MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-193K19
Chromosome	11 (Build37)
Map Location	49,598,963 - 49,763,730
singlet/doublet	doublet
Overlap gene	Gfpt2, Mapk9, Rasgef1c
Upstream gene	Gnb2l1, Trim41, LOC100039945, Trim7, Irgm, EG432555, OTTMUSG00000005523, Psme2b-ps, LOC667214, Tgtp, LOC667219, 9930111J21Rik, Olfr56, LOC100039796, Ifi47, Olfr1396, Olfr1395, Olfr1394, Btnl9, Zfp62, Mgat1, Olfr1393, Olfr1392, Olfr10, Olfr1391, Olfr1390, LOC667286, Olfr1389, Olfr1388, Olfr1387, Olfr1386, Olfr1385, Olfr1549-ps1, Olfr1384, Olfr1383, Olfr1382, GA_x5J8B7TT7LR-4113-3651, Olfr1381, Olfr1380, Flt4, LOC100040032, Scgb3a1, Cnot6, LOC666899, LOC100040073
Downstream gene	Rnf130, LOC380696, Tbc1d9b, 3010026O09Rik, Sqstm1, Mgat4b, Ltc4s, Maml1, Canx, 1700121K02Rik, Hnrph1, Rufy1, Adamts2, Zfp354c, 9630041N07Rik, Grm6, Zfp454, Zfp2, Zfp354b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gnb2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14694 MGI:101849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211007 MGI:2384814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 226 ESTs, 4 Proteins

name	Trim7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94089 MGI:2137353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irgm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15944 MGI:107567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432555 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432555 MGI:3645205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000005523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620913 MGI:3652173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psme2b-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621823 MGI:1341073
definition	gene_synonym : PA28b-p; PA28b2; Psme2-like; Psme2b note : protease (prosome, macropain) 28 subunit beta B, pseudogene pseudo : _no_value

name	LOC667214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 26 Proteins

name	Tgtp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21822 MGI:98734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667219
definition	gene_synonym : Pcbp2-rs note : poly(rC) binding protein 2 pseudogene pseudo : _no_value

name	9930111J21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245240 MGI:3041173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18356 MGI:1333785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039796 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 278 ESTs, 23 Proteins pseudo : _no_value

name	Ifi47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15953 MGI:99448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258334 MGI:3031230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258877 MGI:3031229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258273 MGI:3031228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btnl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237754 MGI:2442439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22720 MGI:99662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mgat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17308 MGI:96973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1393 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258463 MGI:3031227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1392 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258462 MGI:3031226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18307 MGI:107598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258460 MGI:3031225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1390 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259068 MGI:3031224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr1389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259069 MGI:3031223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1388 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258459 MGI:3031222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1387 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258465 MGI:3031221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257888 MGI:3031220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258027 MGI:3031219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1549-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257977 MGI:3031383
definition	gene_synonym : MOR256-42P note : olfactory receptor 1549, pseudogene 1 pseudo : _no_value

name	Olfr1384 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258464 MGI:3031218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1383 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404337 MGI:3031217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257971 MGI:3031216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TT7LR-4113-3651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257864
definition	note : olfactory receptor GA_x5J8B7TT7LR-4113-3651 pseudo : _no_value

name	Olfr1381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258461 MGI:3031215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404336 MGI:3031214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14257 MGI:95561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Scgb3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68662 MGI:1915912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cnot6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104625 MGI:2144529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 649 ESTs, 6 Proteins

name	LOC100040073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gfpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14584 MGI:1338883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26420 MGI:1346862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rasgef1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74563 MGI:1921813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59044 MGI:1891717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC380696 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380696
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	Tbc1d9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76795 MGI:1924045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3010026O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68067 MGI:1915317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sqstm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18412 MGI:107931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103534 MGI:2143974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltc4s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17001 MGI:107498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103806 MGI:1890504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Canx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12330 MGI:88261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700121K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76653 MGI:1923903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	Hnrph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59013 MGI:1891925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rufy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216724 MGI:2429762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamts2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216725 MGI:1347356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp354c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30944 MGI:1353621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630041N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214779 MGI:3053099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108072 MGI:1351343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237758 MGI:2679253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22678 MGI:99167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Zfp354b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27274 MGI:1351476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnb2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376464 GeneID:14694 MGI:101849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 transcript_id : NM_008143.3

name	Trim41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358935 GeneID:211007 MGI:2384814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 41 transcript_id : NM_145377.2

name	LOC100039945 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261871 GeneID:100039945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 226 ESTs, 4 Proteins product : similar to putative oral cancer suppressor transcript_id : XM_001474176.1

name	Trim7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716452 GeneID:94089 MGI:2137353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 7 transcript_id : NM_053166.1

name	Irgm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680350 GeneID:15944 MGI:107567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunity-related GTPase family, M transcript_id : NM_008326.1

name	EG432555 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608096 GeneID:432555 MGI:3645205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432555 transcript_id : NM_001024230.1

name	OTTMUSG00000005523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865922 GeneID:620913 MGI:3652173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000005523 transcript_id : NM_001045540.1

name	LOC667214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261873 GeneID:667214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 26 Proteins product : similar to immunity-related GTPase family, cinema 1 transcript_id : XM_989063.2

