromosome	11 (Build37)
Map Location	5,381,729 - 5,495,350
singlet/doublet	doublet
Overlap gene	LOC382478, Xbp1, Ccdc117, LOC100041183, Ankrd36
Upstream gene	Mtmr3, LOC100041006, OTTMUSG00000005065, Ascc2, 1110020P15Rik, Zmat5, Cabp7, Nf2, Nipsnap1, Thoc5, Nefh, Ap1b1, Rasl10a, Gas2l1, Ewsr1, Rhbdd3, Emid1, Kremen1, Znrf3, LOC100042016
Downstream gene	LOC665181, Mrps24, 2010005J08Rik, 2210015D19Rik, Dbnl, Pgam2, Polm, Aebp1, Pold2, Myl7, Gck, Ykt6, Camk2b, LOC100042156, Nudcd3, LOC100042173, Npc1l1, LOC100041242, LOC665250, Ddx56, Tmed4, Ogdh, LOC100042227, Zmiz2, Ppia, H2afv, LOC665277, LOC665283, LOC626342, Purb, Myo1g, LOC100041286, Ccm2, LOC665327
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mtmr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74302 MGI:1921552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 132 ESTs, 24 Proteins pseudo : _no_value

name	OTTMUSG00000005065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327860 MGI:3652303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ascc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75452 MGI:1922702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110020P15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66152 MGI:1913402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zmat5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67178 MGI:1914428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192650 MGI:2183437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18016 MGI:97307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nipsnap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18082 MGI:1278344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thoc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107829 MGI:1351333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nefh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380684 MGI:97309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11764 MGI:1096368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasl10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75668 MGI:1922918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gas2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78926 MGI:1926176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ewsr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14030 MGI:99960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279766 MGI:2444684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140703 MGI:2155091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kremen1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84035 MGI:1933988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znrf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407821 MGI:3039616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC382478 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382478
definition	note : polymerase (RNA) II (DNA directed) polypeptide D pseudogene pseudo : _no_value

name	Xbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22433 MGI:98970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104479 MGI:2144383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041183 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ankrd36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76389 MGI:1923639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665181 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 116 ESTs, 6 Proteins

name	Mrps24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64660 MGI:1928142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010005J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72046 MGI:1919296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2210015D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76508 MGI:1913774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Dbnl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13169 MGI:700006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56012 MGI:1933118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54125 MGI:1860191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aebp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11568 MGI:1197012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18972 MGI:1097163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17898 MGI:107495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103988 MGI:1270854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ykt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56418 MGI:1927550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12323 MGI:88257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Nudcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209586 MGI:2144158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042173 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 884 ESTs, 3 Proteins

name	Npc1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237636 MGI:2685089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC665250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Ddx56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52513 MGI:1277172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103694 MGI:1915070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18293 MGI:1098267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zmiz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52915 MGI:106374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppia (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268373 MGI:97749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2afv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77605 MGI:1924855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 176 ESTs, 39 Proteins

name	LOC665277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 327 ESTs, 2 Proteins pseudo : _no_value

name	LOC665283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 88 ESTs, 7 Proteins

name	LOC626342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Purb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19291 MGI:1338779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246177 MGI:1927091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ccm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216527 MGI:2384924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 10 Proteins pseudo : _no_value

name	Mtmr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346434 GeneID:74302 MGI:1921552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 3 transcript_id : NM_028860.1

name	OTTMUSG00000005065 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367027 GeneID:327860 MGI:3652303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000005065 transcript_id : NM_177799.3

name	Ascc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270207 GeneID:75452 MGI:1922702
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating signal cointegrator 1 complex subunit 2 transcript_id : NM_029291.1

name	1110020P15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155121 GeneID:66152 MGI:1913402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110020P15 gene transcript_id : NM_197979.2

name	Zmat5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375105 GeneID:67178 MGI:1914428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin type 5 transcript_id : NM_026015.2

name	Cabp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110035 GeneID:192650 MGI:2183437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 7 transcript_id : NM_138948.3

name	Nf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709816 GeneID:18016 MGI:97307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurofibromatosis 2 transcript_id : NM_010898.3

name	Nipsnap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130691 GeneID:18082 MGI:1278344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) transcript_id : NM_008698.2

name	Thoc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801427 GeneID:107829 MGI:1351333
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THO complex 5 transcript_id : NM_172438.2

name	Nefh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286810 GeneID:380684 MGI:97309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurofilament, heavy polypeptide transcript_id : NM_010904.3

name	Ap1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853577 GeneID:11764 MGI:1096368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-1, beta 1 subunit transcript_id : NM_007454.2

name	Rasl10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853579 GeneID:75668 MGI:1922918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 10, member A transcript_id : NM_145216.3

name	Gas2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89357940 GeneID:78926 MGI:1926176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest-specific 2 like 1 transcript_id : NM_144560.2

name	Gas2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89357941 GeneID:78926 MGI:1926176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest-specific 2 like 1 transcript_id : NM_030228.2

