MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-175B04
Chromosome	11 (Build37)
Map Location	100,237,564 - 100,443,765
singlet/doublet	doublet
Overlap gene	Jup, 1110036O03Rik, Fkbp10, Nt5c3l, Klhl10, Klhl11, Acly, Ttc25, Cnp1
Upstream gene	Krt10, A830036E02Rik, Krt20, Krt23, Krt39, Krt40, Krtap3-3, Krtap3-2, Krtap3-1, 2310043L02Rik, OTTMUSG00000004966, LOC435273, 2310040M23Rik, LOC100041412, LOC100041488, Krtap2-4, LOC100041477, A030010K20Rik, 1110033F04Rik, Krtap4-7, LOC546511, LOC100040248, 1110054P19Rik, LOC665922, LOC100040276, LOC665992, LOC665998, LOC670464, LOC670472, LOC670482, 2300006N05Rik, LOC670496, LOC629924, OTTMUSG00000002196, OTTMUSG00000002191, Krtap9-1, LOC670533, 4733401H21Rik, LOC670550, LOC630936, OTTMUSG00000002177, LOC435286, A030006P16Rik, Krt33a, Krt33b, Krt34, Krt31, Krt32, Krt35, Krt36, Krt13, Krt15, Krt19, Krt9, Krt14, Ka11p, LOC666128, Krt16, Krt17, Krt42, LOC100041796, LOC100040491, Eif1, Gast, Hap1, LOC100041835
Downstream gene	Dnajc7, Nkiras2, A930006D11Rik, D11Lgp2e, Gcn5l2, Hspb9, Rab5c, LOC380728, Hcrt, Ghdc, Stat5b, Stat5a, Stat3, Ptrf, Atp6v0a1, Naglu, Hsd17b1, Coasy, Mlx, Psmc3ip, 1300010M03Rik, Tubg1, Tubg2, Plekhh3, Ccr10, Cntnap1, Ezh1, Ramp2, Vps25, Wnk4, Ccdc56, Cntd1, Becn1, Psme3, Aoc2, Aoc3, LOC629949, G6pc, Aarsd1, 1700113I22Rik, Rundc1, Rpl27, Ifi35, Vat1, Rnd2, Brca1, Nbr1, Tmem106a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Krt10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16661 MGI:96685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830036E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268482 MGI:3686876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66809 MGI:1914059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94179 MGI:2148866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237934 MGI:3588208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406221 MGI:3629968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap3-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66380 MGI:1913630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap3-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66708 MGI:1913958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap3-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69473 MGI:1916723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 6 Proteins

name	2310043L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69664 MGI:1916914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000004966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629873 MGI:3651229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins

name	2310040M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75586 MGI:1922836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC100041488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	Krtap2-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71453 MGI:1918703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins

name	LOC100041477 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	A030010K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665891 MGI:3622079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110033F04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68673 MGI:1915923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap4-7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76444 MGI:1923694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100040248 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	1110054P19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68768 MGI:1916018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 16 Proteins

name	LOC665922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 109 ESTs, 21 Proteins pseudo : _no_value

name	LOC100040276 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC665992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC665998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC670464 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC670472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 7 Proteins

name	LOC670482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 9 Proteins

name	2300006N05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69464 MGI:1916714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC629924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	OTTMUSG00000002196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435285 MGI:3651030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000002191 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432600 MGI:3652067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Krtap9-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16705 MGI:1309997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4733401H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70831 MGI:1918081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC630936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 168 ESTs, 21 Proteins pseudo : _no_value

name	OTTMUSG00000002177 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432602 MGI:3650789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	A030006P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77914 MGI:1925164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	Krt33a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71888 MGI:1919138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt33b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16671 MGI:1309991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 55 Proteins

name	Krt34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16672 MGI:1309994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16660 MGI:1309993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16670 MGI:1309995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53617 MGI:1858899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16673 MGI:109364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16663 MGI:101925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16665 MGI:96689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16669 MGI:96693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107656 MGI:96696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16664 MGI:96688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ka11p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:574416
definition	note : type I keratin KA11P pseudo : _no_value

name	LOC666128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Krt16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16666 MGI:96690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16667 MGI:96691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68239 MGI:1915489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041796 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100040491 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Eif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20918 MGI:105125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gast (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14459 MGI:104768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15114 MGI:1261831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 263 ESTs, 13 Proteins

name	Jup (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16480 MGI:96650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110036O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66180 MGI:1913430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14230 MGI:104769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5c3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68106 MGI:1915356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66720 MGI:2181067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217194 MGI:2388648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acly (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104112 MGI:103251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74407 MGI:1921657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12799 MGI:88437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56354 MGI:1928373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkiras2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71966 MGI:1919216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930006D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278304 MGI:3608347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Lgp2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80861 MGI:1931560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcn5l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14534 MGI:1343101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hspb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75482 MGI:1922732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	Rab5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19345 MGI:105306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC380728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcrt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15171 MGI:1202306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ghdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80860 MGI:1931556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20851 MGI:103035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20850 MGI:103036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ptrf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19285 MGI:1277968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11975 MGI:103286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Naglu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27419 MGI:1351641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd17b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15485 MGI:105077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coasy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71743 MGI:1918993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21428 MGI:108398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmc3ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19183 MGI:1098610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300010M03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67998 MGI:1915248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tubg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103733 MGI:101834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103768 MGI:2144208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217198 MGI:2384950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12777 MGI:1096320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntnap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53321 MGI:1858201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ezh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14055 MGI:1097695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ramp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54409 MGI:1859650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28084 MGI:106354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69847 MGI:1917097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52469 MGI:1098757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68107 MGI:1923965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Becn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56208 MGI:1891828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psme3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19192 MGI:1096366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aoc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237940 MGI:2668431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aoc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11754 MGI:1306797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	G6pc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14377 MGI:95607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aarsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69684 MGI:1916934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700113I22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73635 MGI:1920885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rundc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217201 MGI:2144506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19942 MGI:98036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifi35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70110 MGI:1917360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26949 MGI:1349450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11858 MGI:1338755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12189 MGI:104537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17966 MGI:108498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem106a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217203 MGI:1922056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983635 GeneID:16661 MGI:96685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 10 transcript_id : NM_010660.2

name	A830036E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130980 GeneID:268482 MGI:3686876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830036E02 gene transcript_id : NM_010661.2

name	Krt20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21592284 GeneID:66809 MGI:1914059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 20 transcript_id : NM_023256.1

name	Krt23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15431280 GeneID:94179 MGI:2148866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 23 transcript_id : NM_033373.1

name	Krt39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523982 GeneID:237934 MGI:3588208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 39 transcript_id : NM_213730.1

name	Krt40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179317 GeneID:406221 MGI:3629968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 40 transcript_id : NM_001039666.1

name	Krtap3-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367458 GeneID:66380 MGI:1913630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 3-3 transcript_id : NM_025524.2

name	Krtap3-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801669 GeneID:66708 MGI:1913958
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 3-2 transcript_id : NM_025720.2

name	Krtap3-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390787 GeneID:69473 MGI:1916723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 6 Proteins product : keratin associated protein 3-1 transcript_id : XM_894811.2

name	2310043L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801820 GeneID:69664 MGI:1916914
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310043L02 gene transcript_id : NM_027157.2

name	OTTMUSG00000004966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363747 GeneID:629873 MGI:3651229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000004966 transcript_id : NM_001039502.2

name	LOC435273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262469 GeneID:435273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : novel protein similar to keratin associated protein 1 family KRTAP1 member (Homo sapiens), transcript variant 2 transcript_id : XM_001477708.1

name	LOC435273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262467 GeneID:435273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : novel protein similar to keratin associated protein 1 family KRTAP1 member (Homo sapiens), transcript variant 1 transcript_id : XM_001477694.1

name	2310040M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378018 GeneID:75586 MGI:1922836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310040M23 gene transcript_id : NM_029351.2

name	LOC100041412 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262471 GeneID:100041412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Krtap2-4 protein transcript_id : XM_001477731.1

name	LOC100041488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262480 GeneID:100041488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Krtap2-4 protein transcript_id : XM_001477787.1

name	Krtap2-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262475 GeneID:71453 MGI:1918703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins product : keratin associated protein 2-4 transcript_id : XM_001477761.1

name	LOC100041477 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262478 GeneID:100041477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Krtap2-4 protein transcript_id : XM_001477779.1

name	A030010K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796651 GeneID:665891 MGI:3622079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030010K20 gene transcript_id : NM_001048196.1

name	1110033F04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687894 GeneID:68673 MGI:1915923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110033F04 gene transcript_id : NM_026807.2

name	Krtap4-7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539646 GeneID:76444 MGI:1923694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 4-7 transcript_id : NM_029613.1

name	LOC546511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262482 GeneID:546511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to novel member of the keratin associated protein 4 (Krtap4) family transcript_id : XM_001477815.1

name	LOC100040248 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262417 GeneID:100040248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to Keratin associated protein 4-7 transcript_id : XM_001474347.1

name	1110054P19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390798 GeneID:68768 MGI:1916018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 16 Proteins product : RIKEN cDNA 1110054P19 gene transcript_id : XM_980319.1

name	LOC100040276 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262421 GeneID:100040276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001474404.1

name	LOC665992 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390802 GeneID:665992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : novel member of the keratin associated protein 4 (Krtap4) family transcript_id : XM_980769.1

