MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-102G02
Chromosome	11 (Build37)
Map Location	50,121,208 - 50,122,355
singlet/doublet	singlet
Overlap gene	Canx
Upstream gene	Olfr10, Olfr1391, Olfr1390, LOC667286, Olfr1389, Olfr1388, Olfr1387, Olfr1386, Olfr1385, Olfr1549-ps1, Olfr1384, Olfr1383, Olfr1382, GA_x5J8B7TT7LR-4113-3651, Olfr1381, Olfr1380, Flt4, LOC100040032, Scgb3a1, Cnot6, LOC666899, LOC100040073, Gfpt2, Mapk9, Rasgef1c, Rnf130, LOC380696, Tbc1d9b, 3010026O09Rik, Sqstm1, Mgat4b, Ltc4s, Maml1
Downstream gene	1700121K02Rik, Hnrph1, Rufy1, Adamts2, Zfp354c, 9630041N07Rik, Grm6, Zfp454, Zfp2, Zfp354b, Prop1, Olfr1379-ps1, Olfr1378, Olfr1377, Olfr226-ps1, Olfr51, Olfr54, Olfr1375-ps1, Zfp354a, LOC100040275, LOC382518, Olfr1374-ps1, 5133400J02Rik, LOC622699, BC049762, Clk4, Col23a1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18307 MGI:107598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258460 MGI:3031225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1390 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259068 MGI:3031224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr1389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259069 MGI:3031223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1388 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258459 MGI:3031222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1387 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258465 MGI:3031221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257888 MGI:3031220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258027 MGI:3031219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1549-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257977 MGI:3031383
definition	gene_synonym : MOR256-42P note : olfactory receptor 1549, pseudogene 1 pseudo : _no_value

name	Olfr1384 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258464 MGI:3031218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1383 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404337 MGI:3031217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257971 MGI:3031216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TT7LR-4113-3651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257864
definition	note : olfactory receptor GA_x5J8B7TT7LR-4113-3651 pseudo : _no_value

name	Olfr1381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258461 MGI:3031215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404336 MGI:3031214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14257 MGI:95561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Scgb3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68662 MGI:1915912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cnot6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104625 MGI:2144529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 649 ESTs, 6 Proteins

name	LOC100040073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gfpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14584 MGI:1338883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26420 MGI:1346862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rasgef1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74563 MGI:1921813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59044 MGI:1891717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC380696 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380696
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	Tbc1d9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76795 MGI:1924045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3010026O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68067 MGI:1915317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sqstm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18412 MGI:107931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103534 MGI:2143974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltc4s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17001 MGI:107498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103806 MGI:1890504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Canx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12330 MGI:88261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700121K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76653 MGI:1923903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	Hnrph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59013 MGI:1891925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rufy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216724 MGI:2429762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamts2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216725 MGI:1347356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp354c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30944 MGI:1353621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630041N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214779 MGI:3053099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108072 MGI:1351343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237758 MGI:2679253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22678 MGI:99167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Zfp354b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27274 MGI:1351476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19127 MGI:109330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1379-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404506 MGI:3031213
definition	gene_synonym : MOR129-5_p note : olfactory receptor 1379, pseudogene 1 pseudo : _no_value

name	Olfr1378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258912 MGI:3031212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1377 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258913 MGI:3031211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr226-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258202 MGI:3030060
definition	gene_synonym : MOR129-4P note : olfactory receptor 226, pseudogene 1 pseudo : _no_value

name	Olfr51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18351 MGI:1333747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18354 MGI:1333750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1375-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258509 MGI:3031209
definition	gene_synonym : MOR126-2; RP23-217L7.2 note : olfactory receptor 1375, pseudogene 1 pseudo : _no_value

name	Zfp354a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21408 MGI:103172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC382518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382518
definition	note : tubulin alpha-4 pseudogene pseudo : _no_value

name	Olfr1374-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257969 MGI:3031208
definition	gene_synonym : MOR256-44P note : olfactory receptor 1374, pseudogene 1 pseudo : _no_value

name	5133400J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71297 MGI:1918547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC622699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	BC049762 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193286 MGI:3039622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12750 MGI:1098551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col23a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237759 MGI:2653243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45592945 GeneID:18307 MGI:107598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 10 transcript_id : NM_206822.1

name	Olfr1391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238937 GeneID:258460 MGI:3031225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1391 transcript_id : NM_146468.1

name	Olfr1390 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227394 GeneID:259068 MGI:3031224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1390 transcript_id : NM_147065.1

name	Olfr1389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128828 GeneID:259069 MGI:3031223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1389 transcript_id : NM_147066.1

name	Olfr1388 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238931 GeneID:258459 MGI:3031222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1388 transcript_id : NM_146467.1