name	Tgtp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543860 GeneID:21822 MGI:98734
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell specific GTPase transcript_id : NM_011579.2

name	9930111J21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734111 GeneID:245240 MGI:3041173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930111J21 gene transcript_id : NM_173434.1

name	Olfr56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803453 GeneID:18356 MGI:1333785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 56 transcript_id : NM_010999.2

name	Ifi47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680358 GeneID:15953 MGI:99448
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon gamma inducible protein 47 transcript_id : NM_008330.1

name	Olfr1396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129627 GeneID:258334 MGI:3031230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1396 transcript_id : NM_146337.1

name	Olfr1395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129124 GeneID:258877 MGI:3031229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1395 transcript_id : NM_146877.1

name	Olfr1394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129734 GeneID:258273 MGI:3031228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1394 transcript_id : NM_146276.1

name	Btnl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374929 GeneID:237754 MGI:2442439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin-like 9 transcript_id : NM_172793.2

name	Zfp62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67763827 GeneID:22720 MGI:99662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 62 transcript_id : NM_001024846.1

name	Zfp62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67763829 GeneID:22720 MGI:99662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 62 transcript_id : NM_009562.2

name	Mgat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981619 GeneID:17308 MGI:96973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 1 transcript_id : NM_010794.2

name	Olfr1393 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238935 GeneID:258463 MGI:3031227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1393 transcript_id : NM_146471.1

name	Olfr1392 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203770 GeneID:258462 MGI:3031226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1392 transcript_id : NM_146470.1

name	Olfr10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45592945 GeneID:18307 MGI:107598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 10 transcript_id : NM_206822.1

name	Olfr1391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238937 GeneID:258460 MGI:3031225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1391 transcript_id : NM_146468.1

name	Olfr1390 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227394 GeneID:259068 MGI:3031224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1390 transcript_id : NM_147065.1

name	Olfr1389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128828 GeneID:259069 MGI:3031223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1389 transcript_id : NM_147066.1

name	Olfr1388 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238931 GeneID:258459 MGI:3031222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1388 transcript_id : NM_146467.1

name	Olfr1387 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238939 GeneID:258465 MGI:3031221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1387 transcript_id : NM_146473.1

name	Olfr1386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801275 GeneID:257888 MGI:3031220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1386 transcript_id : NM_001011741.1

name	Olfr1385 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801375 GeneID:258027 MGI:3031219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1385 transcript_id : NM_001011805.1

name	Olfr1384 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238941 GeneID:258464 MGI:3031218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1384 transcript_id : NM_146472.1

name	Olfr1383 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430595 GeneID:404337 MGI:3031217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1383 transcript_id : NM_207574.1

name	Olfr1382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801345 GeneID:257971 MGI:3031216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1382 transcript_id : NM_001011790.1

name	Olfr1381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170045 GeneID:258461 MGI:3031215
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1381 transcript_id : NM_146469.1

name	Olfr1380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430601 GeneID:404336 MGI:3031214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1380 transcript_id : NM_207573.1

name	Flt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801963 GeneID:14257 MGI:95561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 4 transcript_id : NM_008029.2

name	Scgb3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25014111 GeneID:68662 MGI:1915912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 3A, member 1 transcript_id : NM_170727.1

name	Scgb3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905068 GeneID:68662 MGI:1915912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 3A, member 1 transcript_id : NM_054037.1

name	Cnot6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059014 GeneID:104625 MGI:2144529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 6 transcript_id : NM_212484.1

name	LOC666899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390048 GeneID:666899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 649 ESTs, 6 Proteins product : similar to ribosomal protein L30 transcript_id : XM_001000091.1

name	Gfpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386698 GeneID:14584 MGI:1338883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 2 transcript_id : NM_013529.2

name	Mapk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592768 GeneID:26420 MGI:1346862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 9 transcript_id : NM_016961.2

name	Mapk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592832 GeneID:26420 MGI:1346862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 9 transcript_id : NM_207692.1

name	Rasgef1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73088861 GeneID:74563 MGI:1921813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RasGEF domain family, member 1C transcript_id : NM_029004.1

name	Rnf130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892292 GeneID:59044 MGI:1891717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 130 transcript_id : NM_021540.3

name	Tbc1d9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358939 GeneID:76795 MGI:1924045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 9B transcript_id : NM_029745.2

name	3010026O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350731 GeneID:68067 MGI:1915317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3010026O09 gene transcript_id : NM_026543.2

name	Sqstm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130186 GeneID:18412 MGI:107931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sequestosome 1 transcript_id : NM_011018.2

name	Mgat4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239191 GeneID:103534 MGI:2143974
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 4, isoenzyme B transcript_id : NM_145926.2

name	Ltc4s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678733 GeneID:17001 MGI:107498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukotriene C4 synthase transcript_id : NM_008521.1

name	Maml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341628 GeneID:103806 MGI:1890504
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mastermind like 1 (Drosophila) transcript_id : NM_175334.2

name	Canx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542338 GeneID:12330 MGI:88261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calnexin transcript_id : NM_007597.2

name	1700121K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261874 GeneID:76653 MGI:1923903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : RIKEN cDNA 1700121K02 gene transcript_id : XM_484016.4

name	Hnrph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628660 GeneID:59013 MGI:1891925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein H1 transcript_id : NM_021510.2

name	Rufy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388074 GeneID:216724 MGI:2429762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 1 transcript_id : NM_172557.2

name	Adamts2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130291 GeneID:216725 MGI:1347356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 transcript_id : NM_175643.2

name	Zfp354c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681198 GeneID:30944 MGI:1353621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354C transcript_id : NM_013922.4

name	9630041N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802593 GeneID:214779 MGI:3053099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630041N07 gene transcript_id : NM_173387.2

name	Grm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734061 GeneID:108072 MGI:1351343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, metabotropic 6 transcript_id : NM_173372.1

name	Zfp454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982551 GeneID:237758 MGI:2679253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 454 transcript_id : NM_172794.2

