MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-180B01
Chromosome	11 (Build37)
Map Location	103,587,266 - 103,588,414
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Adam11, Gja7, Higd1b, Eftud2, Ccdc103, LOC100042500, Gfap, 3000004C01Rik, C1ql1, Dcakd, Nmt1, Plcd3, Acbd4, Hexim1, Hexim2, Fmnl1, 4933400C05Rik, Map3k14, Arhgap27, 5730442P18Rik, Plekhm1, Lrrc37a, Gm884, Lyzl6, Rprml, Gosr2
Downstream gene	Wnt9b, Wnt3, Nsf, EG667631, Arf2, LOC100042645, Crhr1, 4933407P14Rik, Mapt, 1700081L11Rik, Cdc27, Myl4, LOC666721, EG629959, Itgb3, LOC666739, LOC629960
Link	Open Mouse BAC browser

Click to get alignment info.

name	Adam11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11488 MGI:1098667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gja7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14615 MGI:95718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75689 MGI:1922939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eftud2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20624 MGI:1336880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73293 MGI:1920543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 3 Proteins

name	Gfap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14580 MGI:95697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3000004C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70218 MGI:1917468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1ql1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23829 MGI:1344400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcakd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68087 MGI:1915337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18107 MGI:102579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72469 MGI:107451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acbd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67131 MGI:1914381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hexim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192231 MGI:2385923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hexim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71059 MGI:1918309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57778 MGI:1888994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933400C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328019 MGI:3045340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53859 MGI:1858204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544817 MGI:1916903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730442P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70559 MGI:1917809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353047 MGI:2443207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc37a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237954 MGI:2685097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Gm884 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380730 MGI:2685730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyzl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69444 MGI:1916694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rprml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104582 MGI:2144486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gosr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56494 MGI:1927204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22412 MGI:1197020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22415 MGI:98955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18195 MGI:104560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667631 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667631 MGI:3644778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins

name	Arf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11841 MGI:99595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Crhr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12921 MGI:88498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933407P14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237958 MGI:3045264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mapt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17762 MGI:97180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700081L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76719 MGI:1923969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217232 MGI:102685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17896 MGI:97267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 210 ESTs, 2 Proteins pseudo : _no_value

name	EG629959 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629959 MGI:3645610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 47 ESTs, 2 Proteins

name	Itgb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16416 MGI:96612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC629960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Adam11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752959 GeneID:11488 MGI:1098667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 11 transcript_id : NM_009613.1

name	Gja7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365183 GeneID:14615 MGI:95718
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 7 transcript_id : NM_008122.2

name	Higd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252785 GeneID:75689 MGI:1922939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 1B transcript_id : NM_080846.1

name	Eftud2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475933 GeneID:20624 MGI:1336880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor Tu GTP binding domain containing 2 transcript_id : NM_011431.2

name	Ccdc103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802920 GeneID:73293 MGI:1920543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 103 transcript_id : NM_028492.2

name	LOC100042500 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262539 GeneID:100042500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 3 Proteins product : similar to Coiled-coil domain containing 103 transcript_id : XM_001479358.1

name	Gfap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84000447 GeneID:14580 MGI:95697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial fibrillary acidic protein transcript_id : NM_010277.2

name	3000004C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537559 GeneID:70218 MGI:1917468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3000004C01 gene transcript_id : NM_197959.1

name	C1ql1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753221 GeneID:23829 MGI:1344400
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent-like 1 transcript_id : NM_011795.1

name	Dcakd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370255 GeneID:68087 MGI:1915337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dephospho-CoA kinase domain containing transcript_id : NM_026551.3

name	Nmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130678 GeneID:18107 MGI:102579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-myristoyltransferase 1 transcript_id : NM_008707.3

name	Plcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89363031 GeneID:72469 MGI:107451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 3 transcript_id : NM_152813.2

name	Acbd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628666 GeneID:67131 MGI:1914381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 4 transcript_id : NM_025988.2

name	Acbd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628667 GeneID:67131 MGI:1914381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 4 transcript_id : NM_001081495.1

name	Hexim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301215 GeneID:192231 MGI:2385923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexamethylene bis-acetamide inducible 1 transcript_id : NM_138753.2

name	Hexim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625828 GeneID:71059 MGI:1918309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexamthylene bis-acetamide inducible 2 transcript_id : NM_027658.1

name	Fmnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136289 GeneID:57778 MGI:1888994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin-like 1 transcript_id : NM_019679.2