name	Ewsr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853580 GeneID:14030 MGI:99960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ewing sarcoma breakpoint region 1 transcript_id : NM_007968.2

name	Rhbdd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801239 GeneID:279766 MGI:2444684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid domain containing 3 transcript_id : NM_177370.3

name	Emid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131093 GeneID:140703 MGI:2155091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EMI domain containing 1 transcript_id : NM_080595.2

name	Kremen1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900497 GeneID:84035 MGI:1933988
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kringle containing transmembrane protein 1 transcript_id : NM_032396.3

name	Znrf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286865 GeneID:407821 MGI:3039616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc and ring finger 3 transcript_id : NM_001080924.1

name	LOC100042016 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261628 GeneID:100042016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042016 transcript_id : XM_001478392.1

name	Xbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13775155 GeneID:22433 MGI:98970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-box binding protein 1 transcript_id : NM_013842.2

name	Ccdc117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794237 GeneID:104479 MGI:2144383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 117 transcript_id : NM_134033.1

name	Ankrd36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628651 GeneID:76389 MGI:1923639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 36 transcript_id : NM_023816.2

name	LOC665181 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94389883 GeneID:665181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 116 ESTs, 6 Proteins product : similar to endothelial differentiation-related factor 1 transcript_id : XM_979372.1

name	Mrps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940056 GeneID:64660 MGI:1928142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S24 transcript_id : NM_026080.2

name	2010005J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938771 GeneID:72046 MGI:1919296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010005J08 gene transcript_id : NM_001077661.1

name	2010005J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938769 GeneID:72046 MGI:1919296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010005J08 gene transcript_id : NM_178623.3

name	2210015D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94389885 GeneID:76508 MGI:1913774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 2210015D19 gene, transcript variant 2 transcript_id : XM_893272.2

name	Dbnl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130876 GeneID:13169 MGI:700006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : drebrin-like transcript_id : NM_013810.2

name	Pgam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130705 GeneID:56012 MGI:1933118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglycerate mutase 2 transcript_id : NM_018870.2

name	Polm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394000 GeneID:54125 MGI:1860191
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), mu transcript_id : NM_017401.1

name	Aebp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752997 GeneID:11568 MGI:1197012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AE binding protein 1 transcript_id : NM_009636.1

name	Pold2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679412 GeneID:18972 MGI:1097163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), delta 2, regulatory subunit transcript_id : NM_008894.1

name	Myl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326498 GeneID:17898 MGI:107495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 7, regulatory transcript_id : NM_022879.2

name	Gck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129970 GeneID:103988 MGI:1270854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucokinase transcript_id : NM_010292.4

name	Ykt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893017 GeneID:56418 MGI:1927550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YKT6 homolog (S. Cerevisiae) transcript_id : NM_019661.3

name	Camk2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349559 GeneID:12323 MGI:88257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II, beta transcript_id : NM_007595.3

name	Nudcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803279 GeneID:209586 MGI:2144158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NudC domain containing 3 transcript_id : NM_173748.3

name	LOC100042173 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261634 GeneID:100042173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 884 ESTs, 3 Proteins product : similar to hCG1994130 transcript_id : XM_001478643.1

name	Npc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402232 GeneID:237636 MGI:2685089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NPC1-like 1 transcript_id : NM_207242.1

name	LOC100041242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261598 GeneID:100041242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041242 transcript_id : XM_001476031.1

name	Ddx56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893145 GeneID:52513 MGI:1277172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 transcript_id : NM_026538.3

name	Tmed4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527235 GeneID:103694 MGI:1915070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 protein transport domain containing 4 transcript_id : NM_134020.1

name	Ogdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796649 GeneID:18293 MGI:1098267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxoglutarate dehydrogenase (lipoamide) transcript_id : NM_010956.3

name	LOC100042227 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261639 GeneID:100042227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042227 transcript_id : XM_001478677.1

name	Zmiz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607099 GeneID:52915 MGI:106374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MIZ-type containing 2 transcript_id : NM_028601.2

name	Zmiz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607101 GeneID:52915 MGI:106374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MIZ-type containing 2 transcript_id : NM_001005867.1

name	Ppia (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679438 GeneID:268373 MGI:97749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase A transcript_id : NM_008907.1

name	H2afv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261600 GeneID:77605 MGI:1924855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 176 ESTs, 39 Proteins product : H2A histone family, member V transcript_id : XM_001476068.1

name	LOC665283 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94389891 GeneID:665283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 88 ESTs, 6 Proteins product : similar to SMT3B protein transcript_id : XM_975835.1

name	Purb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802243 GeneID:19291 MGI:1338779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purine rich element binding protein B transcript_id : NM_011221.2

name	Myo1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801948 GeneID:246177 MGI:1927091
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IG transcript_id : NM_178440.3

name	LOC100041286 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261602 GeneID:100041286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041286 transcript_id : XM_001476101.1