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374187 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044700.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374179 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044699.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374177 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044698.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374175 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044697.1

name	Zfp354b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475952 GeneID:27274 MGI:1351476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354B transcript_id : NM_013744.2

name	Gnb2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680047 CCDS:CCDS24585.1 GeneID:14694 MGI:101849
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005080 - protein kinase C binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0007205 - protein kinase C activation [Evidence ISS]; GO:0008104 - protein localization [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 note : guanine nucleotide binding protein, beta-2, related sequence 1; guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1; guanine nucleotide binding protein, beta 2, related sequence 1; activated protein kinase C receptor; guanine nucleotide binding protein related product : guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 protein_id : NP_032169.1

name	Trim41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358936 GeneID:211007 MGI:2384814
definition	codon_start : 1 product : tripartite motif-containing 41 protein_id : NP_663352.2

name	LOC100039945 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261872 GeneID:100039945
definition	codon_start : 1 product : similar to putative oral cancer suppressor protein_id : XP_001474226.1

name	Trim7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716453 GeneID:94089 MGI:2137353
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tripartite motif protein 7 protein_id : NP_444396.1

name	Irgm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680351 CCDS:CCDS24588.1 GeneID:15944 MGI:107567
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS] GO_process : GO:0006952 - defense response [Evidence IMP] codon_start : 1 function : interferon response gene product : interferon inducible protein 1 protein_id : NP_032352.1

name	EG432555 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608097 GeneID:432555 MGI:3645205
definition	codon_start : 1 product : hypothetical protein LOC432555 protein_id : NP_001019401.1

name	OTTMUSG00000005523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865923 GeneID:620913 MGI:3652173
definition	codon_start : 1 product : hypothetical protein LOC620913 protein_id : NP_001039005.1

name	LOC667214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390070 GeneID:667214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994157.1

name	Tgtp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543861 CCDS:CCDS24593.1 GeneID:21822 MGI:98734
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence NAS] GO_function : GO:0005525 - GTP binding [Evidence ISS]; GO:0003924 - GTPase activity [Evidence IDA] GO_process : GO:0006955 - immune response [Evidence NAS]; GO:0009615 - response to virus [Evidence IDA] codon_start : 1 exception : mismatches in translation product : T-cell specific GTPase protein_id : NP_035709.2

name	9930111J21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734112 GeneID:245240 MGI:3041173
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245240 protein_id : NP_775610.1

name	Ifi47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680359 CCDS:CCDS24595.1 GeneID:15953 MGI:99448
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS] GO_process : GO:0006952 - defense response [Evidence IMP] codon_start : 1 note : interferon gamma inducible protein, 47 kDa product : interferon gamma inducible protein 47 protein_id : NP_032356.1

name	Olfr1396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129628 CCDS:CCDS24596.1 GeneID:258334 MGI:3031230
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6321048-6321995; olfactory receptor MOR276-2 product : olfactory receptor 1396 protein_id : NP_666449.1

name	Olfr56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468919 CCDS:CCDS24597.1 GeneID:18356 MGI:1333785
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6300500-6299553; olfactory receptor MOR276-1 product : olfactory receptor 56 protein_id : NP_035129.1

name	Olfr1395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129125 CCDS:CCDS24598.1 GeneID:258877 MGI:3031229
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6286247-6285294; olfactory receptor MOR277-1 product : olfactory receptor 1395 protein_id : NP_667088.1

name	Olfr1394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129735 CCDS:CCDS24599.1 GeneID:258273 MGI:3031228
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6274566-6273628; olfactory receptor MOR280-1 product : olfactory receptor 1394 protein_id : NP_666388.1

name	Btnl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370182 CCDS:CCDS24600.1 GeneID:237754 MGI:2442439
definition	codon_start : 1 product : butyrophilin 3 protein_id : NP_766381.1

name	Zfp62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67763830 GeneID:22720 MGI:99662
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 62 isoform 1 protein_id : NP_033588.2

name	Zfp62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67763828 CCDS:CCDS24601.1 GeneID:22720 MGI:99662
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 62 isoform 2 protein_id : NP_001020017.1

name	Mgat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981620 CCDS:CCDS24602.1 GeneID:17308 MGI:96973
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003827 - alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mannoside acetylglucosaminyl transferase 1 product : mannoside acetylglucosaminyltransferase 1 protein_id : NP_034924.2

name	Olfr1393 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238936 CCDS:CCDS24603.1 GeneID:258463 MGI:3031227
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6154577-6153642; MOR256-67_i; olfactory receptor MOR256-24 product : olfactory receptor 1393 protein_id : NP_666682.1

