MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-178A07
Chromosome	11 (Build37)
Map Location	76,213,212 - 76,346,714
singlet/doublet	doublet
Overlap gene	Timm22, Abr
Upstream gene	Smyd4, Serpinf1, LOC100043447, Serpinf2, Wdr81, LOC100042498, 2010305C02Rik, Prpf8, Rilp, Scarf1, Slc43a2, Pitpna, LOC654359, Pps, Myo1c, Crk, Ywhae, Doc2b, Rph3al, 1700016K19Rik, 1500005K14Rik, Vps53, LOC668634, 2310047D13Rik, Gemin4, Dbil5, Glod4, Rnmtl1, Nxn
Downstream gene	LOC100043483, A830053O21Rik, Tusc5, Gosr1, Cpd, Tmigd1, Blmh, Slc6a4, Ccdc55, Efcab5, LOC628108, Ssh2, LOC544800, Coro6, Ankrd13b, 2210008F06Rik, Git1, Trp53i13, 1300007F04Rik, Taok1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Smyd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319822 MGI:2442796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20317 MGI:108080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043447 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	Serpinf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18816 MGI:107173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192652 MGI:2681828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 134 ESTs, 4 Proteins

name	LOC100042498 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2010305C02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380712 MGI:1917141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192159 MGI:2179381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rilp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280408 MGI:2144271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scarf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380713 MGI:2449455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215113 MGI:2442746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitpna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18738 MGI:99887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654359
definition	note : cytochrome c oxidase, subunit VIIc pseudogene pseudo : _no_value

name	Pps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19062 MGI:1194899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17913 MGI:106612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Crk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12928 MGI:88508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ywhae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22627 MGI:894689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Doc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13447 MGI:1100497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rph3al (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380714 MGI:1923492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016K19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74230 MGI:1921480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500005K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76566 MGI:1923816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 104 ESTs, 4 Proteins

name	Vps53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68299 MGI:1915549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668634 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	2310047D13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116972 MGI:2151840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gemin4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276919 MGI:2449313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbil5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13168 MGI:108039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glod4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67201 MGI:1914451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnmtl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67390 MGI:1914640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18230 MGI:109331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56322 MGI:1929742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109934 MGI:107771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100043483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 310 ESTs, 7 Proteins pseudo : _no_value

name	A830053O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320522 MGI:2444198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tusc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237858 MGI:3029307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gosr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53334 MGI:1858260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12874 MGI:107265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmigd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66601 MGI:1913851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blmh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104184 MGI:1345186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15567 MGI:96285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237859 MGI:2144305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcab5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319634 MGI:2442440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 153 ESTs, 10 Proteins pseudo : _no_value

name	Ssh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237860 MGI:2679255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC544800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544800
definition	note : heat shock protein 1, alpha pseudogene pseudo : _no_value

name	Coro6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ankrd13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268445 MGI:2144501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210008F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70057 MGI:1917307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Git1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216963 MGI:1927140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53i13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216964 MGI:1915125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300007F04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67477 MGI:1914727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taok1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216965 MGI:1914490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801987 GeneID:319822 MGI:2442796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 4 transcript_id : NM_177009.2

name	Serpinf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606334 GeneID:20317 MGI:108080
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade F, member 1 transcript_id : NM_011340.3

name	Serpinf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679382 GeneID:18816 MGI:107173
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade F, member 2 transcript_id : NM_008878.1

name	Wdr81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261939 GeneID:192652 MGI:2681828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 134 ESTs, 4 Proteins product : WD repeat domain 81 transcript_id : XM_001002633.2

name	LOC100042498 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261941 GeneID:100042498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042498 transcript_id : XM_001478320.1

name	2010305C02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087150 GeneID:380712 MGI:1917141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010305C02 gene transcript_id : NM_027249.2

name	Prpf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115583686 GeneID:192159 MGI:2179381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-mRNA processing factor 8 transcript_id : NM_138659.2

name	Rilp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480153 GeneID:280408 MGI:2144271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab interacting lysosomal protein transcript_id : NM_001029938.1

name	Scarf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239975 GeneID:380713 MGI:2449455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class F, member 1 transcript_id : NM_001004157.2

name	Slc43a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734185 GeneID:215113 MGI:2442746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 2 transcript_id : NM_173388.1

name	Pitpna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679336 GeneID:18738 MGI:99887
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol transfer protein, alpha transcript_id : NM_008850.1

name	Pps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50263040 GeneID:19062 MGI:1194899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : putative phosphatase transcript_id : NM_008916.2

name	Myo1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124494245 GeneID:17913 MGI:106612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IC transcript_id : NM_008659.3

name	Myo1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124494243 GeneID:17913 MGI:106612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IC transcript_id : NM_001080774.1

name	Myo1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124494241 GeneID:17913 MGI:106612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IC transcript_id : NM_001080775.1

name	Crk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559994 GeneID:12928 MGI:88508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-crk sarcoma virus CT10 oncogene homolog (avian) transcript_id : NM_133656.2

name	Ywhae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802428 GeneID:22627 MGI:894689
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide transcript_id : NM_009536.3

