MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-232B16
Chromosome	1 (Build37)	11 (Build37)
Map Location	135,011,251 - 135,012,209	79,810,965 - 79,811,119
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	Pctk3, LOC100042221, Lemd1, EG638532, Klhdc8a, Nuak2, Tmcc2, Ripk5, Rbbp5, Tmem81, Cntn2, Nfasc, Lrrn2, Mdm4, LOC638636, Pik3c2b
Downstream gene	Ppp1r15b, Plekha6, Golt1a, Kiss1, LOC100038824, Ren1, Etnk2, Sox13, LOC667371, Snrpe, Zc3h11a, LOC667118, Lax1, Atp2b4, Optc, Prelp, LOC100042352, LOC100042358, Fmod, Btg2, EG667414
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pctk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18557 MGI:97518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lemd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213409 MGI:1922403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG638532 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638532 MGI:3646637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Klhdc8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213417 MGI:2442630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nuak2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74137 MGI:1921387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68875 MGI:1916125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ripk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213452 MGI:1925064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbbp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213464 MGI:1918367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74626 MGI:1921876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21367 MGI:104518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfasc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269116 MGI:104753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16980 MGI:106037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17248 MGI:107934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 733 ESTs, 7 Proteins pseudo : _no_value

name	Pik3c2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240752 MGI:2685045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	Ppp1r15b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108954 MGI:2444211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekha6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240753 MGI:2388662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golt1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68338 MGI:1915588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kiss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280287 MGI:2663985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ren1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19701 MGI:97898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etnk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214253 MGI:2443760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20668 MGI:98361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Snrpe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20643 MGI:98346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70579 MGI:1917829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 1 Protein

name	Lax1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240754 MGI:2443362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381290 MGI:88111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Optc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269120 MGI:2151113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prelp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116847 MGI:2151110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Fmod (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14264 MGI:1328364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12227 MGI:108384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667414 MGI:3647540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 760 ESTs, 6 Proteins

name	Pctk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679232 GeneID:18557 MGI:97518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PCTAIRE-motif protein kinase 3 transcript_id : NM_008795.1

name	LOC100042221 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234255 GeneID:100042221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001477751.1

name	Lemd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311552 GeneID:213409 MGI:1922403
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LEM domain containing 1 transcript_id : NM_001033250.3

name	EG638532 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363947 GeneID:638532 MGI:3646637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG638532 transcript_id : XM_914588.2

name	Klhdc8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363055 GeneID:213417 MGI:2442630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 8A transcript_id : NM_144810.3

name	Nuak2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891701 GeneID:74137 MGI:1921387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NUAK family, SNF1-like kinase, 2 transcript_id : NM_028778.3

name	Tmcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341188 GeneID:68875 MGI:1916125
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and coiled-coil domains 2 transcript_id : NM_178874.2

name	Ripk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301222 GeneID:213452 MGI:1925064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor interacting protein kinase 5 transcript_id : NM_172516.4

name	Rbbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369713 GeneID:213464 MGI:1918367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoblastoma binding protein 5 transcript_id : NM_172517.1

name	Tmem81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361444 GeneID:74626 MGI:1921876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 81 transcript_id : NM_029025.2

name	Cntn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248523 GeneID:21367 MGI:104518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : contactin 2 transcript_id : NM_177129.5

name	Nfasc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130561 GeneID:269116 MGI:104753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurofascin transcript_id : NM_182716.3

name	Lrrn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922709 GeneID:16980 MGI:106037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat protein 2, neuronal transcript_id : NM_010732.2

name	Mdm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802331 GeneID:17248 MGI:107934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformed mouse 3T3 cell double minute 4 transcript_id : NM_008575.3

name	Pik3c2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234310 GeneID:240752 MGI:2685045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : phosphoinositide-3-kinase, class 2, beta polypeptide transcript_id : XM_001479658.1

name	Ppp1r15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802693 GeneID:108954 MGI:2444211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 15b transcript_id : NM_133819.2

name	Plekha6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33636692 GeneID:240753 MGI:2388662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family A member 6 transcript_id : NM_182930.1