name	Olfr1392 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203771 CCDS:CCDS24604.1 GeneID:258462 MGI:3031226
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6141322-6140387; olfactory receptor MOR256-25 product : olfactory receptor 1392 protein_id : NP_666681.1

name	Olfr10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592946 CCDS:CCDS24605.1 GeneID:18307 MGI:107598
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : olfactory receptor 10 protein_id : NP_996558.1

name	Olfr1391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238938 CCDS:CCDS24606.1 GeneID:258460 MGI:3031225
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6107233-6106298; olfactory receptor MOR256-27 product : olfactory receptor 1391 protein_id : NP_666679.1

name	Olfr1390 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227395 CCDS:CCDS24607.1 GeneID:259068 MGI:3031224
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6094111-6093176; olfactory receptor MOR256-2 product : olfactory receptor 1390 protein_id : NP_667276.1

name	Olfr1389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128829 CCDS:CCDS24608.1 GeneID:259069 MGI:3031223
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-6004387-6003452; olfactory receptor MOR256-1 product : olfactory receptor 1389 protein_id : NP_667277.1

name	Olfr1388 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238932 CCDS:CCDS24609.1 GeneID:258459 MGI:3031222
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5991012-5990077; olfactory receptor MOR256-28 product : olfactory receptor 1388 protein_id : NP_666678.1

name	Olfr1387 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238940 CCDS:CCDS24610.1 GeneID:258465 MGI:3031221
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5975166-5974231; olfactory receptor MOR256-22 product : olfactory receptor 1387 protein_id : NP_666684.1

name	Olfr1386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801276 CCDS:CCDS24611.1 GeneID:257888 MGI:3031220
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5964781-5963852; olfactory receptor MOR256-50 product : olfactory receptor 1386 protein_id : NP_001011741.1

name	Olfr1385 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801376 CCDS:CCDS24612.1 GeneID:258027 MGI:3031219
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5941817-5940888; olfactory receptor MOR256-41P product : olfactory receptor 1385 protein_id : NP_001011805.1

name	Olfr1384 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238942 CCDS:CCDS24613.1 GeneID:258464 MGI:3031218
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5922712-5921756; olfactory receptor MOR256-23 product : olfactory receptor 1384 protein_id : NP_666683.1

name	Olfr1383 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430596 CCDS:CCDS24614.1 GeneID:404337 MGI:3031217
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5912627-5911692; odorant receptor; olfactory receptor GA_x5J8B7W6B6J-2556603-2556836 product : olfactory receptor 1383 protein_id : NP_997457.1

name	Olfr1382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801346 CCDS:CCDS24615.1 GeneID:257971 MGI:3031216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-5901165-5900230; olfactory receptor MOR256-43P product : olfactory receptor 1382 protein_id : NP_001011790.1

name	Olfr1381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170046 CCDS:CCDS24616.1 GeneID:258461 MGI:3031215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QP88-5884501-5883566; olfactory receptor MOR256-26 product : olfactory receptor 1381 protein_id : NP_666680.1

name	Olfr1380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430602 CCDS:CCDS24617.1 GeneID:404336 MGI:3031214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MOR256-66_i; GA_x6K02T2QP88-5871967-5871032 product : olfactory receptor 1380 protein_id : NP_997456.1

name	Flt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679813 CCDS:CCDS24618.1 GeneID:14257 MGI:95561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : vascular endothelial growth factor receptor-3; chylous ascites; receptor protein tyrosine kinase product : FMS-like tyrosine kinase 4 protein_id : NP_032055.1

name	Scgb3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905069 CCDS:CCDS24619.1 GeneID:68662 MGI:1915912
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : type A is encoded by transcript variant A; pneumo secretory protein 2; uteroglobin related protein 2; family 3A member 1 secretoglobin product : secretoglobin, family 3A, member 1 type A protein_id : NP_473378.1

name	Scgb3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25014112 GeneID:68662 MGI:1915912
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : type B is encoded by transcript variant B; pneumo secretory protein 2; uteroglobin related protein 2; family 3A member 1 secretoglobin product : secretoglobin, family 3A, member 1 type B protein_id : NP_733923.1

name	Cnot6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059015 CCDS:CCDS24621.1 GeneID:104625 MGI:2144529
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCR4-NOT transcription complex, subunit 6 protein_id : NP_997649.1

name	LOC666899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390049 GeneID:666899
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_001000091.1

name	Gfpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305087 CCDS:CCDS24622.1 GeneID:14584 MGI:1338883
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence TAS]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutamine fructose-6-phosphate transaminase 2 protein_id : NP_038557.1

name	Mapk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592833 CCDS:CCDS24623.1 GeneID:26420 MGI:1346862
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; protein kinase, mitogen-activated 9; Jun kinase; JNK/SAPK alpha product : mitogen activated protein kinase 9 isoform a protein_id : NP_997575.1

name	Mapk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393749 CCDS:CCDS24624.1 GeneID:26420 MGI:1346862
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protein kinase, mitogen-activated 9; Jun kinase; JNK/SAPK alpha product : mitogen activated protein kinase 9 isoform b protein_id : NP_058657.1