name	Doc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45433554 GeneID:13447 MGI:1100497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : double C2, beta transcript_id : NM_007873.2

name	Rph3al (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373455 GeneID:380714 MGI:1923492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabphilin 3A-like (without C2 domains) transcript_id : NM_029548.2

name	1700016K19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348515 GeneID:74230 MGI:1921480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700016K19 gene transcript_id : NM_198637.1

name	1500005K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261992 GeneID:76566 MGI:1923816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 104 ESTs, 4 Proteins product : RIKEN cDNA 1500005K14 gene transcript_id : XM_893392.3

name	Vps53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387913 GeneID:68299 MGI:1915549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 53 (yeast) transcript_id : NM_026664.3

name	2310047D13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351822 GeneID:116972 MGI:2151840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310047D13 gene transcript_id : NM_027773.2

name	Gemin4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340774 GeneID:276919 MGI:2449313
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gem (nuclear organelle) associated protein 4 transcript_id : NM_177367.2

name	Dbil5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921598 GeneID:13168 MGI:108039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diazepam binding inhibitor-like 5 transcript_id : NM_021294.2

name	Glod4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343963 GeneID:67201 MGI:1914451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyoxalase domain containing 4 transcript_id : NM_026029.2

name	Rnmtl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803016 GeneID:67390 MGI:1914640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA methyltransferase like 1 transcript_id : NM_183263.2

name	Nxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385508 GeneID:18230 MGI:109331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoredoxin transcript_id : NM_008750.4

name	Timm22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802246 GeneID:56322 MGI:1929742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 22 homolog (yeast) transcript_id : NM_019818.3

name	Abr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38683819 GeneID:109934 MGI:107771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : active BCR-related gene transcript_id : NM_198894.1

name	Abr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38683821 GeneID:109934 MGI:107771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : active BCR-related gene transcript_id : NM_198895.1

name	Abr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574112 GeneID:109934 MGI:107771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : active BCR-related gene transcript_id : NM_198018.1

name	A830053O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254309 GeneID:320522 MGI:2444198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830053O21 gene transcript_id : NM_177182.3

name	Tusc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343238 GeneID:237858 MGI:3029307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor suppressor candidate 5 transcript_id : NM_177709.2

name	Gosr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131190 GeneID:53334 MGI:1858260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi SNAP receptor complex member 1 transcript_id : NM_016810.3

name	Cpd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681000 GeneID:12874 MGI:107265
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase D transcript_id : NM_007754.1

name	Tmigd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802619 GeneID:66601 MGI:1913851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and immunoglobulin domain containing 1 transcript_id : NM_025655.2

name	Blmh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801815 GeneID:104184 MGI:1345186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bleomycin hydrolase transcript_id : NM_178645.2

name	Slc6a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110638 GeneID:15567 MGI:96285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 transcript_id : NM_010484.1

name	Ccdc55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858548 GeneID:237859 MGI:2144305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 55 transcript_id : NM_001012309.1

name	Efcab5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026914 GeneID:319634 MGI:2442440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand calcium binding domain 5 transcript_id : NM_176965.3

name	Ssh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674237 GeneID:237860 MGI:2679255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slingshot homolog 2 (Drosophila) transcript_id : NM_177710.3

name	Coro6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281696 GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 6 transcript_id : NM_139128.1

name	Coro6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129989 GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 6 transcript_id : NM_139130.2

name	Coro6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281699 GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 6 transcript_id : NM_139129.1

name	Ankrd13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956382 GeneID:268445 MGI:2144501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13b transcript_id : NM_172945.2

name	2210008F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261945 GeneID:70057 MGI:1917307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2210008F06 gene transcript_id : XM_001002792.2

name	Git1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921284 GeneID:216963 MGI:1927140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 1 transcript_id : NM_001004144.1

name	Trp53i13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906196 GeneID:216964 MGI:1915125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 inducible protein 13 transcript_id : NM_001024920.1

name	1300007F04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802026 GeneID:67477 MGI:1914727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300007F04 gene transcript_id : NM_026185.3

name	Taok1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358958 GeneID:216965 MGI:1914490
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAO kinase 1 transcript_id : NM_144825.2

name	Smyd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892871 GeneID:319822 MGI:2442796
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SET and MYND domain containing 4 protein_id : NP_795983.1

name	Serpinf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606335 CCDS:CCDS25045.1 GeneID:20317 MGI:108080
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0016525 - negative regulation of angiogenesis [Evidence IDA]; GO:0050769 - positive regulation of neurogenesis [Evidence ISS] codon_start : 1 note : stromal cell derived factor 3; pigment epithelium-derived factor; alpha-2 antiplasmin; pigment epithelium derived factor; pigment epithelium-derived factor-like; serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 product : serine (or cysteine) proteinase inhibitor, clade F, member 1 protein_id : NP_035470.3

name	Serpinf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679383 CCDS:CCDS25046.1 GeneID:18816 MGI:107173
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] citation : [PUBMED 8647939] codon_start : 1 function : Inhibitor of the plasmin note : plasmin inhibitor alpha 2; alpha 2 antiplasmin; pigment epithelium derived factor product : serine (or cysteine) proteinase inhibitor, clade F, member 2 protein_id : NP_032904.1