name	LOC665998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390804 GeneID:665998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : novel member of the keratin associated protein 4 (Krtap4) family transcript_id : XM_980798.1

name	LOC670464 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262485 GeneID:670464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001477853.1

name	LOC670472 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262489 GeneID:670472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 7 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001477869.1

name	LOC670482 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262491 GeneID:670482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 9 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001477882.1

name	2300006N05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802685 GeneID:69464 MGI:1916714
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2300006N05 gene transcript_id : NM_027087.2

name	LOC670496 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262423 GeneID:670496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001474444.1

name	LOC629924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390814 GeneID:629924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to SMT3B protein transcript_id : XM_894864.2

name	OTTMUSG00000002196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000679 GeneID:435285 MGI:3651030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000002196 transcript_id : NM_001013823.1

name	OTTMUSG00000002191 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262428 GeneID:432600 MGI:3652067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : predicted gene, OTTMUSG00000002191 transcript_id : XM_001474519.1

name	Krtap9-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657286 GeneID:16705 MGI:1309997
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 9-1 transcript_id : NM_015741.1

name	LOC670533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262430 GeneID:670533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to ultra-high sulphur keratin transcript_id : XM_001474555.1

name	4733401H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803049 GeneID:70831 MGI:1918081
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4733401H21 gene transcript_id : NM_027568.2

name	OTTMUSG00000002177 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803535 GeneID:432602 MGI:3650789
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000002177 transcript_id : NM_001025244.2

name	LOC435286 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390819 GeneID:435286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : putative novel member of the keratin associated protein (Krtap) family transcript_id : XM_487191.3

name	A030006P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262502 GeneID:77914 MGI:1925164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA A030006P16 gene transcript_id : XM_001477954.1

name	Krt33a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803035 GeneID:71888 MGI:1919138
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 33A transcript_id : NM_027983.2

name	Krt33b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262434 GeneID:16671 MGI:1309991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 55 Proteins product : keratin 33B transcript_id : XM_981536.2

name	Krt34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803093 GeneID:16672 MGI:1309994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 34 transcript_id : NM_027563.2

name	Krt31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754483 GeneID:16660 MGI:1309993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 31 transcript_id : NM_010659.1

name	Krt32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378049 GeneID:16670 MGI:1309995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 32 transcript_id : NM_010665.2

name	Krt35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393683 GeneID:53617 MGI:1858899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 35 transcript_id : NM_016880.1

name	Krt36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803029 GeneID:16673 MGI:109364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 36 transcript_id : NM_008472.2

name	Krt13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754479 GeneID:16663 MGI:101925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 13 transcript_id : NM_010662.1

name	Krt15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680601 GeneID:16665 MGI:96689
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 15 transcript_id : NM_008469.1

name	Krt19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741635 GeneID:16669 MGI:96693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 19 transcript_id : NM_008471.2

name	Krt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054847 GeneID:107656 MGI:96696
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 9 transcript_id : NM_201255.1

name	Krt14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21489934 GeneID:16664 MGI:96688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 14 transcript_id : NM_016958.1

name	Krt16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680603 GeneID:16666 MGI:96690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 16 transcript_id : NM_008470.1

name	Krt17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801821 GeneID:16667 MGI:96691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 17 transcript_id : NM_010663.2

name	Krt42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47679094 GeneID:68239 MGI:1915489
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 42 transcript_id : NM_212483.1

name	LOC100041796 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262506 GeneID:100041796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041796, transcript variant 1 transcript_id : XM_001478054.1

name	LOC100041796 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262508 GeneID:100041796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041796, transcript variant 2 transcript_id : XM_001478069.1

name	LOC100040491 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262436 GeneID:100040491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040491 transcript_id : XM_001474794.1

name	Eif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165346 GeneID:20918 MGI:105125
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 1 transcript_id : NM_011508.1

name	Gast (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981774 GeneID:14459 MGI:104768
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrin transcript_id : NM_010257.2

name	Hap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061485 GeneID:15114 MGI:1261831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : huntingtin-associated protein 1 transcript_id : NM_010404.2

name	LOC100041835 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262510 GeneID:100041835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 263 ESTs, 13 Proteins product : similar to H+ ATP synthase transcript_id : XM_001478119.1

name	Jup (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28395017 GeneID:16480 MGI:96650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junction plakoglobin transcript_id : NM_010593.1

name	1110036O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560877 GeneID:66180 MGI:1913430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110036O03 gene transcript_id : NM_176830.2

name	Fkbp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6806906 GeneID:14230 MGI:104769
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 10 transcript_id : NM_010221.1

name	Nt5c3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368950 GeneID:68106 MGI:1915356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase, cytosolic III-like transcript_id : NM_026561.3

name	Klhl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802863 GeneID:66720 MGI:2181067
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 10 (Drosophila) transcript_id : NM_025727.2

name	Klhl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803034 GeneID:217194 MGI:2388648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 11 (Drosophila) transcript_id : NM_172565.2

name	Acly (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254106 GeneID:104112 MGI:103251
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP citrate lyase transcript_id : NM_134037.2

name	Ttc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358956 GeneID:74407 MGI:1921657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 25 transcript_id : NM_028918.2

name	Cnp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753475 GeneID:12799 MGI:88437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide phosphodiesterase 1 transcript_id : NM_009923.1

name	Dnajc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130620 GeneID:56354 MGI:1928373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 7 transcript_id : NM_019795.4

name	Nkiras2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130408 GeneID:71966 MGI:1919216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFKB inhibitor interacting Ras-like protein 2 transcript_id : NM_028024.2

name	A930006D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374044 GeneID:278304 MGI:3608347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930006D11Rik gene transcript_id : NM_177790.3

name	D11Lgp2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608132 GeneID:80861 MGI:1931560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Lothar Hennighausen 2, expressed transcript_id : NM_030150.2

name	Gcn5l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83999996 GeneID:14534 MGI:1343101
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GCN5 general control of amino acid synthesis-like 2 (yeast) transcript_id : NM_001038010.1

name	Gcn5l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803465 GeneID:14534 MGI:1343101
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GCN5 general control of amino acid synthesis-like 2 (yeast) transcript_id : NM_020004.3

name	Hspb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262512 GeneID:75482 MGI:1922732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : heat shock protein, alpha-crystallin-related, B9 transcript_id : XM_894891.3

name	Rab5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377910 GeneID:19345 MGI:105306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5C, member RAS oncogene family transcript_id : NM_024456.3

name	LOC380728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124487120 GeneID:380728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 4 transcript_id : NM_001081194.1

name	Hcrt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802328 GeneID:15171 MGI:1202306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypocretin transcript_id : NM_010410.2

name	Ghdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994198 GeneID:80860 MGI:1931556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GH3 domain containing transcript_id : NM_031871.1

name	Stat5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543779 GeneID:20851 MGI:103035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 5B transcript_id : NM_011489.2

name	Stat5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981473 GeneID:20850 MGI:103036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 5A transcript_id : NM_011488.2

name	Stat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253928 GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 3 transcript_id : NM_213660.2

name	Stat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253924 GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 3 transcript_id : NM_011486.4

name	Stat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253927 GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 3 transcript_id : NM_213659.2

name	Ptrf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043973 GeneID:19285 MGI:1277968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase I and transcript release factor transcript_id : NM_008986.2

name	Atp6v0a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539453 GeneID:11975 MGI:103286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit A1 transcript_id : NM_016920.2

name	Naglu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305298 GeneID:27419 MGI:1351641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB) transcript_id : NM_013792.1

name	Hsd17b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754247 GeneID:15485 MGI:105077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 1 transcript_id : NM_010475.1

name	Coasy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386908 GeneID:71743 MGI:1918993
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Coenzyme A synthase transcript_id : NM_027896.3

name	Mlx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560536 GeneID:21428 MGI:108398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX-like protein X transcript_id : NM_011550.2

name	Psmc3ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982094 GeneID:19183 MGI:1098610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein transcript_id : NM_008949.2

name	1300010M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357475 GeneID:67998 MGI:1915248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300010M03 gene transcript_id : NM_028933.2

name	1300010M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802672 GeneID:67998 MGI:1915248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300010M03 gene transcript_id : NM_026501.2

name	Tubg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129919 GeneID:103733 MGI:101834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, gamma 1 transcript_id : NM_134024.2

name	Tubg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527245 GeneID:103768 MGI:2144208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, gamma 2 transcript_id : NM_134028.1

name	Plekhh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130249 GeneID:217198 MGI:2384950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family H (with MyTH4 domain) member 3 transcript_id : NM_146030.2

name	Ccr10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865996 GeneID:12777 MGI:1096320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 10 transcript_id : NM_007721.4

name	Cntnap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063559 GeneID:53321 MGI:1858201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : contactin associated protein-like 1 transcript_id : NM_016782.2

name	Ezh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679718 GeneID:14055 MGI:1097695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enhancer of zeste homolog 1 (Drosophila) transcript_id : NM_007970.1

name	Ramp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71361672 GeneID:54409 MGI:1859650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor (calcitonin) activity modifying protein 2 transcript_id : NM_019444.2

name	Vps25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981981 GeneID:28084 MGI:106354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 25 (yeast) transcript_id : NM_026776.3

name	Wnk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793432 GeneID:69847 MGI:1917097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WNK lysine deficient protein kinase 4 transcript_id : NM_175638.2