name	Golt1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388699 GeneID:68338 MGI:1915588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi transport 1 homolog A (S. cerevisiae) transcript_id : NM_026680.4

name	Kiss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226214 GeneID:280287 MGI:2663985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KiSS-1 metastasis-suppressor transcript_id : NM_178260.3

name	LOC100038824 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234179 GeneID:100038824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038824 transcript_id : XM_001471774.1

name	Ren1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886403 GeneID:19701 MGI:97898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : renin 1 structural transcript_id : NM_031192.2

name	Etnk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387127 GeneID:214253 MGI:2443760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ethanolamine kinase 2 transcript_id : NM_175443.3

name	Sox13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226240 GeneID:20668 MGI:98361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 13 transcript_id : NM_011439.2

name	Snrpe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801910 GeneID:20643 MGI:98346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein E transcript_id : NM_009227.2

name	Zc3h11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378001 GeneID:70579 MGI:1917829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 11A transcript_id : NM_144530.5

name	Lax1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982125 GeneID:240754 MGI:2443362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte transmembrane adaptor 1 transcript_id : NM_172842.2

name	Atp2b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54261792 GeneID:381290 MGI:88111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 4 transcript_id : NM_213616.1

name	Optc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905106 GeneID:269120 MGI:2151113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opticin transcript_id : NM_054076.1

name	Prelp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387274 GeneID:116847 MGI:2151110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline arginine-rich end leucine-rich repeat transcript_id : NM_054077.3

name	LOC100042352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234260 GeneID:100042352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042352 transcript_id : XM_001478016.1

name	Fmod (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348716 GeneID:14264 MGI:1328364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibromodulin transcript_id : NM_021355.3

name	Btg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875511 GeneID:12227 MGI:108384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell translocation gene 2, anti-proliferative transcript_id : NM_007570.2

name	EG667414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234317 GeneID:667414 MGI:3647540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 760 ESTs, 6 Proteins product : predicted gene, EG667414 transcript_id : XM_990438.2

name	Pctk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679233 CCDS:CCDS15281.1 GeneID:18557 MGI:97518
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] citation : [PUBMED 1437147] codon_start : 1 product : PCTAIRE-motif protein kinase 3 protein_id : NP_032821.1

name	LOC100042221 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234256 GeneID:100042221
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477801.1

name	Lemd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680919 GeneID:213409 MGI:1922403
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005635 - nuclear envelope [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : LEM domain containing 1 protein_id : NP_001028422.2

name	EG638532 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363948 GeneID:638532 MGI:3646637
definition	codon_start : 1 product : hypothetical protein protein_id : XP_919681.2

name	Klhdc8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450177 GeneID:213417 MGI:2442630
definition	codon_start : 1 product : kelch domain containing 8A protein_id : NP_659059.1

name	Nuak2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229182 CCDS:CCDS15283.1 GeneID:74137 MGI:1921387
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0042149 - cellular response to glucose starvation [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS] codon_start : 1 note : SNF1/AMP-activated protein kinase product : NUAK family, SNF1-like kinase, 2 protein_id : NP_083054.1

name	Tmcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725710 CCDS:CCDS15284.1 GeneID:68875 MGI:1916125
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane and coiled-coil domains 2 protein_id : NP_849205.1

name	Ripk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556610 CCDS:CCDS15285.1 GeneID:213452 MGI:1925064
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : dusty protein kinase product : receptor interacting protein kinase 5 protein_id : NP_766104.2

name	Rbbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369714 CCDS:CCDS15286.1 GeneID:213464 MGI:1918367
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 exception : mismatches in translation product : retinoblastoma binding protein 5 protein_id : NP_766105.1

name	Tmem81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312826 CCDS:CCDS15287.1 GeneID:74626 MGI:1921876
definition	codon_start : 1 product : hypothetical protein LOC74626 protein_id : NP_083301.1

name	Cntn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607084 CCDS:CCDS15288.1 GeneID:21367 MGI:104518
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0001764 - neuron migration [Evidence IMP] codon_start : 1 note : axonin; transiently-expressed axonal glycoprotein product : contactin 2 protein_id : NP_796103.2