name	Wdr81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261940 GeneID:192652 MGI:2681828
definition	codon_start : 1 product : alpha-2-plasmin inhibitor protein_id : XP_001002633.2

name	LOC100042498 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261942 GeneID:100042498
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478370.1

name	2010305C02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059147 GeneID:380712 MGI:1917141
definition	codon_start : 1 product : hypothetical protein LOC380712 protein_id : NP_081525.1

name	Prpf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115583687 CCDS:CCDS25048.1 GeneID:192159 MGI:2179381
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005682 - snRNP U5 [Evidence ISS]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS] [Evidence IEA] codon_start : 1 note : splicing factor PRP8-like product : pre-mRNA processing factor 8 protein_id : NP_619600.2

name	Rilp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480154 CCDS:CCDS25049.1 GeneID:280408 MGI:2144271
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : Rab interacting lysosomal protein protein_id : NP_001025109.1

name	Scarf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239976 CCDS:CCDS25050.1 GeneID:380713 MGI:2449455
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0016358 - dendrite development [Evidence IDA] codon_start : 1 note : novel protein, ortholog of human scavenger receptor class F, member 1 SCARF1 product : scavenger receptor class F, member 1 protein_id : NP_001004157.2

name	Slc43a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734186 CCDS:CCDS25051.1 GeneID:215113 MGI:2442746
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0015179 - L-amino acid transporter activity [Evidence IDA] GO_process : GO:0015807 - L-amino acid transport [Evidence IDA] codon_start : 1 note : L-type amino acid transporter 4 product : solute carrier family 43, member 2 protein_id : NP_775564.1

name	Pitpna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679337 CCDS:CCDS25052.1 GeneID:18738 MGI:99887
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence ISS] [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence ISS] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Pitp alpha product : phosphatidylinositol transfer protein, alpha protein_id : NP_032876.1

name	Pps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679449 CCDS:CCDS25053.1 GeneID:19062 MGI:1194899
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0043005 - neuron projection [Evidence ISS]; GO:0001726 - ruffle [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016312 - inositol bisphosphate phosphatase activity [Evidence ISS]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence ISS]; GO:0004445 - inositol-polyphosphate 5-phosphatase activity [Evidence IEA]; GO:0042577 - lipid phosphatase activity [Evidence ISS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS] codon_start : 1 note : PI-5-phosphatase related; putative PI-5-phosphatase product : putative phosphatase protein_id : NP_032942.1

name	Myo1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124494242 GeneID:17913 MGI:106612
definition	GO_component : GO:0016459 - myosin [Evidence IEA]; GO:0045160 - myosin I [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006810 - transport [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; myosin-Ibeta; myosin I beta; nuclear myosin I beta product : myosin IC isoform a protein_id : NP_001074244.1

name	Myo1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124494244 GeneID:17913 MGI:106612
definition	GO_component : GO:0016459 - myosin [Evidence IEA]; GO:0045160 - myosin I [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006810 - transport [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; myosin-Ibeta; myosin I beta; nuclear myosin I beta product : myosin IC isoform b protein_id : NP_001074243.1

name	Myo1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678986 CCDS:CCDS25054.1 GeneID:17913 MGI:106612
definition	GO_component : GO:0016459 - myosin [Evidence IEA]; GO:0045160 - myosin I [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006810 - transport [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 3; myosin-Ibeta; myosin I beta; nuclear myosin I beta product : myosin IC isoform b protein_id : NP_032685.1

name	Crk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559995 CCDS:CCDS25055.1 GeneID:12928 MGI:88508
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0045309 - protein phosphorylated amino acid binding [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : CT-10 related kinase 3; avian sarcoma virus CT10 (v-crk) oncogene homolog; proto-oncogene c-crk; v-crk sarcoma virus CT10 oncogene-like protein product : v-crk sarcoma virus CT10 oncogene homolog protein_id : NP_598417.2

name	Ywhae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981925 CCDS:CCDS25056.1 GeneID:22627 MGI:894689
definition	GO_function : GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence IDA] codon_start : 1 exception : mismatches in translation note : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activatioprotein, epsilon polypeptide; 14-3-3 epsilon product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide protein_id : NP_033562.2

name	Doc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45433555 CCDS:CCDS25057.1 GeneID:13447 MGI:1100497
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA] codon_start : 1 note : double C2 protein beta product : double C2, beta protein_id : NP_031899.2

name	Rph3al (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152502 CCDS:CCDS25058.1 GeneID:380714 MGI:1923492
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0045744 - negative regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0017158 - regulation of calcium ion-dependent exocytosis [Evidence IMP] codon_start : 1 product : rabphilin 3A-like (without C2 domains) protein_id : NP_083824.1

name	1700016K19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348516 CCDS:CCDS25059.1 GeneID:74230 MGI:1921480
definition	codon_start : 1 product : hypothetical protein LOC74230 protein_id : NP_941039.1