name	Ccdc56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387850 GeneID:52469 MGI:1098757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 56 transcript_id : NM_026618.2

name	Cntd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367867 GeneID:68107 MGI:1923965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin N-terminal domain containing 1 transcript_id : NM_026562.2

name	Becn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352751 GeneID:56208 MGI:1891828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) transcript_id : NM_019584.3

name	Psme3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130228 GeneID:19192 MGI:1096366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteaseome (prosome, macropain) 28 subunit, 3 transcript_id : NM_011192.3

name	Aoc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34098971 GeneID:237940 MGI:2668431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amine oxidase, copper containing 2 (retina-specific) transcript_id : NM_178932.1

name	Aoc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753065 GeneID:11754 MGI:1306797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amine oxidase, copper containing 3 transcript_id : NM_009675.1

name	LOC629949 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262523 GeneID:629949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to ribosomal protein L37a transcript_id : XM_894901.2

name	G6pc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131011 GeneID:14377 MGI:95607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose-6-phosphatase, catalytic transcript_id : NM_008061.3

name	Aarsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450212 GeneID:69684 MGI:1916934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanyl-tRNA synthetase domain containing 1 transcript_id : NM_144829.1

name	1700113I22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130264 GeneID:73635 MGI:1920885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700113I22 gene transcript_id : NM_026865.2

name	Rundc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364318 GeneID:217201 MGI:2144506
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN domain containing 1 transcript_id : NM_172566.2

name	Rpl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343887 GeneID:19942 MGI:98036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L27 transcript_id : NM_011289.2

name	Ifi35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802826 GeneID:70110 MGI:1917360
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon-induced protein 35 transcript_id : NM_027320.3

name	Vat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364129 GeneID:26949 MGI:1349450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle amine transport protein 1 homolog (T californica) transcript_id : NM_012037.2

name	Rnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753115 GeneID:11858 MGI:1338755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho family GTPase 2 transcript_id : NM_009708.1

name	Brca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560811 GeneID:12189 MGI:104537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : breast cancer 1 transcript_id : NM_009764.2

name	Nbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130692 GeneID:17966 MGI:108498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neighbor of Brca1 gene 1 transcript_id : NM_008676.2

name	Tmem106a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803040 GeneID:217203 MGI:1922056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 106A transcript_id : NM_144830.3

name	Krt10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983636 CCDS:CCDS25380.1 GeneID:16661 MGI:96685
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : suprabasal cytokeratin 10; epidermal keratin 10; intermediate filament protein product : keratin complex 1, acidic, gene 10 protein_id : NP_034790.2

name	A830036E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130981 GeneID:268482 MGI:3686876
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin 12 product : keratin complex 1, acidic, gene 12 protein_id : NP_034791.2

name	Krt20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21592285 CCDS:CCDS25381.1 GeneID:66809 MGI:1914059
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : cytokeratin 20 product : keratin 20 protein_id : NP_075745.1

name	Krt23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15431281 CCDS:CCDS25382.1 GeneID:94179 MGI:2148866
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : type I intermediate filament cytokeratin product : keratin complex 1, acidic, gene 23 protein_id : NP_203537.1

name	Krt39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523983 CCDS:CCDS25383.1 GeneID:237934 MGI:3588208
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 exception : mismatches in translation product : type I hair keratin KA35 protein_id : NP_998895.1

name	Krt40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179318 GeneID:406221 MGI:3629968
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : ortholog of type I hair keratin KA36 product : type I hair keratin KA36 protein_id : NP_001034755.1

name	Krtap3-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536226 CCDS:CCDS25385.1 GeneID:66380 MGI:1913630
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : keratin associated protein 3-2 product : keratin associated protein 3-3 protein_id : NP_079800.1

name	Krtap3-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094993 CCDS:CCDS25386.1 GeneID:66708 MGI:1913958
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin associated protein 3-2 protein_id : NP_079996.1

name	Krtap3-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935164 GeneID:69473 MGI:1916723
definition	codon_start : 1 product : keratin associated protein 3-1 protein_id : XP_899904.1

name	2310043L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386206 CCDS:CCDS25388.1 GeneID:69664 MGI:1916914
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69664 protein_id : NP_081433.1

name	OTTMUSG00000004966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87196521 GeneID:629873 MGI:3651229
definition	codon_start : 1 note : novel protein similar to keratin associated protein 1 family KRTAP1 member product : hypothetical protein LOC629873 protein_id : NP_001034591.1

name	LOC435273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262470 GeneID:435273
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477758.1

name	LOC435273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262468 GeneID:435273
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477744.1

name	2310040M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378019 GeneID:75586 MGI:1922836
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : novel protein similar to keratin associated protein 1 family KRTAP1 member product : hypothetical protein LOC75586 protein_id : NP_083627.2

name	LOC100041412 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262472 GeneID:100041412
definition	codon_start : 1 product : similar to Krtap2-4 protein protein_id : XP_001477781.1

name	LOC100041488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262481 GeneID:100041488
definition	codon_start : 1 product : similar to Krtap2-4 protein protein_id : XP_001477837.1

name	Krtap2-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262476 GeneID:71453 MGI:1918703
definition	codon_start : 1 product : keratin associated protein 2-4 protein_id : XP_001477811.1

name	LOC100041477 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262479 GeneID:100041477
definition	codon_start : 1 product : similar to Krtap2-4 protein protein_id : XP_001477829.1

name	A030010K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114796652 GeneID:665891 MGI:3622079
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : novel member of the keratin associated protein 4 (Krtap4) family product : hypothetical protein LOC665891 protein_id : NP_001041661.1

name	1110033F04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114687895 CCDS:CCDS25392.1 GeneID:68673 MGI:1915923
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : novel member of the keratin associated protein 4 (Krtap4) family product : hypothetical protein LOC68673 protein_id : NP_081083.2

name	Krtap4-7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539647 CCDS:CCDS25393.1 GeneID:76444 MGI:1923694
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 product : keratin associated protein 4-7 protein_id : NP_083889.1

name	LOC546511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262483 GeneID:546511
definition	codon_start : 1 product : similar to novel member of the keratin associated protein 4 (Krtap4) family protein_id : XP_001477865.1

name	LOC100040248 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262418 GeneID:100040248
definition	codon_start : 1 product : similar to Keratin associated protein 4-7 protein_id : XP_001474397.1

name	1110054P19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390799 GeneID:68768 MGI:1916018
definition	codon_start : 1 product : hypothetical protein LOC68768 protein_id : XP_985413.1

name	LOC100040276 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262422 GeneID:100040276
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474454.1

name	LOC665992 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390803 GeneID:665992
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985863.1

name	LOC665998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390805 GeneID:665998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985892.1

name	LOC670464 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262486 GeneID:670464
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477903.1

name	LOC670472 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262490 GeneID:670472
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477919.1

name	LOC670482 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262492 GeneID:670482
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477932.1

name	2300006N05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386198 GeneID:69464 MGI:1916714
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 note : novel member of the keratin associated protein 4 (Krtap4) family product : hypothetical protein LOC69464 protein_id : NP_081363.1

name	LOC670496 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262424 GeneID:670496
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474494.1

name	LOC629924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390815 GeneID:629924
definition	codon_start : 1 product : similar to SMT3B protein protein_id : XP_899957.2

name	OTTMUSG00000002196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000680 GeneID:435285 MGI:3651030
definition	codon_start : 1 product : keratin associated protein 4 family member protein_id : NP_001013845.1

name	OTTMUSG00000002191 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262429 GeneID:432600 MGI:3652067
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474569.1

name	Krtap9-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657287 CCDS:CCDS25399.1 GeneID:16705 MGI:1309997
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 9.1; keratin-associated protein 9-1 product : keratin associated protein 9-1 protein_id : NP_056556.1

name	LOC670533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262431 GeneID:670533
definition	codon_start : 1 product : similar to ultra-high sulphur keratin protein_id : XP_001474605.1

name	4733401H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312558 CCDS:CCDS25400.1 GeneID:70831 MGI:1918081
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 note : keratin-associated protein; novel member of the keratin associated protein (Krtap) family product : hypothetical protein LOC70831 protein_id : NP_081844.1

name	OTTMUSG00000002177 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68989245 GeneID:432602 MGI:3650789
definition	codon_start : 1 note : novel member of the keratin associated protein (Krtap) family product : hypothetical protein LOC432602 protein_id : NP_001020415.1

name	LOC435286 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390820 GeneID:435286
definition	codon_start : 1 product : similar to putative novel member of the keratin associated protein (Krtap) family protein_id : XP_487191.3

name	A030006P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262503 GeneID:77914 MGI:1925164
definition	codon_start : 1 product : similar to ortholog of human keratin associated protein 17-1 KRTAP17-1 protein_id : XP_001478004.1

name	Krt33a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386274 CCDS:CCDS25403.1 GeneID:71888 MGI:1919138
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2310015J09 protein_id : NP_082259.1

name	Krt33b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262435 GeneID:16671 MGI:1309991
definition	codon_start : 1 product : keratin complex 1, acidic, gene 3 protein_id : XP_986630.2

name	Krt34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386238 CCDS:CCDS25404.1 GeneID:16672 MGI:1309994
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : keratin complex 1, acidic, gene 4 protein_id : NP_081839.1