name	Fmnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136287 GeneID:57778 MGI:1888994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin-like 1 transcript_id : NM_001077698.1

name	4933400C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376242 GeneID:328019 MGI:3045340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933400C05 gene transcript_id : NM_177801.3

name	Map3k14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388182 GeneID:53859 MGI:1858204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 14 transcript_id : NM_016896.3

name	Arhgap27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378265 GeneID:544817 MGI:1916903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 27 transcript_id : NM_133715.3

name	5730442P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130869 GeneID:70559 MGI:1917809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730442P18 gene transcript_id : NM_183288.2

name	Plekhm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942119 GeneID:353047 MGI:2443207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family M (with RUN domain) member 1 transcript_id : NM_183034.1

name	Lrrc37a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262452 GeneID:237954 MGI:2685097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : leucine rich repeat containing 37A transcript_id : XM_137868.8

name	Gm884 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701938 GeneID:380730 MGI:2685730
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 884, (NCBI) transcript_id : NM_001033434.1

name	Lyzl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037160 GeneID:69444 MGI:1916694
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysozyme-like 6 transcript_id : NM_027083.1

name	Rprml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802486 GeneID:104582 MGI:2144486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reprimo-like transcript_id : NM_001033212.2

name	Gosr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24528552 GeneID:56494 MGI:1927204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi SNAP receptor complex member 2 transcript_id : NM_019650.2

name	Wnt9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801906 GeneID:22412 MGI:1197020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-type MMTV integration site 9B transcript_id : NM_011719.3

name	Wnt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678592 GeneID:22415 MGI:98955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 3 transcript_id : NM_009521.1

name	Nsf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354532 GeneID:18195 MGI:104560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-ethylmaleimide sensitive fusion protein transcript_id : NM_008740.3

name	EG667631 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262541 GeneID:667631 MGI:3644778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : predicted gene, EG667631 transcript_id : XM_001004030.2

name	Arf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363605 GeneID:11841 MGI:99595
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor 2 transcript_id : NM_007477.3

name	LOC100042645 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262542 GeneID:100042645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042645 transcript_id : XM_001479545.1

name	Crhr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367735 GeneID:12921 MGI:88498
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : corticotropin releasing hormone receptor 1 transcript_id : NM_007762.3

name	4933407P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722668 GeneID:237958 MGI:3045264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933407P14 gene transcript_id : NM_001082535.1

name	4933407P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723605 GeneID:237958 MGI:3045264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933407P14 gene transcript_id : NM_199019.2

name	Mapt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370346 GeneID:17762 MGI:97180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein tau transcript_id : NM_001038609.1

name	Mapt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370354 GeneID:17762 MGI:97180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein tau transcript_id : NM_010838.3

name	1700081L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486667 GeneID:76719 MGI:1923969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700081L11 gene transcript_id : NM_001081045.1

name	Cdc27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378021 GeneID:217232 MGI:102685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 27 homolog (S. cerevisiae) transcript_id : NM_145436.2

name	Myl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130182 GeneID:17896 MGI:97267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 4 transcript_id : NM_010858.4

name	EG629959 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262545 GeneID:629959 MGI:3645610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 47 ESTs, 2 Proteins product : predicted gene, EG629959 transcript_id : XM_894949.3

name	Itgb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949056 GeneID:16416 MGI:96612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 3 transcript_id : NM_016780.1

name	LOC629960 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262456 GeneID:629960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC629960 transcript_id : XM_906976.3

name	Adam11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752960 CCDS:CCDS25503.1 GeneID:11488 MGI:1098667
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : a disintegrin and metalloprotease domain (ADAM) 11 product : a disintegrin and metalloprotease domain 11 protein_id : NP_033743.1

name	Gja7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680007 CCDS:CCDS25504.1 GeneID:14615 MGI:95718
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0048738 - cardiac muscle development [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0048468 - cell development [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : connexin 45 product : gap junction membrane channel protein alpha 7 protein_id : NP_032148.1

name	Higd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252786 GeneID:75689 MGI:1922939
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : CLST 11240 protein protein_id : NP_543122.1

name	Eftud2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755594 GeneID:20624 MGI:1336880
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : U5 small nuclear ribonucleoprotein 116 kDa product : elongation factor Tu GTP binding domain containing 2 protein_id : NP_035561.1

name	Ccdc103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037317 CCDS:CCDS25506.1 GeneID:73293 MGI:1920543
definition	codon_start : 1 product : coiled-coil domain containing 103 protein_id : NP_082768.1