name	Olfr1387 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238939 GeneID:258465 MGI:3031221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1387 transcript_id : NM_146473.1

name	Olfr1386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801275 GeneID:257888 MGI:3031220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1386 transcript_id : NM_001011741.1

name	Olfr1385 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801375 GeneID:258027 MGI:3031219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1385 transcript_id : NM_001011805.1

name	Olfr1384 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238941 GeneID:258464 MGI:3031218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1384 transcript_id : NM_146472.1

name	Olfr1383 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430595 GeneID:404337 MGI:3031217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1383 transcript_id : NM_207574.1

name	Olfr1382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801345 GeneID:257971 MGI:3031216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1382 transcript_id : NM_001011790.1

name	Olfr1381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170045 GeneID:258461 MGI:3031215
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1381 transcript_id : NM_146469.1

name	Olfr1380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430601 GeneID:404336 MGI:3031214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1380 transcript_id : NM_207573.1

name	Flt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801963 GeneID:14257 MGI:95561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 4 transcript_id : NM_008029.2

name	Scgb3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25014111 GeneID:68662 MGI:1915912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 3A, member 1 transcript_id : NM_170727.1

name	Scgb3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905068 GeneID:68662 MGI:1915912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 3A, member 1 transcript_id : NM_054037.1

name	Cnot6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059014 GeneID:104625 MGI:2144529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 6 transcript_id : NM_212484.1

name	LOC666899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390048 GeneID:666899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 649 ESTs, 6 Proteins product : similar to ribosomal protein L30 transcript_id : XM_001000091.1

name	Gfpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386698 GeneID:14584 MGI:1338883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 2 transcript_id : NM_013529.2

name	Mapk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592768 GeneID:26420 MGI:1346862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 9 transcript_id : NM_016961.2

name	Mapk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592832 GeneID:26420 MGI:1346862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 9 transcript_id : NM_207692.1

name	Rasgef1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73088861 GeneID:74563 MGI:1921813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RasGEF domain family, member 1C transcript_id : NM_029004.1

name	Rnf130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892292 GeneID:59044 MGI:1891717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 130 transcript_id : NM_021540.3

name	Tbc1d9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358939 GeneID:76795 MGI:1924045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 9B transcript_id : NM_029745.2

name	3010026O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350731 GeneID:68067 MGI:1915317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3010026O09 gene transcript_id : NM_026543.2

name	Sqstm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130186 GeneID:18412 MGI:107931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sequestosome 1 transcript_id : NM_011018.2

name	Mgat4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239191 GeneID:103534 MGI:2143974
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 4, isoenzyme B transcript_id : NM_145926.2

name	Ltc4s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678733 GeneID:17001 MGI:107498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukotriene C4 synthase transcript_id : NM_008521.1

name	Maml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341628 GeneID:103806 MGI:1890504
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mastermind like 1 (Drosophila) transcript_id : NM_175334.2

name	Canx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542338 GeneID:12330 MGI:88261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calnexin transcript_id : NM_007597.2

name	1700121K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261874 GeneID:76653 MGI:1923903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : RIKEN cDNA 1700121K02 gene transcript_id : XM_484016.4

name	Hnrph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628660 GeneID:59013 MGI:1891925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein H1 transcript_id : NM_021510.2

name	Rufy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388074 GeneID:216724 MGI:2429762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 1 transcript_id : NM_172557.2

name	Adamts2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130291 GeneID:216725 MGI:1347356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 transcript_id : NM_175643.2

name	Zfp354c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681198 GeneID:30944 MGI:1353621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354C transcript_id : NM_013922.4

name	9630041N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802593 GeneID:214779 MGI:3053099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630041N07 gene transcript_id : NM_173387.2

name	Grm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734061 GeneID:108072 MGI:1351343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, metabotropic 6 transcript_id : NM_173372.1

name	Zfp454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982551 GeneID:237758 MGI:2679253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 454 transcript_id : NM_172794.2

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374187 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044700.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374179 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044699.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374177 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044698.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374175 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044697.1

name	Zfp354b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475952 GeneID:27274 MGI:1351476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354B transcript_id : NM_013744.2

name	Prop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679480 GeneID:19127 MGI:109330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired like homeodomain factor 1 transcript_id : NM_008936.1

name	Olfr1378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129068 GeneID:258912 MGI:3031212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1378 transcript_id : NM_146910.1

name	Olfr1377 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129070 GeneID:258913 MGI:3031211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1377 transcript_id : NM_146911.1

name	Olfr51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170065 GeneID:18351 MGI:1333747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 51 transcript_id : NM_146909.1

name	Olfr54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203766 GeneID:18354 MGI:1333750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 54 transcript_id : NM_010997.1

name	Zfp354a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374174 GeneID:21408 MGI:103172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354A transcript_id : NM_009329.3