name	Rasgef1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73088862 CCDS:CCDS24625.1 GeneID:74563 MGI:1921813
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : RasGEF domain family, member 1C protein_id : NP_083280.1

name	Rnf130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981195 CCDS:CCDS24626.1 GeneID:59044 MGI:1891717
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : g1-related zinc finger protein product : ring finger protein 130 protein_id : NP_067515.2

name	Tbc1d9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358940 GeneID:76795 MGI:1924045
definition	codon_start : 1 product : TBC1 domain family, member 9B protein_id : NP_084021.2

name	3010026O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386048 GeneID:68067 MGI:1915317
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68067 protein_id : NP_080819.1

name	Sqstm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754954 CCDS:CCDS24629.1 GeneID:18412 MGI:107931
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0003712 - transcription cofactor activity [Evidence TAS]; GO:0043130 - ubiquitin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016197 - endosome transport [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0008104 - protein localization [Evidence ISS]; GO:0043122 - regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 note : oxidative stress induced product : sequestosome 1 protein_id : NP_035148.1

name	Mgat4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239192 CCDS:CCDS24630.1 GeneID:103534 MGI:2143974
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B product : N-acetylglucosaminyltransferase IVb protein_id : NP_666038.2

name	Ltc4s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678734 CCDS:CCDS24631.1 GeneID:17001 MGI:107498
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IEA]; GO:0004464 - leukotriene-C4 synthase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : leukotriene C4 synthase protein_id : NP_032547.1

name	Maml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425022 CCDS:CCDS24632.1 GeneID:103806 MGI:1890504
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence IDA] GO_process : GO:0007219 - Notch signaling pathway [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mastermind like 1 protein_id : NP_780543.1

name	Canx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671664 CCDS:CCDS24633.1 GeneID:12330 MGI:88261
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : calnexin protein_id : NP_031623.1

name	1700121K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261875 GeneID:76653 MGI:1923903
definition	codon_start : 1 product : hypothetical protein LOC76653 protein_id : XP_484016.3

name	Hnrph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946928 CCDS:CCDS24634.1 GeneID:59013 MGI:1891925
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein H1 protein_id : NP_067485.1

name	Rufy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369788 CCDS:CCDS24635.1 GeneID:216724 MGI:2429762
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IDA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : FYVE-finger containing protein; Rab4a interacting protein product : RUN and FYVE domain containing 1 protein_id : NP_766145.1

name	Adamts2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563307 CCDS:CCDS24636.1 GeneID:216725 MGI:1347356
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0017074 - procollagen N-endopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0051605 - proteolysis during protein maturation [Evidence IMP]; GO:0043588 - skin development [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : procollagen N-proteinase; a disintegrin and metalloproteinase with thrombospondin repeats product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2 protein_id : NP_783574.1

name	Zfp354c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592078 CCDS:CCDS24637.1 GeneID:30944 MGI:1353621
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : transcription factor 17-like 2 product : zinc finger protein 354C protein_id : NP_038950.3

name	9630041N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734192 CCDS:CCDS24638.1 GeneID:214779 MGI:3053099
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : novel zinc finger protein product : hypothetical protein LOC214779 protein_id : NP_775563.1

name	Grm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734062 GeneID:108072 MGI:1351343
definition	GO_function : GO:0001642 - group III metabotropic glutamate receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : G protein-coupled receptor, family C, group 1, member F; G protein-coupled receptor GRM6; metabotropic glutamate receptor 6 product : glutamate receptor, metabotropic 6 protein_id : NP_775548.1

name	Zfp454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982552 CCDS:CCDS24639.1 GeneID:237758 MGI:2679253
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 454 protein_id : NP_766382.2

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374176 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038162.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374178 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038163.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374180 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038164.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374188 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038165.1

name	Zfp354b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305545 CCDS:CCDS24641.1 GeneID:27274 MGI:1351476
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : transcription factor 17-like 1 product : zinc finger protein 354B protein_id : NP_038772.1

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 1 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 2 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 3 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 4 pseudo : _no_value

name	LOC667286 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667286
definition	number : 5 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 1 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 2 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 3 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 4 pseudo : _no_value

name	LOC100040073 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040073
definition	number : 1 pseudo : _no_value

name	LOC100039796 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261867 GeneID:100039796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 278 ESTs, 23 Proteins product : hypothetical protein LOC100039796 pseudo : _no_value transcript_id : XR_031267.1