name	Ccm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130250 GeneID:216527 MGI:2384924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebral cavernous malformation 2 homolog (human) transcript_id : NM_146014.2

name	Mtmr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346435 GeneID:74302 MGI:1921552
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myotubularin-related protein 3 protein_id : NP_083136.1

name	OTTMUSG00000005065 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244334 GeneID:327860 MGI:3652303
definition	codon_start : 1 product : hypothetical protein LOC327860 protein_id : NP_808467.1

name	Ascc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270208 CCDS:CCDS24387.1 GeneID:75452 MGI:1922702
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ASC-1 complex subunit P100 protein_id : NP_083567.1

name	1110020P15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574048 GeneID:66152 MGI:1913402
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006122 - mitochondrial electron transport, ubiquinol to cytochrome c [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ubiquinol-cytochrome c reductase complex protein protein_id : NP_932096.1

name	Zmat5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385520 CCDS:CCDS24389.1 GeneID:67178 MGI:1914428
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 product : zinc finger, matrin type 5 protein_id : NP_080291.1

name	Cabp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21322238 CCDS:CCDS24390.1 GeneID:192650 MGI:2183437
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : calcium-binding protein CaBP7 product : calcium binding protein 7 protein_id : NP_620398.1

name	Nf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982775 CCDS:CCDS24391.1 GeneID:18016 MGI:97307
definition	GO_component : GO:0005912 - adherens junction [Evidence IMP]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045216 - intercellular junction assembly and maintenance [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IMP] codon_start : 1 note : schwannomin; moesin-ezrin-radixin-like protein product : neurofibromatosis 2 protein_id : NP_035028.2

name	Nipsnap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679066 CCDS:CCDS24392.1 GeneID:18082 MGI:1278344
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 protein_id : NP_032724.1

name	Thoc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369587 CCDS:CCDS24393.1 GeneID:107829 MGI:1351333
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045650 - negative regulation of macrophage differentiation [Evidence IDA] codon_start : 1 note : serum/glucocorticoid regulated kinase 2 product : Fms interacting protein protein_id : NP_766026.1

name	Nefh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286811 GeneID:380684 MGI:97309
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005883 - neurofilament [Evidence IDA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045104 - intermediate filament cytoskeleton organization and biogenesis [Evidence IMP] codon_start : 1 note : neurofilament 200kDa product : neurofilament, heavy polypeptide protein_id : NP_035034.2

name	Ap1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853578 GeneID:11764 MGI:1096368
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : adaptor-related protein complex AP-1, beta 1 subunit; beta-prime adaptin product : adaptor protein complex AP-1, beta 1 subunit protein_id : NP_031480.2

name	Rasl10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644573 CCDS:CCDS24394.1 GeneID:75668 MGI:1922918
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : RAS-related on chromosome 22 protein_id : NP_660251.1

name	Gas2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281720 GeneID:78926 MGI:1926176
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant beta; GAS2-related protein product : GAS2-related protein isoform beta protein_id : NP_653146.1

name	Gas2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21389322 GeneID:78926 MGI:1926176
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant alpha; GAS2-related protein product : GAS2-related protein isoform alpha protein_id : NP_084504.1

name	Ewsr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853581 CCDS:CCDS24396.1 GeneID:14030 MGI:99960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Ewing sarcoma homolog product : Ewing sarcoma breakpoint region 1 protein_id : NP_031994.2

name	Rhbdd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893529 CCDS:CCDS24397.1 GeneID:279766 MGI:2444684
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : pituitary-derived proapoptotic product : rhomboid domain containing 3 protein_id : NP_796344.1

name	Emid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079312 CCDS:CCDS24398.1 GeneID:140703 MGI:2155091
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : Emu1 product : EMI domain containing 1 protein_id : NP_542162.1

name	Kremen1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345423 CCDS:CCDS24399.1 GeneID:84035 MGI:1933988
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : kringle-coding gene marking the eye and the nose product : kringle-containing transmembrane protein 1 protein_id : NP_115772.2

name	Znrf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286866 GeneID:407821 MGI:3039616
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc and ring finger 3 protein_id : NP_001074393.1

name	LOC100042016 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261629 GeneID:100042016
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478442.1

name	Xbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13775156 CCDS:CCDS24400.1 GeneID:22433 MGI:98970
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : X-box binding protein 1 protein_id : NP_038870.2

name	Ccdc117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794238 CCDS:CCDS24401.1 GeneID:104479 MGI:2144383
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 117 protein_id : NP_598794.1

name	Ankrd36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628652 GeneID:76389 MGI:1923639
definition	codon_start : 1 note : GC3 product : ankyrin repeat domain 48 protein_id : NP_076305.2

name	LOC665181 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94389884 GeneID:665181
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984466.1

name	Mrps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385578 CCDS:CCDS24402.1 GeneID:64660 MGI:1928142
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] codon_start : 1 note : ribosomal protein, mitochondrial, S24 product : mitochondrial ribosomal protein S24 protein_id : NP_080356.1