name	LOC100040275 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261876 GeneID:100040275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040275 transcript_id : XM_001474403.1

name	5133400J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261887 GeneID:71297 MGI:1918547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133400J02 gene transcript_id : XM_001475111.1

name	LOC622699 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390078 GeneID:622699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : hypothetical LOC622699 transcript_id : XM_887141.2

name	BC049762 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802050 GeneID:193286 MGI:3039622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049762 transcript_id : NM_177567.3

name	Clk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373542 GeneID:12750 MGI:1098551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC like kinase 4 transcript_id : NM_007714.3

name	Col23a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510252 GeneID:237759 MGI:2653243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XXIII, alpha 1 transcript_id : NM_153393.1

name	Olfr10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592946 CCDS:CCDS24605.1 GeneID:18307 MGI:107598
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : olfactory receptor 10 protein_id : NP_996558.1

name	Olfr1391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238938 CCDS:CCDS24606.1 GeneID:258460 MGI:3031225
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6107233-6106298; olfactory receptor MOR256-27 product : olfactory receptor 1391 protein_id : NP_666679.1

name	Olfr1390 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227395 CCDS:CCDS24607.1 GeneID:259068 MGI:3031224
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6094111-6093176; olfactory receptor MOR256-2 product : olfactory receptor 1390 protein_id : NP_667276.1

name	Olfr1389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128829 CCDS:CCDS24608.1 GeneID:259069 MGI:3031223
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6004387-6003452; olfactory receptor MOR256-1 product : olfactory receptor 1389 protein_id : NP_667277.1

name	Olfr1388 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238932 CCDS:CCDS24609.1 GeneID:258459 MGI:3031222
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5991012-5990077; olfactory receptor MOR256-28 product : olfactory receptor 1388 protein_id : NP_666678.1

name	Olfr1387 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238940 CCDS:CCDS24610.1 GeneID:258465 MGI:3031221
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5975166-5974231; olfactory receptor MOR256-22 product : olfactory receptor 1387 protein_id : NP_666684.1

name	Olfr1386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801276 CCDS:CCDS24611.1 GeneID:257888 MGI:3031220
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5964781-5963852; olfactory receptor MOR256-50 product : olfactory receptor 1386 protein_id : NP_001011741.1

name	Olfr1385 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801376 CCDS:CCDS24612.1 GeneID:258027 MGI:3031219
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5941817-5940888; olfactory receptor MOR256-41P product : olfactory receptor 1385 protein_id : NP_001011805.1

name	Olfr1384 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238942 CCDS:CCDS24613.1 GeneID:258464 MGI:3031218
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5922712-5921756; olfactory receptor MOR256-23 product : olfactory receptor 1384 protein_id : NP_666683.1

name	Olfr1383 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430596 CCDS:CCDS24614.1 GeneID:404337 MGI:3031217
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5912627-5911692; odorant receptor; olfactory receptor GA_x5J8B7W6B6J-2556603-2556836 product : olfactory receptor 1383 protein_id : NP_997457.1

name	Olfr1382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801346 CCDS:CCDS24615.1 GeneID:257971 MGI:3031216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5901165-5900230; olfactory receptor MOR256-43P product : olfactory receptor 1382 protein_id : NP_001011790.1

name	Olfr1381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170046 CCDS:CCDS24616.1 GeneID:258461 MGI:3031215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QP88-5884501-5883566; olfactory receptor MOR256-26 product : olfactory receptor 1381 protein_id : NP_666680.1

name	Olfr1380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430602 CCDS:CCDS24617.1 GeneID:404336 MGI:3031214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MOR256-66_i; GA_x6K02T2QP88-5871967-5871032 product : olfactory receptor 1380 protein_id : NP_997456.1

name	Flt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679813 CCDS:CCDS24618.1 GeneID:14257 MGI:95561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : vascular endothelial growth factor receptor-3; chylous ascites; receptor protein tyrosine kinase product : FMS-like tyrosine kinase 4 protein_id : NP_032055.1

name	Scgb3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905069 CCDS:CCDS24619.1 GeneID:68662 MGI:1915912
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : type A is encoded by transcript variant A; pneumo secretory protein 2; uteroglobin related protein 2; family 3A member 1 secretoglobin product : secretoglobin, family 3A, member 1 type A protein_id : NP_473378.1

name	Scgb3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25014112 GeneID:68662 MGI:1915912
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : type B is encoded by transcript variant B; pneumo secretory protein 2; uteroglobin related protein 2; family 3A member 1 secretoglobin product : secretoglobin, family 3A, member 1 type B protein_id : NP_733923.1

name	Cnot6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059015 CCDS:CCDS24621.1 GeneID:104625 MGI:2144529
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCR4-NOT transcription complex, subunit 6 protein_id : NP_997649.1