clone name	MSMg01-415K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-297G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-373P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-488G03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-072K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275E15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-424O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-193K19.b	B6Ng01-193K19.g
ACC	GA016579	GA016580
length	952	820
definition	B6Ng01-193K19.b	B6Ng01-193K19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(49,598,963 - 49,599,906)	(49,762,913 - 49,763,730)
sequence	gaattccttcctggcttagaagcttcagttagaaggtaaactcggatata ctcttttgagctcccactctctctaaagcttttctgcccctttctccctc cctctcctgtacataggtttctgtatatgcttgctcagagcgtcccagcg tggtaaatgggatgagtttctctcttcccccttgctgtcactcaggaaag acgcagtgtggagaatatttgtgagataaactaatgacctctaggtgtga ggcttcctttgcttctgcagagtttctgtttgggaattttgtttgtttag ttggtttttttcttttttgttttgtttgtttgttgtttgtttgtttgttt gtttctgagacaactgaaacagttggggtggaatgagctcaggcagtacc agataatggagagaaggggggaataaaagaccgtcaccagctgtccttgt ctgtaaagttactacaacaaaacaccacaggaggcttacaatcagtagaa tctagtttttcaacgttctggagatgaggaagtccaaaaatcaaggcact ggcagattctgtgtctggatcatttggctctttgtatggatgtcttcaca tggaggaaggggagaggcagcttttgggatctcttttttggctttcattt taaaagacatagtcttatgtgactctggctggcctcgaactctctacata gaccaggttggctttgaactcatagagcactctgtctaccaaagtgctgg aatttaaatgcagatgctgccatgttcatccttgggatctctttctctgt ggatagcactcctttatcatctttcttcctgacctggccatgaagcttcc tatcaccattggctatactaccgggacgcttgacattcagattagagaag agcatggtcccctgggccttggccacaggttgatggggactacacacctt gg	gaattcacctgactttatccacagggggctggtgacagcactggctggga gactggtgacagcactggctgggagactggggacagcactggctgggaga ctggggacagcactggctgggagagggatgctaagctgtcttatctgggg ctccagatggccccctgctcccgctgacagaccctgctgcttccacactt ctagaagcagtgggtttggagagctcggggcacttgcaggcaatctgttg ttgcaagtggagagaaaaagcctcacagtagattggtagctgaaaataga gttctccaaagagggatgagtcggcttctccccgctccgttatccatcct cagtcatgttgacaattatttcctaaaccttactttgaagagctgtccca cttaacggatcccccaaactatagcaaagggcagatgtttctacctccca atgacaacgctttttttttttttaggatttaacattggtaatttaatgta tgtccttgtgagactatgccggggcctagcaaacacagaagtggatgctc acagtcagctattggatggaccacagggcccccaatggaggagctagaga aagtacccaaggagctaaagggatctgcaatcctatagatggaacaacaa tatgaactaaccagtaccccccagagctcgtgtctctagctgcatatgaa tcagaaaatggcctagtcggccatcagtggaaagaggcccattagtcgtg caaactctatatgcctcagtacagggggaacgacagggccaagaagtggg agtgggtggggggagtgtgt
quality values	Open. Hide. 49 31 22 39 62 62 62 62 62 62 62 54 62 62 62 62 54 47 62 62 62 62 62 62 62 47 42 62 62 62 62 56 62 62 38 33 56 59 56 56 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 49 54 54 49 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 56 56 59 59 51 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 56 62 62 56 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 42 62 62 56 62 62 62 56 56 62 62 51 62 62 62 54 54 62 62 62 62 62 62 62 56 62 54 47 56 56 47 49 41 62 56 62 62 62 62 62 42 62 62 62 62 62 62 39 62 62 62 62 43 56 62 52 62 62 62 52 52 47 62 62 62 54 62 62 49 52 52 54 39 31 54 54 62 62 62 47 38 43 62 54 42 47 45 62 62 27 45 16 43 27 52 41 46 54 54 54 52 52 47 52 41 39 49 47 52 52 52 50 50 47 47 52 41 32 54 15 16 9 6 13 13 11 39 9 52 47 25 42 54 52 28 49 30 21 18 18 29 33 52 34 52 48 44 58 52 58 52 47 42 54 42 50 52 43 30 33 25 16 5 24 21 32 58 47 53 33 33 31 30 24 34 19 9 33 30 42 35 24 47 18 49 50 48 21 50 50 37 29 53 50 25 53 35 22 18 24 12 22 15 15 22 46 53 35 35 48 28 46 46 18 25 32 8 42 16 25 42 39 28 29 44 16 48 22 22 19 10 13 13 16 7 50 19 28 7 28 6 18 50 33 50 26 35 33 40 32 39 33 34 18 32 22 24 19 21 17 39 29 24 19 32 24 26 9 40 19 31 12 20 22 34 23 53 23 49 28 33 21 40 37 40 17 21 20 9 19 22 14 31 28 21 24 45 11 54 18 15 6 14 18 18 24 20 32 27 25 21 41 22 32 32 26 29 21 33 34 31 47 34 30 34 34 28 39 42 37 27 29 45 24 42 31 53 37 28 28 14 31 13 29 31 24 19 19 22 30 13 7 18 17 16 16 22 15 42 34 8 29 28 22 14 5 12 12 15 19 16 33 9 20 22 7 25 20 13 10 10 25 28 15 27 37 42 29 30 7 45 19 18 27 30 24 31 14 19 32 11 26 13 12 40 21 17 11 14 15 25 28 18 6 19 31 25 16 12 16 26 12 12 7 18 15 25 31	Open. Hide. 62 49 47 44 62 47 32 62 62 62 62 59 51 59 38 28 32 59 46 46 30 59 47 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 54 59 59 49 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 54 62 59 62 62 62 62 62 62 59 59 59 62 62 62 54 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 46 62 62 62 62 54 62 62 62 54 62 62 62 62 47 62 62 62 62 62 62 62 62 46 62 62 62 62 62 54 54 62 62 54 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 52 58 58 58 58 58 46 58 58 58 54 58 58 48 58 42 54 54 54 58 54 58 52 58 46 52 52 54 54 54 52 54 52 54 58 54 54 54 52 42 58 58 52 54 58 58 58 54 58 54 54 54 52 54 52 54 58 54 52 54 58 58 50 58 58 58 54 58 49 58 58 42 37 58 50 49 52 47 58 51 48 54 49 50 49 46 58 58 58 41 43 34 49 58 24 44 45 41 53 58 52 58 58 53 53 52 50 49 49 49 29 50 46 58 49 50 58 51 27 58 50 42 58 58 50 50 46 52 50 42 31 52 52 37 48 49 46 54 42 53 39 38 51 58 49 51 41 37 49 58 52 50 52 53 58 58 54 49 49 41 50 40 50 58 32 52 54 36 51 58 44 44 51 51 49 31 51 32 44 50 40 49 32 53 42 35 39 45 42 38 35 53 50 41 37 34 45 39 41 52 54 40 35 34 52 29 54 54 54 26 26 54 44 29 42 40 38 21 35 42 30 31 14 21 26 53 29 37 32 28 42 38 52 54 52 32 51 31 52 19 47 40 31 34 45 40 30 32 32 39 32 47 29 21 51 32 29 29 28 45 45 32 28 52 37 31 38 47 39 32 29 42 26 32 23 12 46 46 41 29 29 12 21 31 34 29 21 21 40 36 24 31 13 43 16 46 27 19 51 40 40 27 27 19 30 31 41 18 15 33 40 40 41 40 26 43 19 25 13 5 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_49598963_49599906
seq2: B6Ng01-193K19.b_50_1001