name	Krt31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754484 CCDS:CCDS25405.1 GeneID:16660 MGI:1309993
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : keratin complex 1, gene 1 product : keratin complex 1, acidic, gene 1 protein_id : NP_034789.1

name	Krt32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754486 CCDS:CCDS25406.1 GeneID:16670 MGI:1309995
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : keratin complex 1, gene 2 product : keratin complex 1, acidic, gene 2 protein_id : NP_034795.1

name	Krt35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393684 CCDS:CCDS25407.1 GeneID:53617 MGI:1858899
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : hair keratin acidic 5; keratin complex 1, gene 24; keratin complex 1, acidic, gene 24 product : keratin, hair, acidic, 5 protein_id : NP_058576.1

name	Krt36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625599 CCDS:CCDS25408.1 GeneID:16673 MGI:109364
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin complex 1, gene 5; keratin 5 product : keratin complex 1, acidic, gene 5 protein_id : NP_032498.1

name	Krt13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754480 CCDS:CCDS25409.1 GeneID:16663 MGI:101925
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : cytokeratin 13; keratin, type I cytoskeletal 13; keratin complex 1, acidic, gene 13 product : keratin 13 protein_id : NP_034792.1

name	Krt15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680602 CCDS:CCDS25410.1 GeneID:16665 MGI:96689
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin complex 1, acidic, gene 15 protein_id : NP_032495.1

name	Krt19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680606 CCDS:CCDS25411.1 GeneID:16669 MGI:96693
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : cytokeratin 19; cytokeratin-19 product : keratin complex 1, acidic, gene 19 protein_id : NP_032497.1

name	Krt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054848 CCDS:CCDS25412.1 GeneID:107656 MGI:96696
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin complex 1, acidic, gene 9 protein_id : NP_957707.1

name	Krt14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489935 CCDS:CCDS25413.1 GeneID:16664 MGI:96688
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : epidermolysis bullosa simplex, Dowling-Meara, Koebner; Cytokeratin 14 product : keratin complex 1, acidic, gene 14 protein_id : NP_058654.1

name	Krt16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680604 CCDS:CCDS25414.1 GeneID:16666 MGI:96690
definition	GO_component : GO:0005882 - intermediate filament [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045104 - intermediate filament cytoskeleton organization and biogenesis [Evidence IDA] codon_start : 1 note : keratin intermediate filament 16a; keratin intermediate filament 16b product : keratin complex 1, acidic, gene 16 protein_id : NP_032496.1

name	Krt17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106335 CCDS:CCDS25415.1 GeneID:16667 MGI:96691
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045109 - intermediate filament organization [Evidence IGI]; GO:0031424 - keratinization [Evidence IGI]; GO:0002009 - morphogenesis of an epithelium [Evidence IGI] codon_start : 1 product : keratin complex 1, acidic, gene 17 protein_id : NP_034793.1

name	Krt42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47679095 CCDS:CCDS25416.1 GeneID:68239 MGI:1915489
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : type I keratin KA22 product : keratin 17n protein_id : NP_997648.1

name	LOC100041796 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262507 GeneID:100041796
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001478104.1

name	LOC100041796 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262509 GeneID:100041796
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001478119.1

name	LOC100040491 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262437 GeneID:100040491
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474844.1

name	Eif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165347 CCDS:CCDS25417.1 GeneID:20918 MGI:105125
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : suppressor of initiator codon mutations-Yeast homolog related sequence 1 product : suppressor of initiator codon mutations, related sequence 1 protein_id : NP_035638.1

name	Gast (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981775 CCDS:CCDS25418.1 GeneID:14459 MGI:104768
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : gastrin protein_id : NP_034387.2

name	Hap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754158 CCDS:CCDS25419.1 GeneID:15114 MGI:1261831
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0047496 - vesicle transport along microtubule [Evidence IMP] codon_start : 1 product : huntingtin-associated protein 1 protein_id : NP_034534.1

name	LOC100041835 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262511 GeneID:100041835
definition	codon_start : 1 product : similar to H+ ATP synthase protein_id : XP_001478169.1

name	Jup (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28395018 CCDS:CCDS25420.1 GeneID:16480 MGI:96650
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA]; GO:0030057 - desmosome [Evidence IDA]; GO:0005911 - intercellular junction [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 note : plakoglobin; gamma-catenin product : junction plakoglobin protein_id : NP_034723.1

name	1110036O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543672 CCDS:CCDS25421.1 GeneID:66180 MGI:1913430
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : SC65 synaptonemal complex protein; SC65 synaptonemal complex protein (Sc65-pending) product : synaptonemal complex protein SC65 protein_id : NP_789800.1

name	Fkbp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6806907 CCDS:CCDS25422.1 GeneID:14230 MGI:104769
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : FK506 binding protein 6 (65 kDa); FK506 binding protein 10 (65 kDa) product : FK506 binding protein 10 protein_id : NP_034351.1

name	Nt5c3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980891 GeneID:68106 MGI:1915356
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : 5'-nucleotidase, cytosolic III-like protein_id : NP_080837.2

name	Klhl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385188 CCDS:CCDS25423.1 GeneID:66720 MGI:2181067
definition	codon_start : 1 product : kelch-like 10 protein_id : NP_080003.1

name	Klhl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369800 CCDS:CCDS25424.1 GeneID:217194 MGI:2388648
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 11 protein_id : NP_766153.1

name	Acly (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29293809 CCDS:CCDS25425.1 GeneID:104112 MGI:103251
definition	GO_component : GO:0005622 - intracellular [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003878 - ATP citrate synthase activity [Evidence TAS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006085 - acetyl-CoA biosynthesis [Evidence TAS]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : ATP citrate lyase protein_id : NP_598798.1

name	Ttc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358957 GeneID:74407 MGI:1921657
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 25 protein_id : NP_083194.2

name	Cnp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753476 CCDS:CCDS25427.1 GeneID:12799 MGI:88437
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004113 - 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0009214 - cyclic nucleotide catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 2',3'-cyclic-nucleotide 3'-phosphodiesterase product : cyclic nucleotide phosphodiesterase 1 protein_id : NP_034053.1

name	Dnajc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980994 CCDS:CCDS25428.1 GeneID:56354 MGI:1928373
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0031072 - heat shock protein binding [Evidence IEA] codon_start : 1 note : cytoplasmic CAR retention protein; tetratricopeptide repeat domain 2 product : DnaJ (Hsp40) homolog, subfamily C, member 7 protein_id : NP_062769.2

name	Nkiras2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312616 CCDS:CCDS25429.1 GeneID:71966 MGI:1919216
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : I-kappa-B-interacting Ras-like protein 2 product : NFKB inhibitor interacting Ras-like protein 2 protein_id : NP_082300.1

name	A930006D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244324 CCDS:CCDS25430.1 GeneID:278304 MGI:3608347
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC278304 protein_id : NP_808458.1

name	D11Lgp2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608133 CCDS:CCDS25431.1 GeneID:80861 MGI:1931560
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : DNA segment, Chr 11, Lothar Hennighausen 2, expressed protein_id : NP_084426.2

name	Gcn5l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83999997 CCDS:CCDS25432.1 GeneID:14534 MGI:1343101
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004402 - histone acetyltransferase activity [Evidence IDA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001756 - somitogenesis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; general control of amino acid synthesis, yeast homolog-like 2; PCAF-B/GCN5; general control of amino acid synthesis-like 2 product : general control of amino acid synthesis-like 2 isoform b protein_id : NP_001033099.1

name	Gcn5l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000003 CCDS:CCDS25433.1 GeneID:14534 MGI:1343101
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004402 - histone acetyltransferase activity [Evidence IDA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001756 - somitogenesis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; general control of amino acid synthesis, yeast homolog-like 2; PCAF-B/GCN5; general control of amino acid synthesis-like 2 product : general control of amino acid synthesis-like 2 isoform a protein_id : NP_064388.2

name	Hspb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262513 GeneID:75482 MGI:1922732
definition	codon_start : 1 product : heat shock protein, alpha-crystallin-related, B9 protein_id : XP_899984.2

name	Rab5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866024 GeneID:19345 MGI:105306
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5C, member RAS oncogene family protein_id : NP_077776.2

name	LOC380728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124487121 GeneID:380728
definition	codon_start : 1 product : similar to potassium voltage-gated channel, subfamily H, member 4 protein_id : NP_001074663.1

name	Hcrt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754170 CCDS:CCDS25436.1 GeneID:15171 MGI:1202306
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_process : GO:0007631 - feeding behavior [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : prepro-orexin product : hypocretin protein_id : NP_034540.1

name	Ghdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994199 CCDS:CCDS25437.1 GeneID:80860 MGI:1931556
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] codon_start : 1 product : D11lgp1 protein_id : NP_114077.1