name	LOC666899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390049 GeneID:666899
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_001000091.1

name	Gfpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305087 CCDS:CCDS24622.1 GeneID:14584 MGI:1338883
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence TAS]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutamine fructose-6-phosphate transaminase 2 protein_id : NP_038557.1

name	Mapk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592833 CCDS:CCDS24623.1 GeneID:26420 MGI:1346862
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; protein kinase, mitogen-activated 9; Jun kinase; JNK/SAPK alpha product : mitogen activated protein kinase 9 isoform a protein_id : NP_997575.1

name	Mapk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393749 CCDS:CCDS24624.1 GeneID:26420 MGI:1346862
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protein kinase, mitogen-activated 9; Jun kinase; JNK/SAPK alpha product : mitogen activated protein kinase 9 isoform b protein_id : NP_058657.1

name	Rasgef1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73088862 CCDS:CCDS24625.1 GeneID:74563 MGI:1921813
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : RasGEF domain family, member 1C protein_id : NP_083280.1

name	Rnf130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981195 CCDS:CCDS24626.1 GeneID:59044 MGI:1891717
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : g1-related zinc finger protein product : ring finger protein 130 protein_id : NP_067515.2

name	Tbc1d9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358940 GeneID:76795 MGI:1924045
definition	codon_start : 1 product : TBC1 domain family, member 9B protein_id : NP_084021.2

name	3010026O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386048 GeneID:68067 MGI:1915317
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68067 protein_id : NP_080819.1

name	Sqstm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754954 CCDS:CCDS24629.1 GeneID:18412 MGI:107931
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0003712 - transcription cofactor activity [Evidence TAS]; GO:0043130 - ubiquitin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016197 - endosome transport [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0008104 - protein localization [Evidence ISS]; GO:0043122 - regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 note : oxidative stress induced product : sequestosome 1 protein_id : NP_035148.1

name	Mgat4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239192 CCDS:CCDS24630.1 GeneID:103534 MGI:2143974
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B product : N-acetylglucosaminyltransferase IVb protein_id : NP_666038.2

name	Ltc4s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678734 CCDS:CCDS24631.1 GeneID:17001 MGI:107498
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IEA]; GO:0004464 - leukotriene-C4 synthase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : leukotriene C4 synthase protein_id : NP_032547.1

name	Maml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425022 CCDS:CCDS24632.1 GeneID:103806 MGI:1890504
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence IDA] GO_process : GO:0007219 - Notch signaling pathway [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mastermind like 1 protein_id : NP_780543.1

name	Canx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671664 CCDS:CCDS24633.1 GeneID:12330 MGI:88261
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : calnexin protein_id : NP_031623.1

name	1700121K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261875 GeneID:76653 MGI:1923903
definition	codon_start : 1 product : hypothetical protein LOC76653 protein_id : XP_484016.3

name	Hnrph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946928 CCDS:CCDS24634.1 GeneID:59013 MGI:1891925
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein H1 protein_id : NP_067485.1

name	Rufy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369788 CCDS:CCDS24635.1 GeneID:216724 MGI:2429762
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IDA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : FYVE-finger containing protein; Rab4a interacting protein product : RUN and FYVE domain containing 1 protein_id : NP_766145.1

name	Adamts2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563307 CCDS:CCDS24636.1 GeneID:216725 MGI:1347356
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0017074 - procollagen N-endopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0051605 - proteolysis during protein maturation [Evidence IMP]; GO:0043588 - skin development [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : procollagen N-proteinase; a disintegrin and metalloproteinase with thrombospondin repeats product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2 protein_id : NP_783574.1

name	Zfp354c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592078 CCDS:CCDS24637.1 GeneID:30944 MGI:1353621
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : transcription factor 17-like 2 product : zinc finger protein 354C protein_id : NP_038950.3

name	9630041N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734192 CCDS:CCDS24638.1 GeneID:214779 MGI:3053099
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : novel zinc finger protein product : hypothetical protein LOC214779 protein_id : NP_775563.1

name	Grm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734062 GeneID:108072 MGI:1351343
definition	GO_function : GO:0001642 - group III metabotropic glutamate receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : G protein-coupled receptor, family C, group 1, member F; G protein-coupled receptor GRM6; metabotropic glutamate receptor 6 product : glutamate receptor, metabotropic 6 protein_id : NP_775548.1

name	Zfp454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982552 CCDS:CCDS24639.1 GeneID:237758 MGI:2679253
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 454 protein_id : NP_766382.2