name	2010005J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938770 GeneID:72046 MGI:1919296
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : up-regulated gene 4 isoform 1 protein_id : NP_848738.2

name	2010005J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938772 GeneID:72046 MGI:1919296
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : up-regulated gene 4 isoform 2 protein_id : NP_001071129.1

name	2210015D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933680 GeneID:76508 MGI:1913774
definition	codon_start : 1 product : hypothetical protein LOC76508 isoform 2 protein_id : XP_898365.1

name	Dbnl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304993 CCDS:CCDS24403.1 GeneID:13169 MGI:700006
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IDA] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051014 - actin filament severing [Evidence IDA]; GO:0051016 - barbed-end actin filament capping [Evidence IDA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0016601 - Rac protein signal transduction [Evidence IDA] codon_start : 1 product : drebrin-like protein_id : NP_038838.1

name	Pgam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256624 CCDS:CCDS24404.1 GeneID:56012 MGI:1933118
definition	GO_function : GO:0004082 - bisphosphoglycerate mutase activity [Evidence IEA]; GO:0004083 - bisphosphoglycerate phosphatase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016868 - intramolecular transferase activity, phosphotransferases [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004619 - phosphoglycerate mutase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phosphoglycerate mutase muscle-specific subunit product : phosphoglycerate mutase 2 protein_id : NP_061358.1

name	Polm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394001 CCDS:CCDS24405.1 GeneID:54125 MGI:1860191
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003912 - DNA nucleotidylexotransferase activity [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030183 - B cell differentiation [Evidence IMP]; GO:0006260 - DNA replication [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence IMP] codon_start : 1 exception : mismatches in translation function : somatic mutation note : DNA polymerase mu product : polymerase (DNA directed), mu protein_id : NP_059097.1

name	Aebp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752998 CCDS:CCDS24406.1 GeneID:11568 MGI:1197012
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 exception : mismatches in translation note : AE-binding protein 1 product : AE binding protein 1 protein_id : NP_033766.1

name	Pold2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679413 CCDS:CCDS24407.1 GeneID:18972 MGI:1097163
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 exception : mismatches in translation note : polymerase (DNA directed), delta 2, regulatory subunit (50 kDa) product : polymerase (DNA directed), delta 2, regulatory subunit protein_id : NP_032920.1

name	Myl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326499 CCDS:CCDS24408.1 GeneID:17898 MGI:107495
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence ISS] [Evidence IEA] GO_function : GO:0042623 - ATPase activity, coupled [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence ISS]; GO:0000146 - microfilament motor activity [Evidence ISS]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0030048 - actin filament-based movement [Evidence ISS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006939 - smooth muscle contraction [Evidence ISS] codon_start : 1 note : myosin light chain, regulatory A product : myosin, light polypeptide 7, regulatory protein_id : NP_075017.2

name	Gck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982798 CCDS:CCDS24409.1 GeneID:103988 MGI:1270854
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004340 - glucokinase activity [Evidence IDA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001678 - cell glucose homeostasis [Evidence IMP]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 note : hexokinase 4 product : glucokinase protein_id : NP_034422.2

name	Ykt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543971 CCDS:CCDS24410.1 GeneID:56418 MGI:1927550
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0019706 - protein-cysteine S-palmitoleyltransferase activity [Evidence ISS]; GO:0005485 - v-SNARE activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS]; GO:0006904 - vesicle docking during exocytosis [Evidence ISS]; GO:0006903 - vesicle targeting [Evidence ISS] codon_start : 1 note : prenylated SNARE protein; prenylated SNARE protein (Ykt6) product : YKT6 v-SNARE protein protein_id : NP_062635.2

name	Camk2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982483 CCDS:CCDS24411.1 GeneID:12323 MGI:88257
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : CaMK II; calcium/calmodulin-dependent protein kinase II, delta product : calcium/calmodulin-dependent protein kinase II, beta protein_id : NP_031621.2

name	Nudcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424587 CCDS:CCDS24412.1 GeneID:209586 MGI:2144158
definition	codon_start : 1 product : NudC domain containing 3 protein_id : NP_776109.1

name	LOC100042173 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261635 GeneID:100042173
definition	codon_start : 1 product : similar to hCG1994130 protein_id : XP_001478693.1

name	Npc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402233 CCDS:CCDS24413.1 GeneID:237636 MGI:2685089
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008158 - hedgehog receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0030301 - cholesterol transport [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Niemann-Pick disease, type C1-like 1 product : NPC1-like 1 protein_id : NP_997125.1

name	LOC100041242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261599 GeneID:100041242
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476081.1

name	Ddx56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312650 CCDS:CCDS24414.1 GeneID:52513 MGI:1277172
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : DEAD-box RNA helicase product : nucleolar RNA helicase homolog protein_id : NP_080814.1