name	1500005K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261993 GeneID:76566 MGI:1923816
definition	codon_start : 1 product : hypothetical protein LOC76566 protein_id : XP_898485.2

name	Vps53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980873 CCDS:CCDS25060.1 GeneID:68299 MGI:1915549
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 53 protein_id : NP_080940.2

name	2310047D13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625847 GeneID:116972 MGI:2151840
definition	codon_start : 1 product : whn-dependent transcript 3 protein_id : NP_082049.1

name	Gemin4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893521 CCDS:CCDS25061.1 GeneID:276919 MGI:2449313
definition	GO_component : GO:0015030 - Cajal body [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0043021 - ribonucleoprotein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : gemin 4 protein_id : NP_796341.1

name	Dbil5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946592 CCDS:CCDS25062.1 GeneID:13168 MGI:108039
definition	GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : diazepam binding inhibitor-like 5 protein_id : NP_067269.1

name	Glod4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313080 CCDS:CCDS25063.1 GeneID:67201 MGI:1914451
definition	GO_function : GO:0004462 - lactoylglutathione lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glyoxalase domain containing 4 protein_id : NP_080305.1

name	Rnmtl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304046 GeneID:67390 MGI:1914640
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : RNA methyltransferase like 1 protein_id : NP_899086.1

name	Nxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679160 CCDS:CCDS25064.1 GeneID:18230 MGI:109331
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] codon_start : 1 product : nucleoredoxin protein_id : NP_032776.1

name	Timm22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543865 CCDS:CCDS25065.1 GeneID:56322 MGI:1929742
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : preprotein translocase product : translocase of inner mitochondrial membrane 22 homolog protein_id : NP_062792.2

name	Abr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38683822 CCDS:CCDS25066.1 GeneID:109934 MGI:107771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : active BCR-related isoform 3 protein_id : NP_942598.1

name	Abr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574113 GeneID:109934 MGI:107771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : active BCR-related isoform 1 protein_id : NP_932135.1

name	Abr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38683820 CCDS:CCDS25067.1 GeneID:109934 MGI:107771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : active BCR-related isoform 2 protein_id : NP_942597.1

name	A830053O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254310 CCDS:CCDS25068.1 GeneID:320522 MGI:2444198
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : novel helix-loop-helix DNA-binding domain containing protein product : hypothetical protein LOC320522 protein_id : NP_796156.2

name	Tusc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244170 CCDS:CCDS25069.1 GeneID:237858 MGI:3029307
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 product : tumor suppressor candidate 5 protein_id : NP_808377.1

name	Gosr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542904 CCDS:CCDS25070.1 GeneID:53334 MGI:1858260
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS] [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Cis-Golgi SNARE product : golgi SNAP receptor complex member 1 protein_id : NP_058090.2

name	Cpd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681001 CCDS:CCDS25071.1 GeneID:12874 MGI:107265
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008472 - metallocarboxypeptidase D activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0009045 - xylose isomerase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : carboxypeptidase D protein_id : NP_031780.1

name	Tmigd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385118 CCDS:CCDS25072.1 GeneID:66601 MGI:1913851
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane and immunoglobulin domain containing protein_id : NP_079931.1

name	Blmh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519997 CCDS:CCDS25073.1 GeneID:104184 MGI:1345186
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0008423 - bleomycin hydrolase activity [Evidence IMP]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0042493 - response to drug [Evidence IMP]; GO:0009636 - response to toxin [Evidence IMP] codon_start : 1 note : BLM hydrolase product : bleomycin hydrolase protein_id : NP_848760.1

name	Slc6a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110639 CCDS:CCDS25074.1 GeneID:15567 MGI:96285
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008504 - monoamine transporter activity [Evidence ISS]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0005335 - serotonin:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015844 - monoamine transport [Evidence ISS]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 5-hydroxytryptamine (serotonin) transporter product : solute carrier family 6 member 4 protein_id : NP_034614.1

name	Ccdc55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858549 CCDS:CCDS25075.1 GeneID:237859 MGI:2144305
definition	codon_start : 1 product : coiled-coil domain containing 55 protein_id : NP_001012309.1

name	Efcab5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026915 GeneID:319634 MGI:2442440
definition	codon_start : 1 product : EF-hand calcium binding domain 5 protein_id : NP_795939.2

name	Ssh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674238 CCDS:CCDS25076.1 GeneID:237860 MGI:2679255
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : slingshot 2L product : slingshot-like 2 protein_id : NP_808378.2

name	Coro6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281697 CCDS:CCDS25077.1 GeneID:216961 MGI:2183448
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform A is encoded by transcript variant A; coronin 6; clipin E; coronin 6/clipin E type D product : coronin, actin binding protein 6 isoform A protein_id : NP_624354.1

name	Coro6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281703 CCDS:CCDS25079.1 GeneID:216961 MGI:2183448
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform B is encoded by transcript variant B; coronin 6; clipin E; coronin 6/clipin E type D product : coronin, actin binding protein 6 isoform B protein_id : NP_624356.1