name	Nfasc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:35215309 GeneID:269116 MGI:104753
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence IMP] codon_start : 1 product : neurofascin protein_id : NP_874385.1

name	Lrrn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47777289 CCDS:CCDS15289.1 GeneID:16980 MGI:106037
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat protein 2, neuronal protein_id : NP_034862.1

name	Mdm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543245 CCDS:CCDS15290.1 GeneID:17248 MGI:107934
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045023 - G0 to G1 transition [Evidence ISS]; GO:0042177 - negative regulation of protein catabolism [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP] codon_start : 1 product : transformed mouse 3T3 cell double minute 4 protein_id : NP_032601.2

name	Pik3c2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234311 GeneID:240752 MGI:2685045
definition	codon_start : 1 product : phosphoinositide-3-kinase, class 2, beta polypeptide protein_id : XP_001479708.1

name	Ppp1r15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27597067 CCDS:CCDS15291.1 GeneID:108954 MGI:2444211
definition	GO_component : GO:0000164 - protein phosphatase type 1 complex [Evidence IDA] GO_function : GO:0004722 - protein serine/threonine phosphatase activity [Evidence IDA]; GO:0045182 - translation regulator activity [Evidence IC] GO_process : GO:0006983 - ER overload response [Evidence IDA] [Evidence IMP]; GO:0006446 - regulation of translational initiation [Evidence IC]; GO:0042542 - response to hydrogen peroxide [Evidence IMP]; GO:0006979 - response to oxidative stress [Evidence IMP] [Evidence IDA]; GO:0006950 - response to stress [Evidence IMP] codon_start : 1 product : protein phosphatase 1, regulatory subunit 15B protein_id : NP_598580.1

name	Plekha6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33636693 CCDS:CCDS15292.1 GeneID:240753 MGI:2388662
definition	codon_start : 1 note : phosphoinositol 3-phosphate-binding protein-3 product : pleckstrin homology domain containing, family A member 6 protein_id : NP_891846.1

name	Golt1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311983 GeneID:68338 MGI:1915588
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi transport 1 homolog A protein_id : NP_080956.1

name	Kiss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226215 GeneID:280287 MGI:2663985
definition	GO_function : GO:0001664 - G-protein-coupled receptor binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030336 - negative regulation of cell migration [Evidence IPI]; GO:0008285 - negative regulation of cell proliferation [Evidence IPI] codon_start : 1 note : metastin; 0610012C01Rik product : KiSS-1 metastasis-suppressor protein_id : NP_839991.2

name	LOC100038824 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234180 GeneID:100038824
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471824.1

name	Ren1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13676837 CCDS:CCDS15295.1 GeneID:19701 MGI:97898
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004195 - renin activity [Evidence IEA] GO_process : GO:0002003 - angiotensin maturation [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0042756 - drinking behavior [Evidence IMP]; GO:0008065 - establishment of blood-nerve barrier [Evidence IMP]; GO:0009755 - hormone-mediated signaling [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0002016 - renin-angiotensin regulation of body fluid levels [Evidence IMP] codon_start : 1 note : aspartyl-protease product : renin 1 structural protein_id : NP_112469.1

name	Etnk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425172 CCDS:CCDS15296.1 GeneID:214253 MGI:2443760
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 product : putative ethanolamine kinase protein_id : NP_780652.1

name	Sox13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226241 GeneID:20668 MGI:98361
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : SRY-box 13 protein_id : NP_035569.2

name	Snrpe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883844 GeneID:20643 MGI:98346
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein E protein_id : NP_033253.1

name	Zc3h11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270986 CCDS:CCDS15297.1 GeneID:70579 MGI:1917829
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger CCCH type containing 11A protein_id : NP_653113.4

name	Lax1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982126 GeneID:240754 MGI:2443362
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0050851 - antigen receptor-mediated signaling pathway [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0048305 - immunoglobulin secretion [Evidence IMP]; GO:0046649 - lymphocyte activation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : lymphocyte transmembrane adaptor 1 protein_id : NP_766430.2

name	Atp2b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261793 CCDS:CCDS15298.1 GeneID:381290 MGI:88111
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence TAS] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : plasma membrane calcium ATPase 4 protein_id : NP_998781.1