name	Tmed4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527236 CCDS:CCDS24415.1 GeneID:103694 MGI:1915070
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane emp24 protein transport domain containing 4 protein_id : NP_598781.1

name	LOC100042227 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261640 GeneID:100042227
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478727.1

name	Ogdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861164 GeneID:18293 MGI:1098267
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA]; GO:0004591 - oxoglutarate dehydrogenase (succinyl-transferring) activity [Evidence IEA]; GO:0030976 - thiamin pyrophosphate binding [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : alpha-ketoglutarate dehydrogenase product : oxoglutarate dehydrogenase (lipoamide) protein_id : NP_035086.2

name	Zmiz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607100 CCDS:CCDS24418.1 GeneID:52915 MGI:106374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger, MIZ-type containing 2 isoform 1 protein_id : NP_082877.2

name	Zmiz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607102 CCDS:CCDS24417.1 GeneID:52915 MGI:106374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger, MIZ-type containing 2 isoform 2 protein_id : NP_001005867.1

name	Ppia (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679439 CCDS:CCDS24419.1 GeneID:268373 MGI:97749
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence ISS]; GO:0046790 - virion binding [Evidence ISS] GO_process : GO:0006457 - protein folding [Evidence ISS] [Evidence IEA]; GO:0045069 - regulation of viral genome replication [Evidence ISS] codon_start : 1 note : cyclophilin A product : peptidylprolyl isomerase A protein_id : NP_032933.1

name	H2afv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261601 GeneID:77605 MGI:1924855
definition	codon_start : 1 product : H2A histone family, member V protein_id : XP_001476118.1

name	LOC665283 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94389892 GeneID:665283
definition	codon_start : 1 product : similar to SMT3B protein protein_id : XP_980929.1

name	Purb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755252 CCDS:CCDS24420.1 GeneID:19291 MGI:1338779
definition	GO_component : GO:0005662 - DNA replication factor A complex [Evidence IDA]; GO:0000784 - nuclear chromosome, telomeric region [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0003691 - double-stranded telomeric DNA binding [Evidence ISS]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS] [Evidence IDA]; GO:0046332 - SMAD binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence NAS]; GO:0030154 - cell differentiation [Evidence NAS]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0006270 - DNA replication initiation [Evidence ISS]; GO:0006268 - DNA unwinding during replication [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045637 - regulation of myeloid cell differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : vascular actin single-stranded DNA-binding factor 2 p44 component; PurB beta; purine-rich single-stranded DNA-binding protein beta product : purine rich element binding protein B protein_id : NP_035351.1

name	Myo1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410767 CCDS:CCDS24421.1 GeneID:246177 MGI:1927091
definition	GO_component : GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myosin IG protein_id : NP_848534.1

name	LOC100041286 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261603 GeneID:100041286
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476151.1

name	Ccm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122481 CCDS:CCDS24422.1 GeneID:216527 MGI:2384924
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cerebral cavernous malformation 2 homolog protein_id : NP_666126.1

name	LOC100041183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041183
definition	number : 3 pseudo : _no_value

name	LOC100041183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041183
definition	number : 2 pseudo : _no_value

name	LOC100041183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041183
definition	number : 1 pseudo : _no_value

name	LOC626342 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626342
definition	number : 1 pseudo : _no_value

name	LOC100041006 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261597 GeneID:100041006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 132 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_032345.1

name	LOC100042156 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261633 GeneID:100042156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to LOC629446 protein pseudo : _no_value transcript_id : XR_033781.1

name	LOC665250 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261636 GeneID:665250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to RNA polymerase II transcription factor SIII p18 subunit pseudo : _no_value transcript_id : XR_033814.1

name	LOC665277 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261642 GeneID:665277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 327 ESTs, 2 Proteins product : similar to ribosomal protein L36a pseudo : _no_value transcript_id : XR_033842.1

name	LOC665327 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261647 GeneID:665327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 10 Proteins product : similar to hCG2016451 pseudo : _no_value transcript_id : XR_033883.1