name	Coro6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281700 CCDS:CCDS25078.1 GeneID:216961 MGI:2183448
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform C is encoded by transcript variant C; coronin 6; clipin E; coronin 6/clipin E type D product : coronin, actin binding protein 6 isoform C protein_id : NP_624355.1

name	Ankrd13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956383 GeneID:268445 MGI:2144501
definition	codon_start : 1 product : ankyrin repeat domain 13b protein_id : NP_766533.2

name	2210008F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261946 GeneID:70057 MGI:1917307
definition	codon_start : 1 product : hypothetical protein LOC70057 protein_id : XP_001002792.2

name	Git1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921285 CCDS:CCDS25080.1 GeneID:216963 MGI:1927140
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : G protein-coupled receptor kinase-associated ADP ribosylation factor GTPase-activating protein product : G protein-coupled receptor kinase-interactor 1 protein_id : NP_001004144.1

name	Trp53i13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906197 CCDS:CCDS25081.1 GeneID:216964 MGI:1915125
definition	codon_start : 1 product : tumor protein p53 inducible protein 13 protein_id : NP_001020091.1

name	1300007F04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625747 GeneID:67477 MGI:1914727
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67477 protein_id : NP_080461.2

name	LOC668634 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668634
definition	number : 1 pseudo : _no_value

name	LOC100043447 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261991 GeneID:100043447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c pseudo : _no_value transcript_id : XR_034801.1

name	LOC100043483 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261994 GeneID:100043483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 310 ESTs, 7 Proteins product : similar to Rpl36 protein pseudo : _no_value transcript_id : XR_034836.1

name	LOC628108 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261995 GeneID:628108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 153 ESTs, 10 Proteins product : similar to vacuolar H+ ATPase G1 pseudo : _no_value transcript_id : XR_034847.1