name	LOC100042500 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262540 GeneID:100042500
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479408.1

name	Gfap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000448 CCDS:CCDS25507.1 GeneID:14580 MGI:95697
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005882 - intermediate filament [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IMP] GO_process : GO:0045103 - intermediate filament-based process [Evidence IMP] codon_start : 1 note : intermediate filament protein product : glial fibrillary acidic protein protein_id : NP_034407.2

name	3000004C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537560 CCDS:CCDS25508.1 GeneID:70218 MGI:1917468
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70218 protein_id : NP_932063.1

name	C1ql1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753222 CCDS:CCDS25509.1 GeneID:23829 MGI:1344400
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : C1q related factor product : complement component 1, q subcomponent-like 1 protein_id : NP_035925.1

name	Dcakd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754054 CCDS:CCDS25510.1 GeneID:68087 MGI:1915337
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004140 - dephospho-CoA kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : dephospho-CoA kinase domain containing protein_id : NP_080827.2

name	Nmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679082 CCDS:CCDS25511.1 GeneID:18107 MGI:102579
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004379 - glycylpeptide N-tetradecanoyltransferase activity [Evidence IEA] [Evidence IMP] [Evidence ISS] [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0018008 - N-terminal peptidyl-glycine N-myristoylation [Evidence ISS]; GO:0006499 - N-terminal protein myristoylation [Evidence IMP] [Evidence IEA] codon_start : 1 product : N-myristoyltransferase 1 protein_id : NP_032733.1

name	Plcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779905 CCDS:CCDS25512.1 GeneID:72469 MGI:107451
definition	GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0001890 - placenta development [Evidence IGI] codon_start : 1 exception : mismatches in translation product : phospholipase C, delta 3 protein_id : NP_690026.1

name	Acbd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794460 GeneID:67131 MGI:1914381
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : acyl-Coenzyme A binding domain containing 4 isoform 1 protein_id : NP_080264.1

name	Acbd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628668 GeneID:67131 MGI:1914381
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : acyl-Coenzyme A binding domain containing 4 isoform 2 protein_id : NP_001074964.1

name	Hexim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270289 CCDS:CCDS25513.1 GeneID:192231 MGI:2385923
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0017069 - snRNA binding [Evidence ISS]; GO:0016566 - specific transcriptional repressor activity [Evidence IDA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : cardiac lineage protein 1 product : hexamethylene bis-acetamide inducible 1 protein_id : NP_620092.1

name	Hexim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625829 CCDS:CCDS25514.1 GeneID:71059 MGI:1918309
definition	codon_start : 1 product : hexamthylene bis-acetamide inducible 2 protein_id : NP_081934.1

name	Fmnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136288 GeneID:57778 MGI:1888994
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0016043 - cell organization and biogenesis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IMP]; GO:0006929 - substrate-bound cell migration [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lymphocyte specific formin related protein; formin-related gene in leukocytes; formin-like product : formin-like 1 isoform 2 protein_id : NP_001071166.1

name	Fmnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136290 GeneID:57778 MGI:1888994
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0016043 - cell organization and biogenesis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IMP]; GO:0006929 - substrate-bound cell migration [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lymphocyte specific formin related protein; formin-related gene in leukocytes; formin-like product : formin-like 1 isoform 1 protein_id : NP_062653.2

name	4933400C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244338 CCDS:CCDS25515.1 GeneID:328019 MGI:3045340
definition	codon_start : 1 product : hypothetical protein LOC328019 protein_id : NP_808469.1

name	Map3k14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393835 CCDS:CCDS25516.1 GeneID:53859 MGI:1858204
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : alymphoplasia; Nfkb inducing kinase; protein kinase; NF kappa B-inducing kinase product : mitogen-activated protein kinase kinase kinase 14 protein_id : NP_058592.1

name	Arhgap27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776555 CCDS:CCDS25517.1 GeneID:544817 MGI:1916903
definition	GO_component : GO:0005768 - endosome [Evidence ISS]; GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005096 - GTPase activator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0030675 - Rac GTPase activator activity [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0043089 - positive regulation of Cdc42 GTPase activity [Evidence ISS]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Rho GTPase activating protein 27 isoform 1 protein_id : NP_598476.2

name	5730442P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130870 GeneID:70559 MGI:1917809
definition	codon_start : 1 note : novel protein similar to Rho GTPase activating protein 12 (Arhgap12) product : hypothetical protein LOC70559 protein_id : NP_899111.2