clone name	MSMg01-384L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275A10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-146A22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-341P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-372I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509N06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-118O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548O22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-020N19.b	B6Ng01-020N19.g
ACC	DH853537	DH853538
length	922	936
definition	DH853537\|Mus musculus domesticus DNA, BAC clone: B6Ng01-020N19, 5' end.	DH853538\|Mus musculus domesticus DNA, BAC clone: B6Ng01-020N19, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(5,494,428 - 5,495,350)	(5,381,729 - 5,382,351)
sequence	taatgagaatatatttcatattcatattactggacttgttcttggttaaa tgactccaaagggaaatgctttcacttctttcctcagtgagacaccagtg cgtgactggtgactcggagcccatcactaatgcccttgatccacactttc tctgactatacacctcaatcctgggaaagcatggattcctgagggaagat tggatcgactcaaaccgttaacattacagtcctattcctcgagcctggca aacaccctgtgtggagtcagcaccctggcctcagcttggcctggcaggac ttctctaggccacagattcaacttgccctgtcctaggtgactgggtatga attatccctggagtggatgagagatctgctaccagtacagacagatgctt taactagctcaagttattttagccctgtttaacagaagtcttgaattttg tccagaacttatttcttttttaaaatttttatttatgcttcatttacatg ttacatccttatcgaagtttctcctcccccctctcctccaagtccctacc cccgccccccatctcccctctgaattctttattctatatgctcttctaga ttctgcgctaaggatttcaaatgacctttatcacatatgctacaatcctc aaagtgctcagcccttttctaaatctgtgagcaccacccacaagttgtcc ctgcacagaccctgtctgttgatgctgttgtgatagcctggagtaagtcg cactattcccatctttatcctctccactgggtgggtgtttctatattcaa ccaccatatttctagaacactaatctattaatggggagagcgctattgcc atagacttaagggtcattcattgctgccgcttgggcgtggtggcacaacg ccttaatccagcactcgggagg	gaattccatgccatgtaatctcttaagcacgatctggaggggctaagagc caggtggctgcttgaggttaaaacaatgtcttttggaaatagctgaaaac cctttctaattacaagtgtcaatgactagtgaagggtctctagaccagtg gttctcacccttccaaatactatgaccccttaatacagttccttgtgtta tggtgacccctgaccataataaaatttgctttgtcactactgtataactg taattttgggactgttgcgaattttaatgtaaatatctaatagacaactg atatttgactgggggggtcaagacccacaggttgagaaccttcagaacca gcggtacaaaactgtaggatgaatatgcatctattaaagaatttttaaag tccacttatgttaaaacatcaacaatagccatgttgctcctgaggtgctg aggactctctagtcgctcagttcatgagtatggggaccacagcaaaccaa cccagcaccaaaaacctagagagttcacggaatgcagctcattcctcgtc aaccaggaaagcctgcaaaggctggttctggtatcagaggaggagaaacc cgatcttttgggtttagattccatcttagagaacccgacctaaggttgaa ctcaagttgactaacaggccagtacccagcaccagtttccaggttattcc ccaacaaaattgtacctccaggttacaagcctgcccttgctaagaaccac caatcagagggaaacagaagttaagtttacagtttggctgccagcaccag ccaattatgataaaggccacaatactctccccacccccaaattagatgcc caccaggctagaaacactcactccctgcttgccatttcctataaaacctt gttccgatgaggttccaggctgctcacaaaccatcc
quality values	Open. Hide. 47 61 61 43 43 61 61 61 43 40 61 47 61 61 61 61 38 47 61 55 55 55 38 32 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 59 59 61 59 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 55 61 55 61 61 61 61 61 61 61 47 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 53 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 43 61 52 45 14 14 8 14 17 26 61 61 53 47 47 47 47 47 61 61 61 61 61 47 47 53 53 47 53 47 47 53 57 46 47 53 53 42 43 42 42 38 42 27 39 53 57 53 36 30 25 13 22 38 53 53 53 40 46 53 42 53 28 47 40 36 53 32 42 53 53 53 37 28 53 45 22 27 10 7 10 18 36 45 53 53 53 53 43 53 38 53 53 38 38 37 37 38 30 52 53 53 50 50 45 39 43 23 30 47 52 50 39 47 39 43 52 53 50 53 38 53 50 39 19 30 35 35 42 47 33 34 42 42 33 46 18 23 36 50 39 42 41 41 24 47 23 38 35 38 45 37 45 42 52 38 43 38 35 37 39 37 37 53 41 38 39 37 30 37 37 24 52 12 37 27 34 53 36 52 32 57 53 27 27 30 19 36 52 37 52 37 37 53 44 33 53 28 53 19 47 41 28 40 17 52 18 26 29 43 31 37 38 24 36 40 42 36 32 31 47 34 53 53 36 36 28 13 29 29 21 29 28 29 39 34 37 35 34 30 33 23 37 30 30 12 29 53 39 24 53 30 36 30 39 17 23 27 31 34 38 30 28 30 28 32 27 30 31 17 21 14 9 14 6 7 10 13 30 30 33 33 17 14 14 9 7 9 29 12 12 8 6 10 12 15 33 47 29 24 15 9 27 10 24 25 37 31 14 16 7 46 8 24 15 31 18 21 32 25 35 32 22 29 20 46 31 34 23 28 46 9 17 22 19 26 15 15 28 29 33 15 26 25 34 20 41 21 26 16 7 7 17 32 23 29 19 25 25 21 7 6 16 15 36 33 43 41 18 26 31 31 36 22 28 20 7 9 9 17 8 41 30 29 16 10	Open. Hide. 61 61 52 49 61 61 49 32 59 59 59 59 43 59 59 59 52 59 61 61 61 59 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 55 55 61 61 61 59 61 59 59 52 61 61 61 61 61 61 59 59 61 59 59 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 53 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 52 53 50 46 53 53 47 47 42 53 53 53 53 39 57 57 57 53 57 57 53 43 53 57 53 57 47 36 57 53 53 57 47 47 42 47 46 53 52 53 53 57 57 53 53 53 53 57 57 53 57 50 53 53 42 46 50 52 43 50 53 57 53 53 43 47 53 38 57 52 33 57 53 37 52 37 57 57 41 27 57 52 52 57 47 50 38 52 52 52 42 57 28 57 47 16 57 57 28 46 33 43 42 53 53 47 52 50 48 41 57 57 46 46 57 50 45 50 47 45 30 37 27 37 31 47 32 53 53 41 36 53 24 53 35 46 47 39 52 57 31 47 31 50 31 19 37 24 47 25 28 34 37 46 37 52 43 24 21 33 15 11 29 30 30 50 37 52 36 30 12 53 32 53 34 34 52 29 42 57 53 25 40 36 30 47 52 30 27 32 57 53 30 31 24 26 39 33 42 31 36 53 28 57 57 35 27 44 37 33 57 57 37 29 33 32 33 29 41 37 37 32 31 27 23 28 20 11 10 30 24 53 32 30 53 36 47 29 27 19 8 17 31 28 36 24 38 28 46 30 30 32 27 30 25 24 25 31 38 8 8 21 30 45 30 29 45 29 28 28 25 36 33 18 35 38 18 32 23 31 46 29 31 36 31 35 31 51 29 45 31 28 38 39 29 35 24 18 29 22 29 35 30 30 33 41 28 26 31 35 29 29 29 35 16 33 39 24 22 39 18 34 34 34 23 29 29 32 28 29 28 29 28 51 43 38 28 29 39 41 31 33 27 29 26 35 19 19 20 31 22 29 18 46 29 14 11 30 20 15 26 31 28 34 28 32 51 22 28 14 29 28 31 22 28 27 21 46 23 15 33 28 26 22 29 18 19 18 38 51 25 26 28 27 30 18 14 46 41 30 15 21 25 24 29 13 29 28 32 10 31 28 20 19 31 32 21 23 25 6 5 10 22 21 23 28 9 14 32 10 23 7 28 18 19 24 20 29 27 20