clone name	MSMg01-378A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-362E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-178A07.b	B6Ng01-178A07.g
ACC	GA005127	GA005128
length	939	1,088
definition	B6Ng01-178A07.b	B6Ng01-178A07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(76,213,212 - 76,214,150)	(76,345,608 - 76,346,714)
sequence	gaattcataaatacttgtgggctgattacaagtcacagtgtgggatttca gtccacaggtcgctggaaccattccccgatgggaaatggctctcttccat ttccgtaaatgtatgcaacagatggcgcagcgtttccaaatcagtattgg ctgctctcctgacttcatagcttatctcaggtctgctagtagttgagaga gaaaaaaaattttaaccccatcttgaaagatgctttccaatgcctaggaa agaaccctgattaaacaaatgatctgtggcaagtttcctaggcacgaaca caggacaaaatgtacactattacacatacacatgcatacacacattttta aaaaagaggaccattcatgtgtatcagctcagctactaacaacagtgaca ttttaagaggaaaacccaaccactggctatccttcatggctttcgaggtt atttctttcgtatctgccgccatctaatggaagaatgaaagagagaactc taccaacacataagatgcaaaagattaaagtgaaagcagcagaatgcttt aattacacaggcttcctctactgtaacacacacacacacacaaacacaca cacacagagagcacaaagtgtatgacacaagaccatttaaatttcagaat ataacctcatacttctagtagaaatgccccaaagtcctcagtgtgtttaa ggtagagagaaaaattgtttaagttttcaggcctgtaaaatatcatcaca tgaaccaatgaaagtgttaaagacaatcttcacacactggtgccacaaat ggtggctcacgcctttaatcccagcacccaggaagcacatctttgtgagt ttgagggcaacctggtctacaacagccaggcttacacaatgacaccctgc ttcaaaacactaaataaattgtcttattcgtgtgtgtgt	gaattcactgtgtagattgggctggccttaaattaacagatagctgtttg cctctacttctcctgagagctagggttaatggcatgtactgtcatgcaca gtcaagcaagagcttttggtatgccttaccaatgagccacctctccagct tcgaattaaattttaaaaattattatcagtgtgtgtgtgtgtgtgtgtgt tcgcatgcttgggcacacgtatgctatgctttgtttggagatcagaggac aactttagggttctctccttctgattttacaggggccccaggtcttgaac ttgtgttaccaggcttgtatggcaagttcttttattgcctaagccacctg agttaacttcctaaatgagttccatttcactgttttatgtttggtaatcc cgttgtgctggtgccatttgttgaaaagtctgttctttccctatagagta gcattggcatccttgtcaggattcaaatgatgggaggcagtgctttcccc aaatgtacgatgtcctgggcttaatccctgtaccagaaaacaatacaaaa aatcagttggctacctgtagtgcccctttgggagactaaggcagagcagg ttagatttgagcccatttaggctacagaaagagactgaaaagcaaaagca aaaaaaaaaaaaaaaagtccttgatcatagctatataggattatttccgg actcttcagctctgccctgaagatgtttattggaagccgctgccagcagt tttccacttctctgtagtcttggaagctcccgcaggacacaggacgagtt actgggcatcccatggtgaacgcttttcccaagaggctctcccagctaat catttcccgtatctgtcaggtggccagggaggtggcagtgaggtgcccca gtgcaggcctctgccagggtgcaggtcccagagcaggcctgttggtgtga atctcagctactgattgggtggtgccctgatgccctggtaggagagctcc agaccaggtgggaaagagagcagcagctgagggaggcgtctggcactaca gcattgcactgacgtgctgcacggaggcgaatcctgca
quality values	Open. Hide. 58 31 22 27 62 31 22 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 47 59 62 62 43 59 62 62 59 51 62 59 62 62 62 62 62 62 62 59 49 62 62 59 49 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 54 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 49 49 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 39 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 54 58 54 58 58 58 54 58 54 58 58 58 49 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 54 58 54 58 54 58 54 58 58 58 52 58 54 58 53 58 54 58 52 58 54 58 58 51 58 58 58 50 54 49 58 58 58 54 58 51 52 49 58 58 50 52 51 54 54 47 45 35 45 50 58 58 47 49 58 49 53 58 58 53 41 46 58 47 50 53 52 51 49 58 58 58 53 50 53 50 49 54 58 50 37 48 50 53 54 50 58 58 50 40 54 31 58 58 49 40 58 58 52 41 41 53 51 52 51 50 53 58 52 58 50 58 40 40 49 44 49 24 53 42 58 50 54 37 58 58 58 58 50 37 49 51 28 58 49 37 58 49 40 58 58 40 40 39 39 54 30 50 52 53 39 28 54 54 51 53 53 52 47 39 52 41 41 50 42 53 39 27 32 39 38 32 38 49 51 40 54 49 37 52 53 37 34 32 54 53 37 41 27 23 52 45 53 52 47 39 38 41 37 53 42 41 32 42 33 23 42 31 32 25 53 37 54 36 32 51 54 35 54 53 26 34 33 40 32 41 33 33 37 49 32 23 32 31 31 47 47 29 40 52 32 29 46 40 31 31 53 53 45 31 32 32 42 35 45 34 46 51 41 45 30 31 41 21 31 51 35 30 33 32 46 32 26 38 39 30 40 30 30 23 25 31 33 35 30 21 30 31 39 32 42 31 38 33 41 30 31 31 31 25 25 32 31 33 31 31 33 30 25 30 46 31 38 43 28 31 31 31 32 47 47 31 30 29 31 31 32 48 33 31 38 48 41 26 27 28 8 31 32 26 39 25 31 18 5 17 39 31 41 23 31 9 9 6	Open. Hide. 62 59 51 59 62 59 43 59 62 62 62 59 49 46 28 37 59 59 54 50 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 54 49 49 62 62 62 62 59 54 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 56 54 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 54 52 58 58 58 58 54 54 58 58 58 58 49 58 36 41 58 58 48 58 54 58 58 58 58 58 58 58 54 58 58 58 58 54 58 52 58 58 58 58 58 41 58 58 58 58 58 58 58 41 49 41 54 50 58 42 58 52 54 52 58 50 54 53 42 51 49 58 51 52 53 40 58 58 58 58 42 58 58 58 50 58 58 48 51 51 58 54 58 50 54 52 49 58 58 58 54 58 46 39 39 58 58 58 58 58 58 43 48 46 51 58 58 37 51 40 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 38 50 50 44 50 51 49 39 39 39 36 52 53 50 49 50 39 51 40 53 53 41 47 41 26 40 42 37 54 40 42 51 32 44 38 28 41 40 53 42 39 34 34 45 45 40 45 37 29 54 44 37 21 33 41 23 35 20 35 35 54 49 40 54 24 42 21 45 53 35 53 54 40 41 42 32 34 46 31 40 53 53 31 53 54 54 28 20 37 26 36 44 51 31 40 38 37 52 32 40 33 31 45 31 34 32 31 53 34 23 32 35 32 53 46 33 31 33 6 35 22 18 32 32 33 21 52 31 25 33 53 22 52 31 33 31 31 40 46 45 32 23 31 32 51 30 28 32 34 51 31 40 39 43 25 23 31 31 51 51 31 21 46 29 17 38 33 42 25 35 19 33 31 37 20 46 41 31 32 38 43 36 31 31 31 31 32 47 30 32 46 31 24 30 29 38 32 38 31 32 36 6 10 7 27 28 25 18 29 29 23 37 21 16 18 25 15 23 26 32 36 25 34 36 42 18 25 24 32 24 41 41 31 33 32 22 43 27 37 23 18 22 26 32 31 26 21 20 27 26 22 48 21 17 29 31 23 15 17 25 25 44 26 31 11 31 9 31 13 13 10 5 14 27 30 19 11 31 13 21 29 21 19 19 22 27 24 24 28 32 14 32 32 24 23 24 32 30 18 11 32 40 12 8 24 15 5 7 17 39 24 27 26 8 4 8 19 48 30 22 20 7 6 17 32 14 32 10 21 6 13 12 9 21 5 3 4 11 16 28 20 15 7 14 34 21 18 47 16 8 18 7 24 5 11 5 6 26 12 13 7 13 23 10 5 26 8 19 7 23 8 6 25 11 9 8 10 4 5 8 27 13 24 6 25 10 19 25 25 16 20 10 21 10 7 10 6 21 5 9 3 2 6 15 5 6 11 17 3 8 17 6 5 15 13 6 8 9 5 8 7 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_76213212_76214150
seq2: B6Ng01-178A07.b_49_987