name	Stat5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543780 CCDS:CCDS25438.1 GeneID:20851 MGI:103035
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0004871 - signal transducer activity [Evidence IGI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0046543 - development of secondary female sexual characteristics [Evidence IMP]; GO:0046544 - development of secondary male sexual characteristics [Evidence IGI] [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0007595 - lactation [Evidence IMP]; GO:0001553 - luteinization [Evidence IGI]; GO:0001779 - natural killer cell differentiation [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0045647 - negative regulation of erythrocyte differentiation [Evidence IGI]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence IGI]; GO:0045579 - positive regulation of B cell differentiation [Evidence IGI]; GO:0040018 - positive regulation of body size [Evidence IGI] [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0050729 - positive regulation of inflammatory response [Evidence IGI]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IGI]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence IGI]; GO:0045885 - positive regulation of survival gene product activity [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IGI]; GO:0007565 - pregnancy [Evidence IMP] [Evidence IGI]; GO:0042448 - progesterone metabolism [Evidence IGI]; GO:0030155 - regulation of cell adhesion [Evidence IMP]; GO:0030856 - regulation of epithelial cell differentiation [Evidence IMP]; GO:0019218 - regulation of steroid metabolism [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019915 - sequestering of lipid [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA]; GO:0043029 - T cell homeostasis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mammary gland factor STAT5B product : signal transducer and activator of transcription 5B protein_id : NP_035619.2

name	Stat5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755672 CCDS:CCDS25439.1 GeneID:20850 MGI:103036
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IGI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0046543 - development of secondary female sexual characteristics [Evidence IMP]; GO:0046544 - development of secondary male sexual characteristics [Evidence IGI] [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0007595 - lactation [Evidence IMP]; GO:0001553 - luteinization [Evidence IGI]; GO:0030879 - mammary gland development [Evidence IMP]; GO:0001779 - natural killer cell differentiation [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0045647 - negative regulation of erythrocyte differentiation [Evidence IGI]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence IDA] [Evidence IGI]; GO:0045579 - positive regulation of B cell differentiation [Evidence IGI]; GO:0040018 - positive regulation of body size [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] [Evidence IGI]; GO:0050729 - positive regulation of inflammatory response [Evidence IGI]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IGI]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence IGI]; GO:0045885 - positive regulation of survival gene product activity [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IGI]; GO:0007565 - pregnancy [Evidence IGI]; GO:0030155 - regulation of cell adhesion [Evidence IMP]; GO:0030856 - regulation of epithelial cell differentiation [Evidence IMP]; GO:0019218 - regulation of steroid metabolism [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019915 - sequestering of lipid [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA]; GO:0043029 - T cell homeostasis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mammary gland factor STAT5A product : signal transducer and activator of transcription 5A protein_id : NP_035618.1

name	Stat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47458807 GeneID:20848 MGI:103038
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0042755 - eating behavior [Evidence IMP]; GO:0001754 - eye photoreceptor cell differentiation [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence TAS] [Evidence IDA]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019953 - sexual reproduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; acute phase response factor product : signal transducer and activator of transcription 3 isoform 2 protein_id : NP_998825.1

name	Stat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47458804 CCDS:CCDS25440.1 GeneID:20848 MGI:103038
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0042755 - eating behavior [Evidence IMP]; GO:0001754 - eye photoreceptor cell differentiation [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence TAS] [Evidence IDA]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019953 - sexual reproduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; acute phase response factor product : signal transducer and activator of transcription 3 isoform 1 protein_id : NP_998824.1

name	Stat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094115 CCDS:CCDS25441.1 GeneID:20848 MGI:103038
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0042755 - eating behavior [Evidence IMP]; GO:0001754 - eye photoreceptor cell differentiation [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence TAS] [Evidence IDA]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019953 - sexual reproduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; acute phase response factor product : signal transducer and activator of transcription 3 isoform 3 protein_id : NP_035616.1

name	Ptrf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679567 CCDS:CCDS25442.1 GeneID:19285 MGI:1277968
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003716 - RNA polymerase I transcription termination factor activity [Evidence IDA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0042134 - rRNA primary transcript binding [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006361 - transcription initiation from RNA polymerase I promoter [Evidence IDA]; GO:0006353 - transcription termination [Evidence IEA] codon_start : 1 product : polymerase I and transcript release factor protein_id : NP_033012.1

name	Atp6v0a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025532 CCDS:CCDS25443.1 GeneID:11975 MGI:103286
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0030331 - estrogen receptor binding [Evidence ISS]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046965 - retinoid X receptor binding [Evidence ISS]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0007420 - brain development [Evidence ISS]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence ISS]; GO:0007507 - heart development [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0030099 - myeloid cell differentiation [Evidence ISS]; GO:0015992 - proton transport [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : V-ATPase a1; ATPase, H+ transporting, lysosomal (vacuolar proton pump) noncatalytic accessory protein 1 (110/160 kDa); ATPase, H+ transporting, lysosomal (vacuolar proton pump) noncatalytic accessory protein 1A (110/160 kDa); ATPase, H+ transporting, lysosomal V0 subunit a product : ATPase, H+ transporting, lysosomal V0 subunit a isoform 1 protein_id : NP_058616.1

name	Naglu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305299 CCDS:CCDS25444.1 GeneID:27419 MGI:1351641
definition	GO_function : GO:0004561 - alpha-N-acetylglucosaminidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] codon_start : 1 exception : mismatches in translation function : hydrolyse alpha-N-acetylglucosaminide from glycosaminoglycans note : alpha-N-acetylglucosaminidase, lysosomal; N-acetyl-glucosaminidase product : alpha-N-acetylglucosaminidase protein_id : NP_038820.1

name	Hsd17b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754248 CCDS:CCDS25445.1 GeneID:15485 MGI:105077
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004303 - estradiol 17-beta-dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006703 - estrogen biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : hydroxysteroid 17-beta dehydrogenase 1; 17-beta-hydroxysteroid dehydrogenase; estradiol 17-beta-dehydrogenase; 17-beta-hydroxysteroid dehydrogenase type 1 product : hydroxysteroid (17-beta) dehydrogenase 1 protein_id : NP_034605.1

name	Coasy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229125 CCDS:CCDS25446.1 GeneID:71743 MGI:1918993
definition	EC_number : 2.7.7.3 EC_number : 2.7.1.24 GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004140 - dephospho-CoA kinase activity [Evidence IDA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0004595 - pantetheine-phosphate adenylyltransferase activity [Evidence IMP] [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0015937 - coenzyme A biosynthesis [Evidence ISS] [Evidence IDA] codon_start : 1 note : 4'-phosphopantetheine adenylyltransferase and dephospho-CoA kinase; CoA synthase product : Coenzyme A synthase protein_id : NP_082172.2

name	Mlx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560537 CCDS:CCDS25447.1 GeneID:21428 MGI:108398
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MAX-like bHLHZIP protein; BigMax alpha; transcription factor like 4 product : transcription factor-like 4 protein_id : NP_035680.2

name	Psmc3ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092696 CCDS:CCDS25448.1 GeneID:19183 MGI:1098610
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein protein_id : NP_032975.1

name	1300010M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312666 CCDS:CCDS25449.1 GeneID:67998 MGI:1915248
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC67998 isoform 1 protein_id : NP_080777.1

name	1300010M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077025 CCDS:CCDS25450.1 GeneID:67998 MGI:1915248
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC67998 isoform 2 protein_id : NP_083209.1

name	Tubg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527242 CCDS:CCDS25451.1 GeneID:103733 MGI:101834
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0000930 - gamma-tubulin complex [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0000242 - pericentriolar material [Evidence IDA]; GO:0005827 - polar microtubule [Evidence ISS]; GO:0043234 - protein complex [Evidence IEA]; GO:0005876 - spindle microtubule [Evidence IDA]; GO:0005816 - spindle pole body [Evidence ISS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] [Evidence ISS] [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000212 - meiotic spindle organization and biogenesis [Evidence IEP]; GO:0007020 - microtubule nucleation [Evidence TAS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0007052 - mitotic spindle organization and biogenesis [Evidence TAS]; GO:0051258 - protein polymerization [Evidence IEA]; GO:0007088 - regulation of mitosis [Evidence TAS] codon_start : 1 note : tubulin, gamma polypeptide product : tubulin, gamma 1 protein_id : NP_598785.1

name	Tubg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527246 CCDS:CCDS25452.1 GeneID:103768 MGI:2144208
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA]; GO:0000242 - pericentriolar material [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, gamma 2 protein_id : NP_598789.1

name	Plekhh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122503 CCDS:CCDS25453.1 GeneID:217198 MGI:2384950
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : pleckstrin homology domain containing, family H (with MyTH4 domain) member 3 protein_id : NP_666142.1

name	Ccr10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11024708 CCDS:CCDS25454.1 GeneID:12777 MGI:1096320
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0004950 - chemokine receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 2 product : chemokine (C-C motif) receptor 10 protein_id : NP_031747.2

name	Cntnap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063560 CCDS:CCDS25455.1 GeneID:53321 MGI:1858201
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : neurexin IV; paranodin; neurexin 4 (contactin associated protein) product : contactin associated protein 1 protein_id : NP_058062.2

name	Ezh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679719 GeneID:14055 MGI:1097695
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : enhancer of zeste homolog 1 protein_id : NP_031996.1

name	Ramp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507029 CCDS:CCDS25457.1 GeneID:54409 MGI:1859650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015027 - coreceptor, soluble ligand activity [Evidence IDA]; GO:0008565 - protein transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IPI]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : receptor activity modifying protein 2 protein_id : NP_062317.1

name	Vps25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092662 CCDS:CCDS25458.1 GeneID:28084 MGI:106354
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 25 protein_id : NP_081052.2