name	Optc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905107 CCDS:CCDS15299.1 GeneID:269120 MGI:2151113
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : opticin protein_id : NP_473417.1

name	Prelp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543506 CCDS:CCDS15300.1 GeneID:116847 MGI:2151110
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proline arginine-rich end leucine-rich repeat protein_id : NP_473418.2

name	LOC100042352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234261 GeneID:100042352
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478066.1

name	Fmod (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946680 CCDS:CCDS15301.1 GeneID:14264 MGI:1328364
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : fibromodulin protein_id : NP_067330.1

name	Btg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680814 CCDS:CCDS15302.1 GeneID:12227 MGI:108384
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0030182 - neuron differentiation [Evidence ISS]; GO:0006479 - protein amino acid methylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : B-cell translocation gene 2, anti-proliferative protein_id : NP_031596.1

name	EG667414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363969 GeneID:667414 MGI:3647540
definition	codon_start : 1 product : similar to yeast ribosomal protein S28 homologue protein_id : XP_995532.1

name	LOC667371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667371
definition	number : 1 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 1 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 2 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:165100
definition	standard_name : AI428128

name	(CDS detail)
type	STS
link
xref	UniSTS:234389
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:215692
definition	standard_name : RH132409

name	(CDS detail)
type	STS
link
xref	UniSTS:236515
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234215
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:212772
definition	standard_name : RH129466

name	(CDS detail)
type	STS
link
xref	UniSTS:234214
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165101
definition	standard_name : AI465369

name	(CDS detail)
type	STS
link
xref	UniSTS:231669
definition	standard_name : RH142422

name	(CDS detail)
type	STS
link
xref	UniSTS:215897
definition	standard_name : RH132614

name	(CDS detail)
type	STS
link
xref	UniSTS:234213
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234218
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158851
definition	standard_name : MHAa21c6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:143908
definition	standard_name : Ms10j

name	(CDS detail)
type	STS
link
xref	UniSTS:224292
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:231620
definition	standard_name : RH142373

name	(CDS detail)
type	STS
link
xref	UniSTS:207208
definition	standard_name : AU021806

name	(CDS detail)
type	STS
link
xref	UniSTS:210253
definition	standard_name : RH136260

name	(CDS detail)
type	STS
link
xref	UniSTS:161088
definition	standard_name : RH124266

name	(CDS detail)
type	STS
link
xref	UniSTS:162267
definition	standard_name : RH125448

name	(CDS detail)
type	STS
link
xref	UniSTS:209802
definition	standard_name : RH127234

name	(CDS detail)
type	STS
link
xref	UniSTS:226177
definition	standard_name : Mdm4

name	(CDS detail)
type	STS
link
xref	UniSTS:270692
definition	standard_name : PMC133932P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234216
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224555
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164128
definition	standard_name : AI606441

name	(CDS detail)
type	STS
link
xref	UniSTS:234217
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164130
definition	standard_name : AU042621

name	(CDS detail)
type	STS
link
xref	UniSTS:128639
definition	standard_name : D1Mit287

name	(CDS detail)
type	STS
link
xref	UniSTS:128640
definition	standard_name : D1Mit287S

name	(CDS detail)
type	STS
link
xref	UniSTS:248631
definition	standard_name : AA998833

name	(CDS detail)
type	STS
link
xref	UniSTS:142248
definition	standard_name : D1Mit472

name	(CDS detail)
type	STS
link
xref	UniSTS:142085
definition	standard_name : D16Mit18

name	(CDS detail)
type	STS
link
xref	UniSTS:127811
definition	standard_name : D16Mit18

name	(CDS detail)
type	STS
link
xref	UniSTS:142086
definition	standard_name : D1Mit1012

name	(CDS detail)
type	STS
link
xref	UniSTS:128666
definition	standard_name : D1Mit31.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128665
definition	standard_name : D1Mit31

name	(CDS detail)
type	STS
link
xref	UniSTS:144345
definition	standard_name : Ren1

name	(CDS detail)
type	STS
link
xref	UniSTS:128654
definition	standard_name : D1Mit30