name	Plekhm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942120 CCDS:CCDS25518.1 GeneID:353047 MGI:2443207
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : pleckstrin homology domain containing, family M (with RUN domain) member 1 protein_id : NP_898855.1

name	Lrrc37a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262453 GeneID:237954 MGI:2685097
definition	codon_start : 1 product : hypothetical protein protein_id : XP_137868.8

name	Gm884 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701939 GeneID:380730 MGI:2685730
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC380730 protein_id : NP_001028606.1

name	Lyzl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037161 CCDS:CCDS25519.1 GeneID:69444 MGI:1916694
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0003796 - lysozyme activity [Evidence IEA] GO_process : GO:0016998 - cell wall catabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : lysozyme-like protein 1; novel protein similar to lysozyme product : lysozyme-like 6 protein_id : NP_081359.1

name	Rprml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701722 CCDS:CCDS25520.1 GeneID:104582 MGI:2144486
definition	codon_start : 1 product : reprimo-like protein_id : NP_001028384.1

name	Gosr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24528553 CCDS:CCDS25521.1 GeneID:56494 MGI:1927204
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 note : golgi SNARE product : golgi SNAP receptor complex member 2 protein_id : NP_062624.2

name	Wnt9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543962 CCDS:CCDS25522.1 GeneID:22412 MGI:1197020
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : wingless-type MMTV integration site family, member 15; wingless-type MMTV integration site 15 product : wingless-type MMTV integration site 9B protein_id : NP_035849.2

name	Wnt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678593 CCDS:CCDS25523.1 GeneID:22415 MGI:98955
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless-related MMTV integration site 3 protein_id : NP_033547.1

name	Nsf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543349 CCDS:CCDS25524.1 GeneID:18195 MGI:104560
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004176 - ATP-dependent peptidase activity [Evidence IEA]; GO:0042623 - ATPase activity, coupled [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0019905 - syntaxin binding [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : N-ethylmaleimide sensitive factor product : N-ethylmaleimide sensitive fusion protein protein_id : NP_032766.2

name	EG667631 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390980 GeneID:667631 MGI:3644778
definition	codon_start : 1 product : similar to Zinc finger, CDGSH-type domain 1 protein_id : XP_001004030.1

name	Arf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671571 CCDS:CCDS25525.1 GeneID:11841 MGI:99595
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ADP-ribosylation factor 2 protein_id : NP_031503.1

name	LOC100042645 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262543 GeneID:100042645
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479595.1

name	Crhr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681013 CCDS:CCDS25526.1 GeneID:12921 MGI:88498
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015056 - corticotrophin-releasing factor receptor activity [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007610 - behavior [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006950 - response to stress [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CRF-R1alpha; CRF 1 receptor product : corticotropin releasing hormone receptor 1 protein_id : NP_031788.1

name	4933407P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722669 GeneID:237958 MGI:3045264
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0008717 - D-alanyl-D-alanine endopeptidase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; intramembrane protease 5; ortholog of human intramembrane protease 5 IMP5 product : intramembrane protease 5 isoform b protein_id : NP_001076004.1

name	4933407P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723606 GeneID:237958 MGI:3045264
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0008717 - D-alanyl-D-alanine endopeptidase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; intramembrane protease 5; ortholog of human intramembrane protease 5 IMP5 product : intramembrane protease 5 isoform a protein_id : NP_950184.2

name	Mapt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370347 CCDS:CCDS25527.1 GeneID:17762 MGI:97180
definition	GO_component : GO:0030424 - axon [Evidence ISS] [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence ISS]; GO:0030426 - growth cone [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence ISS] [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0045298 - tubulin [Evidence ISS] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence ISS] GO_process : GO:0048699 - generation of neurons [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence ISS]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence ISS] [Evidence IEA]; GO:0045773 - positive regulation of axon extension [Evidence ISS]; GO:0031116 - positive regulation of microtubule polymerization [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : microtubule-associated protein tau isoform a protein_id : NP_001033698.1

name	Mapt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370355 CCDS:CCDS25528.1 GeneID:17762 MGI:97180
definition	GO_component : GO:0030424 - axon [Evidence ISS] [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence ISS]; GO:0030426 - growth cone [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence ISS] [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0045298 - tubulin [Evidence ISS] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence ISS] GO_process : GO:0048699 - generation of neurons [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence ISS]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence ISS] [Evidence IEA]; GO:0045773 - positive regulation of axon extension [Evidence ISS]; GO:0031116 - positive regulation of microtubule polymerization [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : microtubule-associated protein tau isoform b protein_id : NP_034968.3