name	Wnk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316732 CCDS:CCDS25459.1 GeneID:69847 MGI:1917097
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005923 - tight junction [Evidence IEP] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030644 - chloride ion homeostasis [Evidence TAS]; GO:0006821 - chloride transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0008104 - protein localization [Evidence IDA]; GO:0050794 - regulation of cellular process [Evidence IDA] codon_start : 1 note : protein kinase, lysine deficient 4; WNK4 protein kinase product : WNK lysine deficient protein kinase 4 protein_id : NP_783569.1

name	Ccdc56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311867 CCDS:CCDS25460.1 GeneID:52469 MGI:1098757
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : coiled-coil domain containing 56 protein_id : NP_080894.1

name	Cntd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311935 CCDS:CCDS25461.1 GeneID:68107 MGI:1923965
definition	codon_start : 1 product : cyclin N-terminal domain containing 1 protein_id : NP_080838.1

name	Becn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27764875 CCDS:CCDS25462.1 GeneID:56208 MGI:1891828
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence ISS]; GO:0005802 - Golgi trans face [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006914 - autophagy [Evidence IDA] [Evidence IMP] [Evidence IEA]; GO:0051707 - response to other organism [Evidence IDA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : Bcl-2-interacting protein beclin product : beclin 1 protein_id : NP_062530.2

name	Psme3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755214 CCDS:CCDS25463.1 GeneID:19192 MGI:1096366
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : proteasome activator subunit 3 protein_id : NP_035322.1

name	Aoc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34098972 CCDS:CCDS25464.1 GeneID:237940 MGI:2668431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008131 - amine oxidase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006584 - catecholamine metabolism [Evidence IEA] codon_start : 1 note : retina-specific amine oxidase product : amine oxidase, copper containing 2 (retina-specific) protein_id : NP_849263.1

name	Aoc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753066 CCDS:CCDS25465.1 GeneID:11754 MGI:1306797
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008131 - amine oxidase activity [Evidence ISS] [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0048038 - quinone binding [Evidence ISS] GO_process : GO:0009308 - amine metabolism [Evidence ISS]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0006118 - electron transport [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] codon_start : 1 note : semicarbazide-sensitive amine oxidase product : amine oxidase, copper containing 3 protein_id : NP_033805.1

name	LOC629949 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82935345 GeneID:629949
definition	codon_start : 1 product : similar to ribosomal protein L37a protein_id : XP_899994.1

name	G6pc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982353 CCDS:CCDS25466.1 GeneID:14377 MGI:95607
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004346 - glucose-6-phosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0005978 - glycogen biosynthesis [Evidence IEA] codon_start : 1 note : Glc-6-Pase-alpha product : glucose-6-phosphatase, catalytic subunit protein_id : NP_032087.2

name	Aarsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450213 CCDS:CCDS25467.1 GeneID:69684 MGI:1916934
definition	GO_function : GO:0004813 - alanine-tRNA ligase activity [Evidence IEA]; GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006419 - alanyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 product : alanyl-tRNA synthetase domain containing 1 protein_id : NP_659078.1

name	1700113I22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21902523 CCDS:CCDS25468.1 GeneID:73635 MGI:1920885
definition	codon_start : 1 product : hypothetical protein LOC73635 protein_id : NP_081141.1

name	Rundc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369794 CCDS:CCDS25469.1 GeneID:217201 MGI:2144506
definition	codon_start : 1 exception : mismatches in translation product : RUN domain containing 1 protein_id : NP_766154.1

name	Rpl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567400 CCDS:CCDS25470.1 GeneID:19942 MGI:98036
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L27 protein_id : NP_035419.1

name	Ifi35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312544 CCDS:CCDS25471.1 GeneID:70110 MGI:1917360
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : interferon-induced protein 35 protein_id : NP_081596.1

name	Vat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859662 CCDS:CCDS25472.1 GeneID:26949 MGI:1349450
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : membrane protein of cholinergic synaptic vesicles product : vesicle amine transport protein 1 homolog (T californica) protein_id : NP_036167.1

name	Rnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753116 CCDS:CCDS25473.1 GeneID:11858 MGI:1338755
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007266 - Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : aplysia ras-related homolog N (RhoN); ras homolog N (RhoN); ras homolog gene family, member N product : Rho family GTPase 2 protein_id : NP_033838.1

name	Brca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560812 CCDS:CCDS25474.1 GeneID:12189 MGI:104537
definition	GO_component : GO:0005813 - centrosome [Evidence TAS]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0008274 - gamma-tubulin ring complex [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence TAS]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0015631 - tubulin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007098 - centrosome cycle [Evidence IGI]; GO:0051298 - centrosome duplication [Evidence TAS]; GO:0006978 - DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator [Evidence ISS]; GO:0008630 - DNA damage response, signal transduction resulting in induction of apoptosis [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IMP]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0045739 - positive regulation of DNA repair [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0006359 - regulation of transcription from RNA polymerase III promoter [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : breast cancer 1 protein_id : NP_033894.2

name	Nbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679020 CCDS:CCDS25475.1 GeneID:17966 MGI:108498
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : next to the Brca1 product : neighbor of Brca1 gene 1 protein_id : NP_032702.1

name	LOC666128 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666128
definition	number : 1 pseudo : _no_value

name	LOC665922 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262473 GeneID:665922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 109 ESTs, 21 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_033379.1

name	LOC670550 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262500 GeneID:670550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to novel member of the keratin associated protein (Krtap) family pseudo : _no_value transcript_id : XR_033451.1

name	LOC630936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262501 GeneID:630936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 168 ESTs, 21 Proteins product : similar to nuclease sensitive element binding protein 1 pseudo : _no_value transcript_id : XR_001819.2