seq1  GAATTCATAAATACTTGTGGGCTGATTACAAGTCACAGTGTGGGATTTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATAAATACTTGTGGGCTGATTACAAGTCACAGTGTGGGATTTCA  50

seq1  GTCCACAGGTCGCTGGAACCATTCCCCGATGGGAAATGGCTCTCTTCCAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCACAGGTCGCTGGAACCATTCCCCGATGGGAAATGGCTCTCTTCCAT  100

seq1  TTCCGTAAATGTATGCAACAGATGGCGCAGCGTTTCCAAATCAGTATTGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCGTAAATGTATGCAACAGATGGCGCAGCGTTTCCAAATCAGTATTGG  150

seq1  CTGCTCTCCTGACTTCATAGCTTATCTCAGGTCTGCTAGTAGTTGAGAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCTCCTGACTTCATAGCTTATCTCAGGTCTGCTAGTAGTTGAGAGA  200

seq1  GAAAAAAAATTTTAACCCCATCTTGAAAGATGCTTTCCAATGCCTAGGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAAAAATTTTAACCCCATCTTGAAAGATGCTTTCCAATGCCTAGGAA  250

seq1  AGAACCCTGATTAAACAAATGATCTGTGGCAAGTTTCCTAGGCACGAACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACCCTGATTAAACAAATGATCTGTGGCAAGTTTCCTAGGCACGAACA  300

seq1  CAGGACAAAATGTACACTATTACACATACACATGCATACACACATTTTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACAAAATGTACACTATTACACATACACATGCATACACACATTTTTA  350

seq1  AAAAAGAGGACCATTCATGTGTATCAGCTCAGCTACTAACAACAGTGACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGAGGACCATTCATGTGTATCAGCTCAGCTACTAACAACAGTGACA  400

seq1  TTTTAAGAGGAAAACCCAACCACTGGCTATCCTTCATGGCTTTCGAGGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAAGAGGAAAACCCAACCACTGGCTATCCTTCATGGCTTTCGAGGTT  450

seq1  ATTTCTTTCGTATCTGCCGCCATCTAATGGAAGAATGAAAGAGAGAACTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTTTCGTATCTGCCGCCATCTAATGGAAGAATGAAAGAGAGAACTC  500

seq1  TACCAACACATAAGATGCAAAAGATTAAAGTGAAAGCAGCAGAATGCTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAACACATAAGATGCAAAAGATTAAAGTGAAAGCAGCAGAATGCTTT  550

seq1  AATTACACAGGCTTCCTCTACTGTAACACACACACACACACAAACACACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTACACAGGCTTCCTCTACTGTAACACACACACACACACAAACACACA  600

seq1  CACACAGAGAGCACAAAGTGTATGACACAAGACCATTTAAATTTCAGAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAGAGAGCACAAAGTGTATGACACAAGACCATTTAAATTTCAGAAT  650

seq1  ATAACCTCATACTTCTAGTAGAAATGCCCCAAAGTCCTCAGTGTGTTTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACCTCATACTTCTAGTAGAAATGCCCCAAAGTCCTCAGTGTGTTTAA  700

seq1  GGTAGAGAGAAAAATTGTTTAAGTTTTCAGGCCTGTAAAATATCATCACA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGAGAGAAAAATTGTTTAAGTTTTCAGGCCTGTAAAATATCATCACA  750

seq1  TGAACCAATGAAAGTGTTAAAGACAATCTTCACACACTGGTGCCACAAAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACCAATGAAAGTGTTAAAGACAATCTTCACACACTGGTGCCACAAAT  800

seq1  GGTGGCTCACGCCTTTAATCCCAGCACCCAGGAAGCACATCTTTGTGAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCTCACGCCTTTAATCCCAGCACCCAGGAAGCACATCTTTGTGAGT  850

seq1  TTGAGGGCAACCTGGTCTACAACAGCCAGGCTTACACAATGACACCCTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGGCAACCTGGTCTACAACAGCCAGGCTTACACAATGACACCCTGC  900

seq1  TTCAAAACACTAAATAAATTGTCTTATTCGTGTGTGTGT  939
      |||||||||||||||||||||||||||||||||||||||
seq2  TTCAAAACACTAAATAAATTGTCTTATTCGTGTGTGTGT  939

seq1: chr11_76345608_76346714
seq2: B6Ng01-178A07.g_63_1150 (reverse)

seq1  TGCAGGATTCGCCCTCCCGTGCAGGCCACCGTCAGTGCAAATGCCTGTAG  50
      |||||||||||||   ||||||||  || ||||||||| |||| ||||||
seq2  TGCAGGATTCGCC--TCCGTGCAG--CA-CGTCAGTGC-AATG-CTGTAG  43