name	1700081L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486668 GeneID:76719 MGI:1923969
definition	codon_start : 1 product : hypothetical protein LOC76719 protein_id : NP_001074514.1

name	Cdc27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378022 GeneID:217232 MGI:102685
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007091 - mitotic metaphase/anaphase transition [Evidence ISS] codon_start : 1 product : cell division cycle 27 homolog protein_id : NP_663411.2

name	EG629959 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935391 GeneID:629959 MGI:3645610
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900042.1

name	Myl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981605 CCDS:CCDS25535.1 GeneID:17896 MGI:97267
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin light chain, alkali, cardiac atria; myosin, light polypeptide 4, alkali; atrial, embryonic product : myosin, light polypeptide 4 protein_id : NP_034988.2

name	Itgb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949057 CCDS:CCDS25536.1 GeneID:16416 MGI:96612
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005178 - integrin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007044 - cell-substrate junction assembly [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0030334 - regulation of cell migration [Evidence IMP] codon_start : 1 exception : mismatches in translation note : integrin beta 3 (Cd61); platelet glycoprotein IIIa (GP3A); integrin beta 3 subunit; platelet gpIIIa; beta3 integrin; beta subunit of alpha V/beta 3; integrin beta3 subunit product : integrin beta 3 protein_id : NP_058060.1

name	LOC629960 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262457 GeneID:629960
definition	codon_start : 1 product : hypothetical protein protein_id : XP_912069.3

name	LOC666739 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666739
definition	number : 2 pseudo : _no_value

name	LOC666739 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666739
definition	number : 1 pseudo : _no_value

name	LOC666721 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262544 GeneID:666721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 210 ESTs, 2 Proteins product : similar to High mobility group nucleosomal binding domain 1 pseudo : _no_value transcript_id : XR_034295.1