clone name	MSMg01-446M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-324A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148K18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-150G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548P13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-483K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-536F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-540P13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-307K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-175B04.b	B6Ng01-175B04.g
ACC	GA002976	GA002977
length	1,123	1,103
definition	B6Ng01-175B04.b	B6Ng01-175B04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(100,237,564 - 100,238,678)	(100,442,682 - 100,443,765)
sequence	gaattccaggccaaaggatagctcccagactgcccttcccccaagtaggc gagacccaagacgctcagtttatccaaccctcaagctggccaatttgaca gtggaaaatggcctctcactgggagctaaatttcatttctgtaaattcct gggccgagcattctgcttatgagccacctgggagccacttgttgactctg tgagcaccacactgttaggacccagtgttaatgagctccggtgtgctgag gcgctggctcctaggttccatgtttgtccctttcctgtttcttgaatctg cagatgctcttcatgtctgcatgtggctgcacttcaagaaggctctcgtg atctaagttcggaaagccacttatccacccttctctacacagacctagac tactcctggcccacacattccaaacccctcagcagcacctggggacagat ctgcccatctgtaccggactcacctggacaaacaggggaatggtgttgag ccggaagatctccatgcggttcatgggatcccgggcgaggatgtgcaggg ctccggtgcagccttccacgatctcctccatcctcacaccatccgtgtag ggctgctgggtgcctgcagccacatggcgctgggcgtcctggtgggcctt gaccaacagctggacgaggcggggaatgaccgcggcctcctgcagagggg catggttggctgggcacagagccaggttccggatcaggccaatagttgcc tggcaagaaaggaggcagtgatgagtggaggggcgggtagtccttaaaca tctggaggatccctgatccccggctttaggtattttgtccttcctgtcat ctcttctgaatctgagtcccacttcagcaacaaccgcagagtcaaggagc atcctggctactcctggaaacggaactgggggccttgtgggcggggctgt aggcacagaacctgaaggaatctagagctaaagtttggggctttaagctc agttagtacacacaaaggtttggatacccagcaccgtacagagttgggtt gtgattgcacagaacttactcagcaagtatgagtagcttggatgcatgta ggatcaaggcaaacctggctaca	gaattctgggacagccagggctacacagagaaaccctgtctcgaaaaaaa acaaaaaaattctgctctttcaaagcatggcaggcagctcctggtctcgg gcctttgctggcttaaggctcaaactgttggaaagtgttctctgcaaatg catgactggtctcctcccgcttacatgaggcaacataaagggatctgcac actgctcagctaagttgctgttctaggcagacacaagaggctctgaagct ggactgcaggtgctgatggcacagatagctagggagagagaggccttgaa ccagagcagcaggagggactgctgaatgtgtctactcttgggtgtgagga gcaaggttgccttccccaagtaccccacaaagcccaggctgggaactctg ggccttgctgagaggtctttgggacatggccacctgcatgtggtcggttg ccttagctgtcagataaaggctttgtgctccaagtttctggctgccagcc aatccccaccttctctatgtgtctgaagccagcctctcctttctgcttca tgaaagccaacactgttgccctacccagcctcgtcacagctgtgcccagc cagcagaagggagacaggaccgatggccccaagctgtgggacaaagctgg tcttaatgtacgcagccctaaccccagggaagactgggctggacatagaa ggccaagagtgatagcacacagctgggattaacatgatttatttcagtat cagtcttagtggtggcttgaggtgggcaacacagggtgagggtaggagca tacatcccagattctcgggttgacaacccaattagcaagggtcctgttac tgagcagaaggcagagtgaaggtacttccaggagccaggctttgccagag caggagaatggggcttacttcttgccagctcagggtcccctccactggtt cttggtacctaccacccctccttttaagacccagaggcaccatgcaggca gattgggctgggccagaagcaaagctgggagcttcttcggggcattcttt tctgaacttttggtccctcaatccacaacagcagagacatgcttgcctgg aga
quality values	Open. Hide. 58 29 20 35 54 54 39 14 47 40 54 31 18 41 52 52 62 22 20 62 62 62 62 62 62 43 39 56 49 62 62 62 62 27 26 22 21 21 26 25 24 22 22 26 22 16 19 23 43 62 62 62 62 59 44 62 62 62 62 62 59 59 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 49 41 34 27 48 50 56 56 45 33 48 56 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 56 56 44 56 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 62 56 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 56 62 56 56 62 62 62 62 62 43 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 56 47 62 62 62 62 62 62 62 56 54 54 47 62 28 31 54 54 62 62 52 52 62 62 62 62 62 62 48 62 62 62 62 62 52 62 62 62 62 62 62 54 62 62 62 62 52 52 48 52 52 52 48 37 54 54 26 24 17 9 18 20 54 54 52 58 58 58 54 54 54 42 52 46 52 44 32 54 58 58 58 58 58 58 54 58 58 58 54 54 52 37 50 52 52 50 54 50 52 52 52 42 52 54 58 40 58 54 58 54 54 52 58 58 58 54 39 58 58 32 21 58 40 42 44 40 42 46 28 51 42 47 40 53 58 58 58 47 50 51 46 30 51 50 48 47 47 34 29 47 50 58 47 31 51 47 51 37 45 39 51 51 46 50 51 52 50 35 13 51 19 50 50 48 39 50 33 49 36 26 49 49 39 33 53 37 44 9 19 40 50 43 33 58 33 23 25 17 37 40 33 36 23 44 16 43 33 28 34 42 18 28 14 35 29 52 53 37 24 46 38 32 25 52 52 54 42 32 32 40 24 44 50 40 37 41 41 19 50 41 31 24 39 49 32 28 24 54 18 37 33 50 49 36 54 54 40 40 39 54 37 26 29 35 45 42 35 21 34 25 44 44 28 21 40 45 37 23 29 13 6 34 29 17 30 47 29 34 41 32 40 40 51 49 41 40 47 29 41 54 39 40 33 22 21 53 35 54 54 41 32 19 18 47 53 28 21 32 26 36 31 40 21 28 34 18 51 14 23 31 26 40 39 33 27 34 24 34 39 19 31 14 53 28 28 27 51 45 31 30 18 33 16 37 30 15 29 29 26 21 28 30 14 46 10 31 33 10 13 33 13 43 23 31 27 25 18 30 36 29 12 31 32 25 26 36 42 34 32 20 20 12 46 11 18 18 15 22 16 28 27 25 32 30 15 25 7 11 37 33 31 27 42 42 22 31 21 46 29 29 30 35 30 15 11 25 13 14 26 32 24 8 27 39 9 9 31 27 41 31 27 25 33 32 30 32 31 35 21 30 28 16 9 11 38 11 36 16 24 7 26 38 41 22 28 33 38 44 9 13 9 18 23 22 19 12 21 24 9 18 6 31 11 11 26 10 33 10 12 5 5 6 8 24 9 32 15 31 14 8 10 13 6 7 19 17 4 12 13 11 7 11 7 5 13 22 8 11 10 10 33 8 5 6 21 21 19 22 9 15 23 8 7 6 4 5 7 7 9 16 24 10 13 7 25 8 5 6 12 15 27 9 19 9 14 3 3 4 10 9 5 6 3 3 7 10 6 20 7 27 12 27 5 15 10 10 7 7 8 5 5 6 13 5 6 30 6 10 8 16 3 15 7 23 7 6 22	Open. Hide. 46 49 42 41 62 62 47 46 62 62 47 39 47 11 11 20 8 11 10 21 17 22 24 22 22 27 19 23 46 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 49 34 27 40 46 46 43 43 56 43 48 35 56 59 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 50 62 56 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 43 62 62 59 62 62 62 59 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 59 59 59 59 59 59 56 56 51 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 51 38 56 36 31 51 62 62 56 62 56 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 54 56 62 54 62 54 62 62 52 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 50 62 54 50 52 52 62 62 62 62 62 62 58 46 58 58 54 54 54 58 58 49 49 58 58 58 58 58 52 54 54 47 52 54 52 54 58 58 54 58 54 54 58 58 58 52 41 58 58 54 54 54 58 54 58 54 52 52 50 52 52 34 52 54 52 52 58 52 52 52 52 42 52 54 52 42 50 46 27 54 47 29 41 34 54 32 52 42 33 33 52 46 39 50 48 28 25 58 58 50 54 54 51 23 51 37 50 54 58 53 51 41 27 49 32 27 50 49 24 42 53 51 45 48 37 19 49 41 41 52 52 32 50 51 42 53 37 16 37 58 52 53 21 29 33 39 28 12 16 22 50 28 20 24 20 49 37 50 48 49 51 47 51 49 49 49 32 40 51 50 27 41 50 16 26 13 21 9 25 41 53 21 50 50 41 50 52 32 53 39 50 37 47 37 31 42 53 51 32 26 28 36 41 39 36 23 21 31 38 41 19 29 38 23 39 53 53 31 17 39 31 29 37 32 23 30 32 34 41 34 50 25 36 28 30 20 19 26 23 6 9 28 50 10 51 26 32 44 30 37 31 39 37 25 28 28 30 51 49 19 35 51 19 54 26 21 41 40 32 47 26 31 25 33 26 45 17 42 33 27 29 25 11 38 23 19 21 30 39 16 40 31 8 9 14 28 18 12 22 28 30 35 13 32 39 29 26 21 15 12 31 9 31 33 26 35 32 32 34 21 15 15 32 30 31 34 20 20 17 6 14 9 9 30 14 33 6 47 8 31 34 24 8 9 9 6 11 24 23 10 26 29 26 6 36 31 10 30 26 31 21 17 17 43 45 18 10 18 21 29 15 51 10 26 29 15 11 18 7 6 25 12 16 25 37 32 25 34 21 18 28 11 22 33 25 27 45 31 31 22 25 30 32 29 32 14 41 20 13 36 46 48 31 10 14 46 19 29 13 15 15 26 33 31 31 17 46 18 9 21 37 12 24 17 15 18 9 11 42 37 18 16 23 41 26 48 41 21 46 32 6 22 23 21 23 19 13 31 8 21 18 6 6 14 24 33 42 31 21 7 6 17 23 5 23 11 9 27 37 20 24 28 12 16 10 6 6 8 6 16 28 12 14 26 28 21 8 9 29 14 33 11 26 7 31 42 11 16 9 14 16 17 31 29 11 6 14 15 13 24 26 48 48 21 18 10 11 14 14 34 10 30 31 8 25 18 5 30 25 9 10 24 9 7 19 13 4 5 9 12 5 6 12 11 21 10 5 24 6 6 7 5 6 14 10 10 10 15 10 9 21 13 6 13 5 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_100237564_100238678
seq2: B6Ng01-175B04.b_49_1171

seq1  GAATTCCAGGCCAAAGGATAGCTCCCAGACTGCCCTTCCCCCAAGTAGGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGCCAAAGGATAGCTCCCAGACTGCCCTTCCCCCAAGTAGGC  50

seq1  GAGACCCAAGACGCTCAGTTTATCCAACCCTCAAGCTGGCCAATTTGACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACCCAAGACGCTCAGTTTATCCAACCCTCAAGCTGGCCAATTTGACA  100

seq1  GTGGAAAATGGCCTCTCACTGGGAGCTAAATTTCATTTCTGTAAATTCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAAAATGGCCTCTCACTGGGAGCTAAATTTCATTTCTGTAAATTCCT  150

seq1  GGGCCGAGCATTCTGCTTATGAGCCACCTGGGAGCCACTTGTTGACTCTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCGAGCATTCTGCTTATGAGCCACCTGGGAGCCACTTGTTGACTCTG  200

seq1  TGAGCACCACACTGTTAGGACCCAGTGTTAATGAGCTCCGGTGTGCTGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCACCACACTGTTAGGACCCAGTGTTAATGAGCTCCGGTGTGCTGAG  250

seq1  GCGCTGGCTCCTAGGTTCCATGTTTGTCCCTTTCCTGTTTCTTGAATCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCTGGCTCCTAGGTTCCATGTTTGTCCCTTTCCTGTTTCTTGAATCTG  300

seq1  CAGATGCTCTTCATGTCTGCATGTGGCTGCACTTCAAGAAGGCTCTCGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATGCTCTTCATGTCTGCATGTGGCTGCACTTCAAGAAGGCTCTCGTG  350

seq1  ATCTAAGTTCGGAAAGCCACTTATCCACCCTTCTCTACACAGACCTAGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTAAGTTCGGAAAGCCACTTATCCACCCTTCTCTACACAGACCTAGAC  400

seq1  TACTCCTGGCCCACACATTCCAAACCCCTCAGCAGCACCTGGGGACAGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTCCTGGCCCACACATTCCAAACCCCTCAGCAGCACCTGGGGACAGAT  450

seq1  CTGCCCATCTGTACCGGACTCACCTGGACAAACAGGGGAATGGTGTTGAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCCATCTGTACCGGACTCACCTGGACAAACAGGGGAATGGTGTTGAG  500

seq1  CCGGAAGATCTCCATGCGGTTCATGGGATCCCGGGCGAGGATGTGCAGGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGAAGATCTCCATGCGGTTCATGGGATCCCGGGCGAGGATGTGCAGGG  550