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374176 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038162.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374178 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038163.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374180 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038164.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374188 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038165.1

name	Zfp354b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305545 CCDS:CCDS24641.1 GeneID:27274 MGI:1351476
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : transcription factor 17-like 1 product : zinc finger protein 354B protein_id : NP_038772.1

name	Prop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679481 CCDS:CCDS24643.1 GeneID:19127 MGI:109330
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0048732 - gland development [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : prophet of Pit-1; Ames dwarf; pituitary specific homeodomain factor product : paired like homeodomain factor 1 protein_id : NP_032962.1

name	Olfr1378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129069 CCDS:CCDS24644.1 GeneID:258912 MGI:3031212
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4469162-4468215; olfactory receptor MOR129-2 product : olfactory receptor 1378 protein_id : NP_667121.1

name	Olfr1377 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129071 CCDS:CCDS24645.1 GeneID:258913 MGI:3031211
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4453480-4452557; olfactory receptor MOR129-1 product : olfactory receptor 1377 protein_id : NP_667122.1

name	Olfr51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170066 CCDS:CCDS24646.1 GeneID:18351 MGI:1333747
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4431129-4430206; olfactory receptor MOR129-3 product : olfactory receptor 51 protein_id : NP_667120.1

name	Olfr54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203767 CCDS:CCDS24647.1 GeneID:18354 MGI:1333750
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4411197-4410256; olfactory receptor MOR126-1 product : olfactory receptor 54 protein_id : NP_035127.1

name	Zfp354a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982823 CCDS:CCDS24648.1 GeneID:21408 MGI:103172
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription factor 17 product : zinc finger protein 354A protein_id : NP_033355.2

name	LOC100040275 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261877 GeneID:100040275
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474453.1

name	5133400J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261888 GeneID:71297 MGI:1918547
definition	codon_start : 1 product : hypothetical protein LOC71297 protein_id : XP_001475161.1

name	LOC622699 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390079 GeneID:622699
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892234.2

name	BC049762 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243908 CCDS:CCDS24650.1 GeneID:193286 MGI:3039622
definition	codon_start : 1 product : hypothetical protein LOC193286 protein_id : NP_808235.1

name	Clk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671766 CCDS:CCDS24651.1 GeneID:12750 MGI:1098551
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : CDC like kinase 4 protein_id : NP_031740.1

name	Col23a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510253 CCDS:CCDS24652.1 GeneID:237759 MGI:2653243
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : collagen type XXIII, alpha 1 product : procollagen, type XXIII, alpha 1 protein_id : NP_700442.1

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 1 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 2 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 3 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 4 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 5 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 1 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 2 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 3 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 4 pseudo : _no_value

name	LOC100040073 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040073
definition	number : 1 pseudo : _no_value