clone name	MSMg01-448P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308A02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-542N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-467M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-180B01.b	B6Ng01-180B01.g
ACC	GA006604	GA006605
length	1,017	1,143
definition	B6Ng01-180B01.b	B6Ng01-180B01.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaatactgaatggcagagaaccacctggaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccaccatacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaagctggtacaaccactctggaaatcagtctggtggttcctca gaaaattggacatagtactaccggaggatcccacaatacctctcctgggc atatatccagaagatgtttcaactggtgagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacccagat gtccctcagcagaggaatggatacagaaaatgtggtacatttacacaatg gagtactactcagctattaaaaagaatgaatttataaaattcctaagcaa atggatagacctggagggcatcatcctgagtgaggtaacccaatcacaaa ggaactctcacaatatgtactcactgataagtggatattagcccagaaac ttaggatacccaacatacaagatacaatttgctaaacgcatgaaactcaa gaagaatgaagactacagtgtggacacattgccccttcttagaattggga acaaaacacccatggaaagagttatatagacaaagtttggagctaagaca aaaggatggaccatctagagactgccatacccggggatccatcccataat cagcctccaaacgctgacaccattgcaaacactagcaagattttgctgaa aggacccagatatagctgtctcttgtgaggctatgccggggcctagcaaa cacagaagtggatgctcacagtcagctattggatggatcacagggccccc aatggaggagctagagaaagtacccaaggagctaaaggggtctgcaaccc tataggtggaacacaat	gaattcccagtgtgtaccattactacaccgtggtttcaggggattgaact caggtcctgtatgtgcacgataactactttcctgacggggccatctccca gtcttatttgtcctctcttgccttggcttgtggcaatatttttgcccagt agaggctgccacctgacccggctaaggagtaaaggtcgtgaggtgggaag gctcctcagggccaccagcaggcagcagagccagactgaaaacaggggtc cttccctcctctcatctccacatctcctcttgggtaagtagggcaggaat gcaccccttgctatgaattctgggtaaatgaggcctagtgtaaagtggtt atccaacccaggctgtccatcaaatcagaccaggccaaacatatgagcag aggcccccactctgcggcctgccacatggggagaatgcaagtagtcgaaa acaaagcggtagccttcaggaatctgggacctgaaatgaaaaacaaaaag aacagagatgcaataatggatggggccccttatggtttagctccagagtc ccattgcatcctgggggtctggaacaagggaggtagaagcagggagtggg ggcagagagttcttatctctgagctcagacacaccctgtgccctgtccca ggtcttcaggccccctagggttctcagggagggaggcagtcctgagggta gccatgtttctccctgtatccccatcctaacatgtttgaggccctgtgct cttgggcatggactccagctggttctgagctagcgacagaaggctccaca cacagtaagcaggctttagtttgtccagggctttatcatctgtttcgctt gagccccacctggtacatggcttcatccctcttcacagccaggagaaatg aggctggagtgggttaactgttccttctgccaagggactcaactttcatt gtcttcttgccctttctgccccatgttgccttctgcctcctcacccgact tgagactttcctgctccttacttcagagtccaaacccaggcctgggggct ctccattttcagactttggatccaaaagccgccattcttctaccgaacct aggaccaggctggtgactgactactgaaggaattcctacccag
quality values	Open. Hide. 41 29 25 26 58 58 58 31 18 54 58 58 58 36 41 46 31 35 39 62 47 62 62 28 62 54 62 62 62 47 46 62 11 13 8 7 10 8 11 10 9 15 18 10 13 13 59 62 59 59 62 62 59 56 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 59 59 62 62 54 62 18 14 13 18 25 23 23 28 36 40 27 25 25 40 41 62 62 54 32 42 54 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 49 32 54 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 62 62 51 59 56 28 37 29 38 38 43 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 52 54 58 58 49 46 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 54 58 58 58 52 58 58 58 58 58 54 58 58 58 58 58 58 52 54 58 58 54 54 58 58 58 54 58 58 49 58 58 58 58 58 54 58 51 51 51 51 58 45 41 58 58 48 58 53 58 53 58 58 58 52 50 54 46 58 54 58 58 58 58 54 50 58 58 46 58 54 42 58 58 58 58 58 49 58 53 53 51 51 58 58 42 58 42 43 58 58 58 50 46 32 51 52 51 50 51 54 58 53 58 49 47 50 50 58 41 58 41 51 58 38 12 41 44 49 53 53 58 42 40 58 50 37 50 47 58 49 58 43 50 32 58 58 40 43 50 49 54 41 41 42 49 54 52 54 54 52 54 34 47 52 41 47 52 53 39 46 51 53 39 54 51 45 45 54 46 54 25 54 35 49 49 37 46 37 42 28 17 54 49 44 31 51 33 27 54 47 39 21 39 40 53 53 53 40 33 49 33 28 25 39 53 16 28 30 53 33 29 39 54 23 49 49 46 17 18 32 40 26 53 24 40 40 31 45 35 41 32 32 28 32 43 49 36 31 29 16 46 40 32 37 41 51 42 32 19 21 41 33 25 41 33 29 26 24 51 32 27 28 37 34 29 31 30 24 46 33 29 16 37 46 45 35 31 43 30 31 47 44 14 29 18 7 37 12 15 27 29 23 21 31 26 38 34 37 32 32 31 31 31 31 37 43 31 31 29 11 28 21 32 28 37 32 33 29 17 46 46 46 31 31 23 25 23 25 26 46 42 38 29 32 27 32 39 39 21 25 30 32 27 22 31 32 32 33 25 31 21 24 17 31 23 31 26 27 19 31 26 17 21 6 9 22 19 23 35 27 32 25 11 5 37 12 7 28 28 28 19 8 12 8 13 25 10 8 16 25 21 35 29 33 21 29 14 29 44 25 20 25 19 31 44 33 9 12 14 9 17 15 18 31 25 37 8 33 47 47 19 10 13 21 24 32 15 21 26 43 28 32 23 16 16 14 26 22 16 25 24 30 10 28 28 12 24 32	Open. Hide. 62 49 37 41 62 62 62 47 44 62 62 24 16 18 13 13 16 12 16 19 16 23 18 16 19 24 17 49 62 62 54 54 54 62 62 62 59 49 62 62 59 62 54 49 62 62 62 62 62 62 62 59 62 62 62 59 51 39 33 23 28 38 34 27 27 23 34 22 23 34 37 59 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 54 62 59 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 62 62 62 38 37 34 46 38 49 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 49 58 54 58 42 58 52 58 54 54 45 42 58 58 54 58 58 58 52 45 58 58 58 54 54 58 58 58 58 58 58 49 58 58 54 54 58 58 58 54 58 52 52 58 54 58 58 58 41 58 54 58 54 58 58 52 54 58 49 58 49 32 51 58 58 58 58 58 58 51 58 58 58 35 44 47 54 54 53 58 51 58 58 58 58 51 58 52 58 32 58 51 46 50 46 58 35 50 58 50 51 58 43 54 58 39 41 49 58 49 29 58 52 51 58 52 50 34 58 51 49 51 58 53 37 20 49 32 58 58 58 43 40 53 39 58 54 39 49 40 52 52 50 39 49 58 24 19 58 43 40 28 49 41 53 50 50 58 58 29 33 36 19 49 58 50 53 35 40 53 33 49 54 40 54 51 52 35 27 54 54 53 51 35 49 40 45 54 54 54 39 53 37 54 35 40 40 52 39 53 51 30 54 35 39 41 21 30 22 54 51 44 49 33 37 35 33 41 21 30 37 54 46 36 42 32 35 26 25 31 42 37 54 40 26 52 52 42 53 42 28 40 52 31 32 19 52 35 35 32 53 31 30 34 23 32 38 25 15 25 30 53 33 46 29 32 32 32 28 52 32 25 31 51 36 31 42 31 24 51 29 33 51 43 33 12 26 46 27 45 33 30 40 30 37 40 51 26 30 51 33 18 32 31 16 19 30 22 42 17 47 26 30 28 31 43 31 42 33 23 31 46 40 28 22 19 17 27 28 28 15 31 30 24 31 36 33 20 41 41 37 35 43 29 46 31 29 24 31 32 28 28 36 32 34 37 31 15 18 12 12 10 36 46 32 31 30 23 10 27 24 31 31 32 25 16 20 16 38 17 26 22 26 38 31 32 20 21 12 31 31 16 25 30 17 13 13 19 6 11 26 5 7 6 18 27 19 13 14 13 15 44 32 21 27 8 18 30 22 30 14 32 18 31 12 11 13 24 17 15 43 20 13 27 24 34 36 48 24 31 21 32 9 12 13 17 15 19 16 14 9 9 4 5 14 33 16 13 9 7 14 32 25 9 20 13 27 18 15 28 20 27 6 19 34 18 14 22 16 26 11 14 9 26 9 11 27 24 13 18 7 6 7 30 13 10 4 4 11 28 31 7 33 10 22 18 11 22 23 15 20 20 40 27 15 2 5 21 23 10 18 5 17 28 28 16 21 16 5 15 5 5 13 16 6 4 9 2 6 22 8 18 28 17 9 15 11 13 5 13 5 17 7 7 17 17 6 10 7 12 5 14 7 9 5 13 20 11 11 3 4 6 14 2 3 3 3 3 4 4 3 2 2 2 1 3 1 1 3 3 3 8 5 4 3 5 9 13 13 12 11 16 15 16 13 17 17 21 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_103587266_103588414
seq2: B6Ng01-180B01.g_66_1208 (reverse)