seq1  TGCCAGGAACGCCTCCCTCCAGCTGGCTGGCTCTCTTTCCCACCTGGTCC  100
      ||||||  |||||||||| ||||| ||| |||||||||||||||||||| 
seq2  TGCCAG--ACGCCTCCCT-CAGCT-GCT-GCTCTCTTTCCCACCTGGTC-  87

seq1  TTGGAGCTCTCCTACCCAGGGCACTCAGGGCACCCACCCAATCAGTAGCT  150
       ||||||||||||| |||||||| |||||||| |||||||||||||||||
seq2  -TGGAGCTCTCCTA-CCAGGGCA-TCAGGGCA-CCACCCAATCAGTAGCT  133

seq1  GAGATTCACACCAACAGGCCCTGCTCTGGGACCTGCACCCTGGCAGAGGC  200
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  GAGATTCACACCAACAGG-CCTGCTCTGGGACCTGCACCCTGGCAGAGGC  182

seq1  CTGCACTGGGGCACCTCACTGCCACCTCCCTGGCCACCCTGACAGATACG  250
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  CTGCACTGGGGCACCTCACTGCCACCTCCCTGGCCA-CCTGACAGATACG  231

seq1  GGAAATGATTAGCTGGGAGAGCCTCTTGGGAAAAGCGTTCACCATGGGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATGATTAGCTGGGAGAGCCTCTTGGGAAAAGCGTTCACCATGGGAT  281

seq1  GCCCAGTAACTCGTCCTGTGTCCTGCGGGAGCTTCCAAGACTACAGAGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGTAACTCGTCCTGTGTCCTGCGGGAGCTTCCAAGACTACAGAGAA  331

seq1  GTGGAAAACTGCTGGCAGCGGCTTCCAATAAACATCTTCAGGGCAGAGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAAAACTGCTGGCAGCGGCTTCCAATAAACATCTTCAGGGCAGAGCT  381

seq1  GAAGAGTCCGGAAATAATCCTATATAGCTATGATCAAGGACTTTTTTTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGTCCGGAAATAATCCTATATAGCTATGATCAAGGACTTTTTTTTT  431

seq1  TTTTTTTTGCTTTTGCTTTTCAGTCTCTTTCTGTAGCCTAAATGGGCTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTGCTTTTGCTTTTCAGTCTCTTTCTGTAGCCTAAATGGGCTCA  481

seq1  AATCTAACCTGCTCTGCCTTAGTCTCCCAAAGGGGCACTACAGGTAGCCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTAACCTGCTCTGCCTTAGTCTCCCAAAGGGGCACTACAGGTAGCCA  531

seq1  ACTGATTTTTTGTATTGTTTTCTGGTACAGGGATTAAGCCCAGGACATCG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGATTTTTTGTATTGTTTTCTGGTACAGGGATTAAGCCCAGGACATCG  581

seq1  TACATTTGGGGAAAGCACTGCCTCCCATCATTTGAATCCTGACAAGGATG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATTTGGGGAAAGCACTGCCTCCCATCATTTGAATCCTGACAAGGATG  631

seq1  CCAATGCTACTCTATAGGGAAAGAACAGACTTTTCAACAAATGGCACCAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATGCTACTCTATAGGGAAAGAACAGACTTTTCAACAAATGGCACCAG  681

seq1  CACAACGGGATTACCAAACATAAAACAGTGAAATGGAACTCATTTAGGAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAACGGGATTACCAAACATAAAACAGTGAAATGGAACTCATTTAGGAA  731

seq1  GTTAACTCAGGTGGCTTAGGCAATAAAAGAACTTGCCATACAAGCCTGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAACTCAGGTGGCTTAGGCAATAAAAGAACTTGCCATACAAGCCTGGT  781

seq1  AACACAAGTTCAAGACCTGGGGCCCCTGTAAAATCAGAAGGAGAGAACCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACAAGTTCAAGACCTGGGGCCCCTGTAAAATCAGAAGGAGAGAACCC  831

seq1  TAAAGTTGTCCTCTGATCTCCAAACAAAGCATAGCATACGTGTGCCCAAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGTTGTCCTCTGATCTCCAAACAAAGCATAGCATACGTGTGCCCAAG  881

seq1  CATGCGAACACACACACACACACACACACTGATAATAATTTTTAAAATTT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCGAACACACACACACACACACACACTGATAATAATTTTTAAAATTT  931

seq1  AATTCGAAGCTGGAGAGGTGGCTCATTGGTAAGGCATACCAAAAGCTCTT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCGAAGCTGGAGAGGTGGCTCATTGGTAAGGCATACCAAAAGCTCTT  981

seq1  GCTTGACTGTGCATGACAGTACATGCCATTAACCCTAGCTCTCAGGAGAA  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGACTGTGCATGACAGTACATGCCATTAACCCTAGCTCTCAGGAGAA  1031

seq1  GTAGAGGCAAACAGCTATCTGTTAATTTAAGGCCAGCCCAATCTACACAG  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAGGCAAACAGCTATCTGTTAATTTAAGGCCAGCCCAATCTACACAG  1081

seq1  TGAATTC  1107
      |||||||
seq2  TGAATTC  1088

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information