clone name	MSMg01-384L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-488G03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-072K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275E15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-424O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105B13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-102G02.b	B6Ng01-102G02.g
ACC	DH911289	DH911290
length	1,131	1,183
definition	DH911289\|Mus musculus domesticus DNA, BAC clone: B6Ng01-102G02, 5' end.	DH911290\|Mus musculus domesticus DNA, BAC clone: B6Ng01-102G02, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaaagagcaaactttgaaaaacacatacttcctctcataaaactg catgcaaattattctattagctttaaagaaaaccttatgattttatagtg cttcttcagataccaatcaaaaataactggcaaccaccagaaatactaaa atgcttttttaaagagaagttatgtacatacaaacttctttcaaaaacaa gaaataaacttgagaaaactaaaaattgttagcacacaggtgaggcctcc ctggtctacacagcaaactccatgcagcaagggatacccacccaatgata tcctgtgtaaaaatacaaaacaaaacaataaaaaacctaaaaattccaca gttaagaaagcagcaatgaaatacagctaaggcttctacagtcccctgtt aaagttaaaaggccattagtgccaagtctccatggttcaccagcagcagc atttcttttcataggtcttgcaaacttttctctctttaaatgatggggac taaacccagggccctgtgaatggcagccatgtactctaccactgaactgc ataccccccaagctcaagatcataaagcacatgttacacaaagagagagc ctaccaggctgagctctgccgtcttggaaagcagcttcacataggcacca ccacattctattccattctgaaaattaacctcatacctagtttcagagag aaaagaaaaagtcctatggcattttgaaagatcatatttcctatatttcc taattgatttctcccagcttggtcatgttttatcagatgtcatacccaca caaaaggttccattgtctactgcttttatgtggccactcggccacacaaa aatcaaaaaaacaaaataaaagtaatccttaatgcaaaagccagacattt gtttgcttctaagaaggtaaacaaccagactgttttacaagaagataaaa caaaccactcaacatattccaattcacacaaatcctactataaacatgat ttttagaatgttcaactttcatactgtcacctgagattaccctttctaga aaatatcagatgcacctgaactactgacatgagaggctggtatcaacaga gctattcagttaggaagaaatggcatgatgc	gaattcaggacctctggaagagcagtcagtgctcttaacggcagagccat cgctccagccccgccccctttggtttttcttaaacccaacaaatcttgca gttttggaggtcagatgtttaaaattgcttggcagggctgcctctgttct gaagttcttgggagaaaatctgttttcttttctttttttattattttaat agtatcttttaattgagtatttgggaatttcacatcatgcaccccaattg ccatcactccctgatctttccatgaccatccccttcttccatgacctccc ccaccaaaaaaaaaaaaagaagggaaaaaataagtccattttgtgtggtc catatattcgctggcgcatggtcaaattcctagtagccactctccccgcc tccataagtctctctgcttgcatccgggccagaaaccttcaactgaggag agagccctgcaggctgatggaaaggggtggggccagctctcctgcacagg gtggggcctgccttccctcccttaagtacattaacatggcttgggggagg ggcagcccattaacatgggcttccgtggtaacaagggctgcagatatcaa cataacccttggcagtatcaagccactcatggccctcatcatcttcacag gccacaggccacacggcctcaggtggctctacatgctggttatacggcat ggcccttaaatgcccttaaggcagcaaagcctgaggatatcaccaaggcg tgaggcagcagcacagattgcttaagtcctcgtggatctcacgcttcatc tcttcctggggcaaccacatgggtcgcagtcaccaatatggcctccagtg gcctcggggaccactatggtccaatccagcaagtgaaccttttctttttc tccggcttccatcctgcccaggccagagagaccccgagcccagcagcagt ctgagctgagtctgtgtctggataactccagctgctgtgtttcatcctac tgactctactgagcatgacagtatgtcccccctcagcctctgtccttgca caccatcgcagctccaatctgcctctctctaggactcgcatgcctatttc atctcttaccttcacccgccatcaatgcatgagggttcaccgtcctgagc catctgttcagggggtatgtgtgggggatacgt
quality values	Open. Hide. 61 47 43 38 61 38 35 55 61 61 61 49 61 55 61 61 61 61 61 61 61 61 61 61 61 61 43 38 43 33 28 28 28 41 52 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 35 55 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 59 61 61 61 61 59 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 57 57 57 57 57 57 53 57 57 57 57 57 52 57 53 57 53 57 53 57 53 57 57 57 57 57 57 53 57 57 57 57 57 53 50 57 53 57 57 53 57 52 57 53 57 52 47 57 53 57 47 53 45 50 57 53 57 53 57 23 57 57 57 57 57 53 57 53 53 57 53 57 57 53 57 57 57 43 43 57 50 53 57 47 57 53 57 47 52 52 47 47 52 53 57 57 46 57 57 53 53 53 57 43 53 52 57 53 41 46 52 45 43 43 46 47 47 53 43 41 52 34 52 43 45 43 57 53 53 43 50 50 50 57 52 50 42 53 57 52 39 32 38 57 34 57 38 53 57 57 