seq1  CTGGGTAGGAATTCCTCTAGTGATTTCACTCAACAAGCCCTGGTCTCCTA  50
      ||||||||||||||||  |||    ||| ||| ||   |||||  |||||
seq2  CTGGGTAGGAATTCCTTCAGT--AGTCAGTCACCA--GCCTGG--TCCTA  44

seq1  -GTTCCGTAGAAAGAATGGCGGC-TTTGGATTCAAAGGTCTGAAAATGGA  98
       |||| |||| |||||||||||| ||||||| |||| |||||||||||||
seq2  GGTTCGGTAG-AAGAATGGCGGCTTTTGGATCCAAA-GTCTGAAAATGGA  92

seq1  GAGCCCCCAGGGCCTGGTTTGGACTCTGAAGT-AGGAGCAGGAAAGTCTC  147
      ||||||||||| |  ||||||||||||||||| |||||||||||||||||
seq2  GAGCCCCCAGGCCTGGGTTTGGACTCTGAAGTAAGGAGCAGGAAAGTCTC  142

seq1  AAGTCGGGTGAGGAGGCAGAAGGCAACATGGGGCAGAAAGGGCAAAGAAG  197
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  AAGTCGGGTGAGGAGGCAGAAGGCAACATGGGGCAGAAAGGGC-AAGAAG  191

seq1  ACAATGAAAGTTGAGTCACCTTGGCAGAAGGAACAGTTAA-CCACTCCAG  246
      ||||||||||||||||| |||||||||||||||||||||| |||||||||
seq2  ACAATGAAAGTTGAGTC-CCTTGGCAGAAGGAACAGTTAACCCACTCCAG  240