seq1  CTCCGGTGCAGCCTTCCACGATCTCCTCCATCCTCACACCATCCGTGTAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCGGTGCAGCCTTCCACGATCTCCTCCATCCTCACACCATCCGTGTAG  600

seq1  GGCTGCTGGGTGCCTGCAGCCACATGGCGCTGGGCGTCCTGGTGGGCCTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTGGGTGCCTGCAGCCACATGGCGCTGGGCGTCCTGGTGGGCCTT  650

seq1  GACCAACAGCTGGACGAGGCGGGGAATGACCGCGGCCTCCTGCAGAGGGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAACAGCTGGACGAGGCGGGGAATGACCGCGGCCTCCTGCAGAGGGG  700

seq1  CATGGTTGGCTGGGCACAGAGCCAGGTTCCGGATCAGGCCAATAGTTGCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGTTGGCTGGGCACAGAGCCAGGTTCCGGATCAGGCCAATAGTTGCC  750

seq1  TGGCAAGAAAGGAGGCAGTGATGAGTGGAGGGGCGGGTAGTCCTTAAACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAAGAAAGGAGGCAGTGATGAGTGGAGGGGCGGGTAGTCCTTAAACA  800

seq1  TCTGGAGGATCCCTGATCCCCGGCTTTAGGTATTTTGTCCTTCCTGTCAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAGGATCCCTGATCCCCGGCTTTAGGTATTTTGTCCTTCCTGTCAT  850

seq1  CTCTTCTGAATCTGAGTCCCACTTCAGCAACAACCGCAGAGTC-AGGAGC  899
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CTCTTCTGAATCTGAGTCCCACTTCAGCAACAACCGCAGAGTCAAGGAGC  900

seq1  ATCCTGGCTACTCCTGG-AACGGAACTGGGGG-CTTGTGGGCGGGGCTGT  947
      ||||||||||||||||| |||||||||||||| |||||||||||||||||
seq2  ATCCTGGCTACTCCTGGAAACGGAACTGGGGGCCTTGTGGGCGGGGCTGT  950

seq1  AGGCACAGAA-CTGAAGGAATCTAGAGCT-AAGGTTGGGGCTTT-AGCTC  994
      |||||||||| |||||||||||||||||| ||| |||||||||| |||||
seq2  AGGCACAGAACCTGAAGGAATCTAGAGCTAAAGTTTGGGGCTTTAAGCTC  1000

seq1  AGTTAGGACACACAAAGGGTTGGATACCCAGCACCGCACAGAGT--GGGT  1042
      |||||| ||||||||||| ||||||||||||||||| |||||||  || |
seq2  AGTTAGTACACACAAAGGTTTGGATACCCAGCACCGTACAGAGTTGGGTT  1050

seq1  GTGATGGCACAGAACTTACCCCAGCAAGTAGGGAGAGGCT--GAGGCA-G  1089
      ||||| |||||||||||| | |||||||||  |||  |||  || ||| |
seq2  GTGATTGCACAGAACTTA-CTCAGCAAGTA-TGAGTAGCTTGGATGCATG  1098

seq1  GAGGATCAAGGCGAACCTTGGCTACA  1115
       ||||||||||| |||| ||||||||
seq2  TAGGATCAAGGCAAACC-TGGCTACA  1123

seq1: chr11_100442682_100443765
seq2: B6Ng01-175B04.g_67_1169 (reverse)

seq1  TCTCCAG--CAGCATGTCTCTGCTG-TGTGGATGGAGG--CC--AAGGTC  43
      |||||||   ||||||||||||||| ||||||| ||||  ||  ||| ||
seq2  TCTCCAGGCAAGCATGTCTCTGCTGTTGTGGATTGAGGGACCAAAAGTTC  50

seq1  AGAAA--GATGCCCCG-AGAAGCT-CCAGCTTTGCTTTCTGCCCAGCCCA  89
      |||||   |||||||| ||||||| ||||||||||||   ||||||||||
seq2  AGAAAAGAATGCCCCGAAGAAGCTCCCAGCTTTGCTTCTGGCCCAGCCCA  100

seq1  TCTTGCCTGCATGGTGCCTCTGGGTCTTTAAAGGA-GGGTGGTAGGTACC  138
         ||||||||||||||||||||||||| |||||| ||||||||||||||
seq2  ATCTGCCTGCATGGTGCCTCTGGGTCTTAAAAGGAGGGGTGGTAGGTACC  150

seq1  AAGAACCAGTGGAGGGGACCCTGAGCTGGCAAG-AGTAAGCCCCA-TCTC  186
      ||||||||||||||||||||||||||||||||| ||||||||||| ||||
seq2  AAGAACCAGTGGAGGGGACCCTGAGCTGGCAAGAAGTAAGCCCCATTCTC  200

seq1  CTGCTCTGGCAAAGCCTGGCTCCTGG-AGTACC-TCACTCTGCCTTCTGC  234
      |||||||||||||||||||||||||| |||||| ||||||||||||||||
seq2  CTGCTCTGGCAAAGCCTGGCTCCTGGAAGTACCTTCACTCTGCCTTCTGC  250

seq1  TCAGTAACAGGA-CCTTGCTAATTGGGTTGTC-ACCCGAGAATCTGGGAT  282
      |||||||||||| ||||||||||||||||||| |||||||||||||||||
seq2  TCAGTAACAGGACCCTTGCTAATTGGGTTGTCAACCCGAGAATCTGGGAT  300

seq1  GTATGCTCCTACCCTCACCCTGTGTTGCCCACCTC-AGCCACCACTAAGA  331
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  GTATGCTCCTACCCTCACCCTGTGTTGCCCACCTCAAGCCACCACTAAGA  350

seq1  CTGATACTGAAATAAATCATGTTAATCCCAGCTGTGTGCTATCACTCTTG  381
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATACTGAAATAAATCATGTTAATCCCAGCTGTGTGCTATCACTCTTG  400

seq1  GCCTTCTATGTCCAGCCCAGTCTTCCCTGGGGTTAGGGCTGCGTACATTA  431
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTCTATGTCCAGCCCAGTCTTCCCTGGGGTTAGGGCTGCGTACATTA  450

seq1  AGACCAGCTTTGTCCCACAGCTTGGGGCCATCGGTCCTGTCTCCCTTCTG  481
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCAGCTTTGTCCCACAGCTTGGGGCCATCGGTCCTGTCTCCCTTCTG  500

seq1  CTGGCTGGGCACAGCTGTGACGAGGCTGGGTAGGGCAACAGTGTTGGCTT  531
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTGGGCACAGCTGTGACGAGGCTGGGTAGGGCAACAGTGTTGGCTT  550

seq1  TCATGAAGCAGAAAGGAGAGGCTGGCTTCAGACACATAGAGAAGGTGGGG  581
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGAAGCAGAAAGGAGAGGCTGGCTTCAGACACATAGAGAAGGTGGGG  600

seq1  ATTGGCTGGCAGCCAGAAACTTGGAGCACAAAGCCTTTATCTGACAGCTA  631
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGCTGGCAGCCAGAAACTTGGAGCACAAAGCCTTTATCTGACAGCTA  650

seq1  AGGCAACCGACCACATGCAGGTGGCCATGTCCCAAAGACCTCTCAGCAAG  681
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAACCGACCACATGCAGGTGGCCATGTCCCAAAGACCTCTCAGCAAG  700

seq1  GCCCAGAGTTCCCAGCCTGGGCTTTGTGGGGTACTTGGGGAAGGCAACCT  731
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGAGTTCCCAGCCTGGGCTTTGTGGGGTACTTGGGGAAGGCAACCT  750

seq1  TGCTCCTCACACCCAAGAGTAGACACATTCAGCAGTCCCTCCTGCTGCTC  781
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCCTCACACCCAAGAGTAGACACATTCAGCAGTCCCTCCTGCTGCTC  800

seq1  TGGTTCAAGGCCTCTCTCTCCCTAGCTATCTGTGCCATCAGCACCTGCAG  831
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTCAAGGCCTCTCTCTCCCTAGCTATCTGTGCCATCAGCACCTGCAG  850

seq1  TCCAGCTTCAGAGCCTCTTGTGTCTGCCTAGAACAGCAACTTAGCTGAGC  881
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGCTTCAGAGCCTCTTGTGTCTGCCTAGAACAGCAACTTAGCTGAGC  900

seq1  AGTGTGCAGATCCCTTTATGTTGCCTCATGTAAGCGGGAGGAGACCAGTC  931
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTGCAGATCCCTTTATGTTGCCTCATGTAAGCGGGAGGAGACCAGTC  950

seq1  ATGCATTTGCAGAGAACACTTTCCAACAGTTTGAGCCTTAAGCCAGCAAA  981
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCATTTGCAGAGAACACTTTCCAACAGTTTGAGCCTTAAGCCAGCAAA  1000

seq1  GGCCCGAGACCAGGAGCTGCCTGCCATGCTTTGAAAGAGCAGAATTTTTT  1031
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCGAGACCAGGAGCTGCCTGCCATGCTTTGAAAGAGCAGAATTTTTT  1050

seq1  TGTTTTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCCAGAA  1081
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCCAGAA  1100

seq1  TTC  1084
      |||
seq2  TTC  1103

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information