57 33 50 57 57 57 57 33 37 52 53 44 52 53 44 57 36 34 37 57 57 53 40 53 57 52 37 40 23 42 40 42 37 40 57 57 36 53 34 41 40 33 37 33 37 33 57 33 40 40 32 33 26 37 31 57 47 40 47 41 57 40 27 36 48 53 24 44 44 23 36 33 31 57 28 46 51 32 38 34 34 36 26 48 28 45 24 40 30 30 32 27 51 38 24 47 29 36 22 51 51 46 16 44 20 30 34 39 28 41 29 45 28 48 28 29 29 30 46 28 29 51 51 30 29 29 47 28 45 38 23 29 26 29 30 30 31 34 22 46 23 29 28 43 26 46 51 46 22 29 35 25 51 46 51 51 46 43 30 30 43 43 36 33 29 46 46 35 33 34 23 30 28 33 31 24 46 16 26 28 43 34 30 39 51 39 28 35 43 24 19 38 28 22 22 46 29 30 29 51 26 23 21 33 34 29 26 16 32 27 31 13 13 21 15 21 51 32 27 20 19 20 30 25 28 29 25 27 29 18 51 51 33 23 35 21 26 29 29 28 15 29 12 29 51 51 31 18 16 44 26 31 6 18 35 36 29 20 18 28 28 34 28 28 28 20 28 20 21 14 23 33 10 12 13 17 25 42 23 17 4 22 34 31 31 18 24 12 20 33 7 15 12 27 33 33 26 44 44 44 29 13 19 33 33 23 38 11 21 27 14 18 29 26 42 23 13 11 10 6 24 23 29 16 29 12 15 26 16 25 13 5 14 7 13 29 26 42 14 10 34 24 20 23 13 13 23 34 34 13 11 7 20 14 18 4 14 4 19 5 9 9 11 14 6 14 9 15 27 12 21 13 7 13 6 21 7 17 14 7 11 11 21 9 16 4 18 4 3 5 15 23 18 4 4 5 4 4 3 9 4 4 27 12 13 3 4 3 13 6 4 1 3 4 10 5 10 7 13 12 7 16 6 9 7 10 18 4	Open. Hide. 61 61 55 55 61 38 27 18 29 30 26 28 35 35 49 59 59 59 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 59 61 61 59 59 61 61 61 44 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 49 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 52 55 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 53 61 37 53 61 43 61 53 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 53 61 50 61 61 61 61 61 61 61 53 61 61 61 61 52 61 53 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 61 50 61 61 61 61 46 61 61 61 61 61 61 61 61 61 61 61 61 61 61 57 53 53 57 53 53 57 53 47 53 53 57 57 57 53 57 57 57 53 57 57 57 45 50 47 42 47 34 47 47 47 45 57 53 53 57 47 47 57 53 53 53 52 45 53 57 57 57 53 57 53 50 53 53 47 57 57 45 57 53 45 42 53 50 57 52 36 57 57 50 53 31 57 42 50 47 53 52 53 45 50 41 33 53 52 57 53 53 52 52 37 42 53 42 50 45 50 50 50 57 42 47 41 35 50 53 53 45 50 53 46 34 57 57 50 33 45 53 37 41 53 53 50 53 41 50 50 37 23 57 32 53 50 40 52 30 46 39 53 30 33 36 44 40 53 39 52 38 53 38 17 43 38 52 46 32 52 48 35 35 48 33 40 53 36 36 52 37 22 53 40 42 40 37 16 43 27 40 36 40 52 42 57 52 38 44 33 57 40 37 40 27 53 53 34 40 41 41 8 57 24 41 31 41 36 53 40 26 37 41 44 37 30 9 46 40 24 34 33 40 40 36 31 20 37 9 46 29 38 35 38 38 20 44 21 48 14 31 29 27 44 24 30 28 25 20 13 47 30 29 39 34 29 30 21 29 33 48 37 48 28 17 46 31 26 25 28 29 27 9 4 14 26 29 20 31 28 29 38 39 39 25 29 28 29 32 38 41 37 34 11 17 32 23 33 28 29 24 27 24 46 39 22 29 25 27 36 14 28 35 18 21 36 28 38 29 33 34 34 33 21 30 31 26 24 26 21 10 11 41 21 43 28 29 24 46 41 23 26 20 23 15 16 28 28 27 18 27 17 24 21 25 20 22 23 24 20 20 31 27 28 30 33 23 28 29 19 30 22 46 46 6 12 9 51 51 51 29 26 23 28 31 8 19 13 30 16 27 22 28 35 20 23 14 16 17 17 22 31 8 14 5 12 16 12 36 8 32 14 19 17 28 17 24 9 15 15 4 18 23 14 7 19 32 15 26 7 22 24 13 15 29 18 12 23 20 13 30 9 24 11 8 18 12 12 8 24 15 15 22 26 29 38 38 17 10 8 29 12 29 17 29 29 18 18 11 6 20 13 33 31 29 18 17 15 23 28 30 24 22 19 14 13 12 10 13 20 30 23 18 17 5 12 31 17 13 5 10 7 5 3 7 11 10 9 12 24 36 30 30 6 11 14 14 9 19 24 8 10 11 24 4 3 4 2 5 4 2 4 22 15 15 25 23 20 13 6 7 19 7 21 14 19 12 4 2 3 6 3 7 13 20 7 18 7 10 5 3 5 4 6 4 2 3 2 7 9 19 21 6 8 1 2 3 1 4 8 1 4 7 5 11 3 4 3 4 19 5 4 4 4 5 3 3 4 6 1 3 8 3 3 9 11 5 3 3 3 1 1 5 5 1 13 20 4 4 13 4 19 12 9 4 14 7 4 14 13 5 8 4 5 17 5 4 12 1 1 3 6 19 19 16 15 16 4 5 5 8 8 19 3 10 1 20 19 13 5 10 5 6 4 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_50121208_50122355
seq2: B6Ng01-102G02.b_44_1174