seq1  CCTCATTTCTCCTGGCTGTGAAGAGGGATGAAGCCATGTACCAGGTGGGG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCATTTCTCCTGGCTGTGAAGAGGGATGAAGCCATGTACCAGGTGGGG  290

seq1  CTCAAGCGAAACAGATGATAAAGCCCTGGACAAACTAAAGCCTGCTTACT  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAGCGAAACAGATGATAAAGCCCTGGACAAACTAAAGCCTGCTTACT  340

seq1  GTGTGTGGAGCCTTCTGTCGCTAGCTCAGAACCAGCTGGAGTCCATGCCC  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGGAGCCTTCTGTCGCTAGCTCAGAACCAGCTGGAGTCCATGCCC  390

seq1  AAGAGCACAGGGCCTCAAACATGTTAGGATGGGGATACAGGGAGAAACAT  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCACAGGGCCTCAAACATGTTAGGATGGGGATACAGGGAGAAACAT  440

seq1  GGCTACCCTCAGGACTGCCTCCCTCCCTGAGAACCCTAGGGGGCCTGAAG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTACCCTCAGGACTGCCTCCCTCCCTGAGAACCCTAGGGGGCCTGAAG  490

seq1  ACCTGGGACAGGGCACAGGGTGTGTCTGAGCTCAGAGATAAGAACTCTCT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGGGACAGGGCACAGGGTGTGTCTGAGCTCAGAGATAAGAACTCTCT  540

seq1  GCCCCCACTCCCTGCTTCTACCTCCCTTGTTCCAGACCCCCAGGATGCAA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCCACTCCCTGCTTCTACCTCCCTTGTTCCAGACCCCCAGGATGCAA  590

seq1  TGGGACTCTGGAGCTAAACCATAAGGGGCCCCATCCATTATTGCATCTCT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGACTCTGGAGCTAAACCATAAGGGGCCCCATCCATTATTGCATCTCT  640

seq1  GTTCTTTTTGTTTTTCATTTCAGGTCCCAGATTCCTGAAGGCTACCGCTT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTTTTTGTTTTTCATTTCAGGTCCCAGATTCCTGAAGGCTACCGCTT  690

seq1  TGTTTTCGACTACTTGCATTCTCCCCATGTGGCAGGCCGCAGAGTGGGGG  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTCGACTACTTGCATTCTCCCCATGTGGCAGGCCGCAGAGTGGGGG  740

seq1  CCTCTGCTCATATGTTTGGCCTGGTCTGATTTGATGGACAGCCTGGGTTG  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGCTCATATGTTTGGCCTGGTCTGATTTGATGGACAGCCTGGGTTG  790

seq1  GATAACCACTTTACACTAGGCCTCATTTACCCAGAATTCATAGCAAGGGG  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAACCACTTTACACTAGGCCTCATTTACCCAGAATTCATAGCAAGGGG  840

seq1  TGCATTCCTGCCCTACTTACCCAAGAGGAGATGTGGAGATGAGAGGAGGG  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATTCCTGCCCTACTTACCCAAGAGGAGATGTGGAGATGAGAGGAGGG  890

seq1  AAGGACCCCTGTTTTCAGTCTGGCTCTGCTGCCTGCTGGTGGCCCTGAGG  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGACCCCTGTTTTCAGTCTGGCTCTGCTGCCTGCTGGTGGCCCTGAGG  940

seq1  AGCCTTCCCACCTCACGACCTTTACTCCTTAGCCGGGTCAGGTGGCAGCC  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTTCCCACCTCACGACCTTTACTCCTTAGCCGGGTCAGGTGGCAGCC  990

seq1  TCTACTGGGCAAAAATATTGCCACAAGCCAAGGCAAGAGAGGACAAATAA  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACTGGGCAAAAATATTGCCACAAGCCAAGGCAAGAGAGGACAAATAA  1040

seq1  GACTGGGAGATGGCCCCGTCAGGAAAGTAGTTATCGTGCACATACAGGAC  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGGGAGATGGCCCCGTCAGGAAAGTAGTTATCGTGCACATACAGGAC  1090

seq1  CTGAGTTCAATCCCCTGAAACCACGGTGTAGTAATGGTACACACTGGGAA  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGTTCAATCCCCTGAAACCACGGTGTAGTAATGGTACACACTGGGAA  1140

seq1  TTC  1149
      |||
seq2  TTC  1143

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information