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_5494428_5495350
seq2: B6Ng01-020N19.b_55_976 (reverse)

seq1  CCTCCCGAGTGCTGGGATTAAAGGCG-TGTGCCACCACGCCCAAGCGGCA  49
      ||||||||||||| ||||| |||||| |||||||||||||||||||||||
seq2  CCTCCCGAGTGCT-GGATT-AAGGCGTTGTGCCACCACGCCCAAGCGGCA  48

seq1  GCAATGAATGACCCTTAAGTCTATGGCCATAGCGCTCTCCCCATTAATAG  99
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  GCAATGAATGACCCTTAAGTCTATGGCAATAGCGCTCTCCCCATTAATAG  98

seq1  ATTAGTGTTCTAGTAATATGGTGGTTGAATATAGAAACACCCACCCAGTG  149
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  ATTAGTGTTCTAGAAATATGGTGGTTGAATATAGAAACACCCACCCAGTG  148

seq1  GAGAGGATAAAGATGGGAATAGTGCGACTTACTCCAGGCTATCACAACAG  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGGATAAAGATGGGAATAGTGCGACTTACTCCAGGCTATCACAACAG  198

seq1  CATCAACAGACAGGGTCTGTGCAGGGACAACTTGTGGGTGGTGCTCACAG  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAACAGACAGGGTCTGTGCAGGGACAACTTGTGGGTGGTGCTCACAG  248

seq1  ATTTAGAAAAGGGCTGAGCACTTTGAGGATTGTAGCATATGTGATAAAGG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGAAAAGGGCTGAGCACTTTGAGGATTGTAGCATATGTGATAAAGG  298

seq1  TCATTTGAAATCCTTAGCGCAGAATCTAGAAGAGCATATAGAATAAAGAA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTGAAATCCTTAGCGCAGAATCTAGAAGAGCATATAGAATAAAGAA  348

seq1  TTCAGAGGGGAGATGGGGGGCGGGGGTAGGGACTTGGAGGAGAGGGGGGA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGAGGGGAGATGGGGGGCGGGGGTAGGGACTTGGAGGAGAGGGGGGA  398

seq1  GGAGAAACTTCGATAAGGATGTAACATGTAAATGAAGCATAAATAAAAAT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAAACTTCGATAAGGATGTAACATGTAAATGAAGCATAAATAAAAAT  448

seq1  TTTAAAAAAGAAATAAGTTCTGGACAAAATTCAAGACTTCTGTTAAACAG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAAAAAGAAATAAGTTCTGGACAAAATTCAAGACTTCTGTTAAACAG  498

seq1  GGCTAAAATAACTTGAGCTAGTTAAAGCATCTGTCTGTACTGGTAGCAGA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTAAAATAACTTGAGCTAGTTAAAGCATCTGTCTGTACTGGTAGCAGA  548