seq1  GAATTCAAAGAGCAAACTTTGAAAAACACATACTTCCTCTCATAAAACTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAGAGCAAACTTTGAAAAACACATACTTCCTCTCATAAAACTG  50

seq1  CATGCAAATTATTCTATTAGCTTTAAAGAAAACCTTATGATTTTATAGTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCAAATTATTCTATTAGCTTTAAAGAAAACCTTATGATTTTATAGTG  100

seq1  CTTCTTCAGATACCAATCAAAAATAACTGGCAACCACCAGAAATACTAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTCAGATACCAATCAAAAATAACTGGCAACCACCAGAAATACTAAA  150

seq1  ATGCTTTTTTAAAGAGAAGTTATGTACATACAAACTTCTTTCAAAAACAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTTTTTTAAAGAGAAGTTATGTACATACAAACTTCTTTCAAAAACAA  200

seq1  GAAATAAACTTGAGAAAACTAAAAATTGTTAGCACACAGGTGAGGCCTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATAAACTTGAGAAAACTAAAAATTGTTAGCACACAGGTGAGGCCTCC  250

seq1  CTGGTCTACACAGCAAACTCCATGCAGCAAGGGATACCCACCCAATGATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTCTACACAGCAAACTCCATGCAGCAAGGGATACCCACCCAATGATA  300

seq1  TCCTGTGTAAAAATACAAAACAAAACAATAAAAAACCTAAAAATTCCACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTGTAAAAATACAAAACAAAACAATAAAAAACCTAAAAATTCCACA  350

seq1  GTTAAGAAAGCAGCAATGAAATACAGCTAAGGCTTCTACAGTCCCCTGTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAGAAAGCAGCAATGAAATACAGCTAAGGCTTCTACAGTCCCCTGTT  400

seq1  AAAGTTAAAAGGCCATTAGTGCCAAGTCTCCATGGTTCACCAGCAGCAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTAAAAGGCCATTAGTGCCAAGTCTCCATGGTTCACCAGCAGCAGC  450

seq1  ATTTCTTTTCATAGGTCTTGCAAACTTTTCTCTCTTTAAATGATGGGGAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTTTTCATAGGTCTTGCAAACTTTTCTCTCTTTAAATGATGGGGAC  500

seq1  TAAACCCAGGGCCCTGTGAATGGCAGCCATGTACTCTACCACTGAACTGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCCAGGGCCCTGTGAATGGCAGCCATGTACTCTACCACTGAACTGC  550

seq1  ATACCCCCCAAGCTCAAGATCATAAAGCACATGTTACACAAAGAGAGAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCCCCCAAGCTCAAGATCATAAAGCACATGTTACACAAAGAGAGAGC  600

seq1  CTACCAGGCTGAGCTCTGCCGTCTTGGAAAGCAGCTTCACATAGGCACCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCAGGCTGAGCTCTGCCGTCTTGGAAAGCAGCTTCACATAGGCACCA  650

seq1  CCACATTCTATTCCATTCTGAAAATTAACCTCATACCTAGTTTCAGAGAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACATTCTATTCCATTCTGAAAATTAACCTCATACCTAGTTTCAGAGAG  700

seq1  AAAAGAAAAAGTCCTATGGCATTTTGAAAGATCATATTTCCTATATTTCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAAAAGTCCTATGGCATTTTGAAAGATCATATTTCCTATATTTCC  750

seq1  TAATTGATTTCTCCCAGCTTGGTCATGTTTTATCAGATGTCATACCCACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTGATTTCTCCCAGCTTGGTCATGTTTTATCAGATGTCATACCCACA  800

seq1  CAAAAGGTTCCATTGTCTACTGCTTTTATGTGGCCACTCGGCCACACAAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGGTTCCATTGTCTACTGCTTTTATGTGGCCACTCGGCCACACAAA  850

seq1  AATCAAAAAAACAAAATAAAAGTAATCCTTAATGCAAAAGCCAGACATTT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAAAAAAACAAAATAAAAGTAATCCTTAATGCAAAAGCCAGACATTT  900

seq1  GTTTGCTTCTAAGAAGGTAAACAACCAGACTGTTTTACAAGAAGATAAAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGCTTCTAAGAAGGTAAACAACCAGACTGTTTTACAAGAAGATAAAA  950

seq1  ACAAAACCACTCAACATATTCCAATTCACACAAAATTCCTACTATAAACA  1000
         |||||||||||||||||||||||||||||||  ||||||||||||||
seq2  --CAAACCACTCAACATATTCCAATTCACACAAA--TCCTACTATAAACA  996

seq1  TGATTTTTTAGAATGTTCAACTTTCATACTGTCACCTGAGATTACCCTTT  1050
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGA-TTTTTAGAATGTTCAACTTTCATACTGTCACCTGAGATTACCCTTT  1045

seq1  CTAGAAAATTATCAAGATGGCACTGAACTTACTGAACAATGAGAGGCTTG  1100
      |||||||| |||| |||||   |||||| ||||||   ||||||||| ||
seq2  CTAGAAAA-TATC-AGATGCACCTGAAC-TACTGA--CATGAGAGGC-TG  1089

seq1  GTATCAAACAGGAAGGGCTTATTCAGTTTAGCAGAGATGGCATGATGC  1148
      |||||||      || || |||||||||  | ||| ||||||||||||
seq2  GTATCAA-----CAGAGC-TATTCAGTTAGGAAGAAATGGCATGATGC  1131

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information