seq1  GAATTCCTTCCTGGCTTAGAAGCTTCAGTTAGAAGGTAAACTCGGATATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTCCTGGCTTAGAAGCTTCAGTTAGAAGGTAAACTCGGATATA  50

seq1  CTCTTTTGAGCTCCCACTCTCTCTAAAGCTTTTCTGCCCCTTTCTCCCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTTGAGCTCCCACTCTCTCTAAAGCTTTTCTGCCCCTTTCTCCCTC  100

seq1  CCTCTCCTGTACATAGGTTTCTGTATATGCTTGCTCAGAGCGTCCCAGCG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTCCTGTACATAGGTTTCTGTATATGCTTGCTCAGAGCGTCCCAGCG  150

seq1  TGGTAAATGGGATGAGTTTCTCTCTTCCCCCTTGCTGTCACTCAGGAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAAATGGGATGAGTTTCTCTCTTCCCCCTTGCTGTCACTCAGGAAAG  200

seq1  ACGCAGTGTGGAGAATATTTGTGAGATAAACTAATGACCTCTAGGTGTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCAGTGTGGAGAATATTTGTGAGATAAACTAATGACCTCTAGGTGTGA  250

seq1  GGCTTCCTTTGCTTCTGCAGAGTTTCTGTTTGGGAATTTTGTTTGTTTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCCTTTGCTTCTGCAGAGTTTCTGTTTGGGAATTTTGTTTGTTTAG  300

seq1  TTGGTTTTTTTCTTTTTTGTTTTGTTTGTTTGTTGTTTGTTTGTTTGTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTTTTTTTCTTTTTTGTTTTGTTTGTTTGTTGTTTGTTTGTTTGTTT  350

seq1  GTTTCTGAGACAACTGAAACAGTTGGGGTGGAATGAGCTCAGGCAGTACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCTGAGACAACTGAAACAGTTGGGGTGGAATGAGCTCAGGCAGTACC  400

seq1  AGATAATGGAGAGAAGGGGGGAATAAAAGACCGTCACCAGCTGTCCTTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAATGGAGAGAAGGGGGGAATAAAAGACCGTCACCAGCTGTCCTTGT  450

seq1  CTGTAAAGTTACTACAACAAAACACCACAGGAGGCTTACAATCAGTAGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAAAGTTACTACAACAAAACACCACAGGAGGCTTACAATCAGTAGAA  500

seq1  TCTAGTTTTTCAACGTTCTGGAGATGAGGAAGTCCAAAAATCAAGGCACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGTTTTTCAACGTTCTGGAGATGAGGAAGTCCAAAAATCAAGGCACT  550

seq1  GGCAGATTCTGTGTCTGGATCATTTGGCTCTTTGTATGGATGTCTTCACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGATTCTGTGTCTGGATCATTTGGCTCTTTGTATGGATGTCTTCACA  600

seq1  TGGAGGAAGGGGAGAGGCAGCTTTTGGGATCTCTTTTTTGGCTTTCATTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGAAGGGGAGAGGCAGCTTTTGGGATCTCTTTTTTGGCTTTCATTT  650

seq1  T-AAAGACATAGTCTTATGTGACTCTGGCTGGCCTCGAACTCTCTACATA  699
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGACATAGTCTTATGTGACTCTGGCTGGCCTCGAACTCTCTACATA  700

seq1  GACCAGGTTGGCTTTGAACTCATAGAGCACTCTGTCTACC-AAGTGCTGG  748
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GACCAGGTTGGCTTTGAACTCATAGAGCACTCTGTCTACCAAAGTGCTGG  750