seq1  TCTCTCATCCACTCCAGGGATAATTCATACCCAGTCACCTAGGACAGGGC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCATCCACTCCAGGGATAATTCATACCCAGTCACCTAGGACAGGGC  598

seq1  AAGTTGAATCTGTGGCCTAGAGAAGTCCTGCCAGGCCAAGCTGAGGCCAG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTGAATCTGTGGCCTAGAGAAGTCCTGCCAGGCCAAGCTGAGGCCAG  648

seq1  GGTGCTGACTCCACACAGGGTGTTTGCCAGGCTCGAGGAATAGGACTGTA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCTGACTCCACACAGGGTGTTTGCCAGGCTCGAGGAATAGGACTGTA  698

seq1  ATGTTAACGGTTTGAGTCGATCCAATCTTCCCTCAGGAATCCATGCTTTC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTAACGGTTTGAGTCGATCCAATCTTCCCTCAGGAATCCATGCTTTC  748

seq1  CCAGGATTGAGGTGTATAGTCAGAGAAAGTGTGGATCAAGGGCATTAGTG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGATTGAGGTGTATAGTCAGAGAAAGTGTGGATCAAGGGCATTAGTG  798

seq1  ATGGGCTCCGAGTCACCAGTCACGCACTGGTGTCTCACTGAGGAAAGAAG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGCTCCGAGTCACCAGTCACGCACTGGTGTCTCACTGAGGAAAGAAG  848

seq1  TGAAAGCATTTCCCTTTGGAGTCATTTAACCAAGAACAAGTCCAGTAATA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAGCATTTCCCTTTGGAGTCATTTAACCAAGAACAAGTCCAGTAATA  898

seq1  TGAATATGAAATATATTCTCATTA  923
      ||||||||||||||||||||||||
seq2  TGAATATGAAATATATTCTCATTA  922

seq1: chr11_5381729_5382351
seq2: B6Ng01-020N19.g_66_688

seq1  GAATTCCATGCCATGTAATCTCTTAAGCACGATCTGGAGGGGCTAAGAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATGCCATGTAATCTCTTAAGCACGATCTGGAGGGGCTAAGAGC  50

seq1  CAGGTGGCTGCTTGAGGTTAAAACAATGTCTTTTGGAAATAGCTGAAAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTGGCTGCTTGAGGTTAAAACAATGTCTTTTGGAAATAGCTGAAAAC  100

seq1  CCTTTCTAATTACAAGTGTCAATGACTAGTGAAGGGTCTCTAGACCAGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTCTAATTACAAGTGTCAATGACTAGTGAAGGGTCTCTAGACCAGTG  150

seq1  GTTCTCACCCTTCCAAATACTATGACCCCTTAATACAGTTCCTTGTGTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTCACCCTTCCAAATACTATGACCCCTTAATACAGTTCCTTGTGTTA  200

seq1  TGGTGACCCCTGACCATAATAAAATTTGCTTTGTCACTACTGTATAACTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGACCCCTGACCATAATAAAATTTGCTTTGTCACTACTGTATAACTG  250

seq1  TAATTTTGGGACTGTTGCGAATTTTAATGTAAATATCTAATAGACAACTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTTGGGACTGTTGCGAATTTTAATGTAAATATCTAATAGACAACTG  300

seq1  ATATTTGACTGGGGGGGTCAAGACCCACAGGTTGAGAACCTTCAGAACCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTTGACTGGGGGGGTCAAGACCCACAGGTTGAGAACCTTCAGAACCA  350

seq1  GCGGTACAAAACTGTAGGATGAATATGCATCTATTAAAGAATTTTTAAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGTACAAAACTGTAGGATGAATATGCATCTATTAAAGAATTTTTAAAG  400

seq1  TCCACTTATGTTAAAACATCAACAATAGCCATGTTGCTCCTGAGGTGCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACTTATGTTAAAACATCAACAATAGCCATGTTGCTCCTGAGGTGCTG  450

seq1  AGGACTCTCTAGTCGCTCAGTTCATGAGTATGGGGACCACAGCAAACCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACTCTCTAGTCGCTCAGTTCATGAGTATGGGGACCACAGCAAACCAA  500

seq1  CCCAGCACCAAAAACCTAGAGAGTTCACGGAATGCAGCTCATTCCTCGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCACCAAAAACCTAGAGAGTTCACGGAATGCAGCTCATTCCTCGTC  550

seq1  AACCAGGAAAGCCTGCAAAGGCTGGTTCTGGTATCAGAGGAGGAGAAACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCAGGAAAGCCTGCAAAGGCTGGTTCTGGTATCAGAGGAGGAGAAACC  600

seq1  CGATCTTTTGGGTTTAGATTCCA  623
      |||||||||||||||||||||||
seq2  CGATCTTTTGGGTTTAGATTCCA  623

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information