seq1  AA-TTAAAGGCAGATGCTGCCATGTTCATCCTTGGGATCTC-TTCTCTGT  796
      || ||||| |||||||||||||||||||||||||||||||| ||||||||
seq2  AATTTAAATGCAGATGCTGCCATGTTCATCCTTGGGATCTCTTTCTCTGT  800

seq1  GGATAGCACTCCTTTATCATC-TTCCTCCTGACCTGGCCATGAAGCTTCC  845
      ||||||||||||||||||||| ||| ||||||||||||||||||||||||
seq2  GGATAGCACTCCTTTATCATCTTTCTTCCTGACCTGGCCATGAAGCTTCC  850

seq1  TATCACCATTGGCTATACTACGGGGACGC-TGACATTCAGATTAGAG-AG  893
      ||||||||||||||||||||| ||||||| ||||||||||||||||| ||
seq2  TATCACCATTGGCTATACTACCGGGACGCTTGACATTCAGATTAGAGAAG  900

seq1  AGCAGTGGTCCCCT-GGCCTTGGCCACAGGTTGATGGGAACTACACA-CT  941
      |||| ||||||||| ||||||||||||||||||||||| |||||||| ||
seq2  AGCA-TGGTCCCCTGGGCCTTGGCCACAGGTTGATGGGGACTACACACCT  949

seq1  TGG  944
      |||
seq2  TGG  952

seq1: chr11_49762913_49763730
seq2: B6Ng01-193K19.g_64_883 (reverse)

seq1  ACACACT-CCCCCACCCACTCCCACTTCTTGGCCCTGTCGTT-CCCCTGT  48
      ||||||| |||||||||||||||||||||||||||||||||| |||||||
seq2  ACACACTCCCCCCACCCACTCCCACTTCTTGGCCCTGTCGTTCCCCCTGT  50

seq1  ACTGAGGCATATAGAGTTTGCACGACTAATGGGCCTCTTTCCACTGATGG  98
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGGCATATAGAGTTTGCACGACTAATGGGCCTCTTTCCACTGATGG  100

seq1  CCGACTAGGCCATTTTCTGATTCATATGCAGCTAGAGACACGAGCTCTGG  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGACTAGGCCATTTTCTGATTCATATGCAGCTAGAGACACGAGCTCTGG  150

seq1  GGGGTACTGGTTAGTTCATATTGTTGTTCCATCTATAGGATTGCAGATCC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTACTGGTTAGTTCATATTGTTGTTCCATCTATAGGATTGCAGATCC  200

seq1  CTTTAGCTCCTTGGGTACTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGCTCCTTGGGTACTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGG  250

seq1  TCCATCCAATAGCTGACTGTGAGCATCCACTTCTGTGTTTGCTAGGCCCC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATCCAATAGCTGACTGTGAGCATCCACTTCTGTGTTTGCTAGGCCCC  300

seq1  GGCATAGTCTCACAAGGACATACATTAAATTACCAATGTTAAATCCTAAA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATAGTCTCACAAGGACATACATTAAATTACCAATGTTAAATCCTAAA  350

seq1  AAAAAAAAAAGCGTTGTCATTGGGAGGTAGAAACATCTGCCCTTTGCTAT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAAGCGTTGTCATTGGGAGGTAGAAACATCTGCCCTTTGCTAT  400

seq1  AGTTTGGGGGATCCGTTAAGTGGGACAGCTCTTCAAAGTAAGGTTTAGGA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGGGGGATCCGTTAAGTGGGACAGCTCTTCAAAGTAAGGTTTAGGA  450

seq1  AATAATTGTCAACATGACTGAGGATGGATAACGGAGCGGGGAGAAGCCGA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATTGTCAACATGACTGAGGATGGATAACGGAGCGGGGAGAAGCCGA  500

seq1  CTCATCCCTCTTTGGAGAACTCTATTTTCAGCTACCAATCTACTGTGAGG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATCCCTCTTTGGAGAACTCTATTTTCAGCTACCAATCTACTGTGAGG  550

seq1  CTTTTTCTCTCCACTTGCAACAACAGATTGCCTGCAAGTGCCCCGAGCTC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTCTCTCCACTTGCAACAACAGATTGCCTGCAAGTGCCCCGAGCTC  600

seq1  TCCAAACCCACTGCTTCTAGAAGTGTGGAAGCAGCAGGGTCTGTCAGCGG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAACCCACTGCTTCTAGAAGTGTGGAAGCAGCAGGGTCTGTCAGCGG  650

seq1  GAGCAGGGGGCCATCTGGAGCCCCAGATAAGACAGCTTAGCATCCCTCTC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCAGGGGGCCATCTGGAGCCCCAGATAAGACAGCTTAGCATCCCTCTC  700

seq1  CCAGCCAGTGCTGTCCCCAGTCTCCCAGCCAGTGCTGTCCCCAGTCTCCC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCAGTGCTGTCCCCAGTCTCCCAGCCAGTGCTGTCCCCAGTCTCCC  750

seq1  AGCCAGTGCTGTCACCAGTCTCCCAGCCAGTGCTGTCACCAGCCCCCTGT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGTGCTGTCACCAGTCTCCCAGCCAGTGCTGTCACCAGCCCCCTGT  800

seq1  GGATAAAGTCAGGTGAATTC  818
      ||||||||||||||||||||
seq2  GGATAAAGTCAGGTGAATTC  820

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information