name	(CDS detail)
type	STS
link
xref	UniSTS:209961
definition	standard_name : RH135965

name	(CDS detail)
type	STS
link
xref	UniSTS:128671
definition	standard_name : D1Mit312S

name	(CDS detail)
type	STS
link
xref	UniSTS:128670
definition	standard_name : D1Mit312

name	(CDS detail)
type	STS
link
xref	UniSTS:161471
definition	standard_name : RH124649

name	(CDS detail)
type	STS
link
xref	UniSTS:178465
definition	standard_name : AW259412

name	(CDS detail)
type	STS
link
xref	UniSTS:178464
definition	standard_name : AW540933

name	(CDS detail)
type	STS
link
xref	UniSTS:128707
definition	standard_name : D1Mit348

name	(CDS detail)
type	STS
link
xref	UniSTS:88876
definition	standard_name : RH39400

name	(CDS detail)
type	STS
link
xref	UniSTS:128503
definition	standard_name : D1Mit164

name	(CDS detail)
type	STS
link
xref	UniSTS:165104
definition	standard_name : C76690

name	(CDS detail)
type	STS
link
xref	UniSTS:219382
definition	standard_name : RH137294

name	(CDS detail)
type	STS
link
xref	UniSTS:207216
definition	standard_name : BB238747

name	(CDS detail)
type	STS
link
xref	UniSTS:224842
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224209
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:160918
definition	standard_name : RH118245

name	(CDS detail)
type	STS
link
xref	UniSTS:270674
definition	standard_name : PMC133870P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158854
definition	standard_name : AI131919

name	(CDS detail)
type	STS
link
xref	UniSTS:158853
definition	standard_name : AA959598

name	(CDS detail)
type	STS
link
xref	UniSTS:207207
definition	standard_name : AW822012

name	(CDS detail)
type	STS
link
xref	UniSTS:141196
definition	standard_name : Btg2

name	(CDS detail)
type	STS
link
xref	UniSTS:224482
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270445
definition	standard_name : PMC123230P1

name	(CDS detail)
type	STS
link
xref	UniSTS:261837
definition	standard_name : AA819837

name	(CDS detail)
type	STS
link
xref	UniSTS:271371
definition	standard_name : PMC156147P12

name	LOC638636 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234258 GeneID:638636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 733 ESTs, 7 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_033420.1

name	LOC667118 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234316 GeneID:667118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 1 Protein product : similar to Zinc finger BED domain containing protein 4 transcript_id : XR_035411.1

clone name	MSMg01-388E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-232B16.b	B6Ng01-232B16.g
ACC	GA044523	GA044524
length	1,110	209
definition	B6Ng01-232B16.b	B6Ng01-232B16.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(135,011,251 - 135,012,209)	(79,810,965 - 79,811,119)
sequence	gaattcaaagaggacataaataaatgcctaaatgtattttttttgttttg tttttgtttttgtttttggagacggggtttctctgtgtagccctggctgc ctggacctcactttgtagaccaggctggcctcgaactcagaaatccgcct gcctctgcctccccagtgctgggattaaaggcgtgcgccaccacgcccgg ccccgcctaaatgtatttaaacatgacaggaataaattcctcaacaaatt ctaagaaaacacaaaaaaactgaaataaattggaagacaacagaggttat aaaaatagaattcagggaagagatagaaacactgaagagaacccaaactt gaaattaaaaacagtggtggagggaggtggccaagagactaaaagcactc gtttgcaaacctgtttggaacccccagaatccatgtaaccacagcatgca gtgaggcaagtgtctgtgaccctgcatacactattaggagatgggaggca gagacaggagaatctatgggagctcgaaggccaactagcctggcctacac agcaggaaagagaccgtgactcaaacaaggcagaaaggtaaagacagacc acagaagggtatccactgacctccacatgtccactgcagcatgcatgtgc ctactcccacagcaacaaacaagcacaaacatacactcaagggtatcaca tcttatacacatccaagctcaacaggccaaatacaaaactcaacggaagg gagctggagagatggctcagtggtttcccaggaaccacattggtggctca caaaccatctgtaacgggatcagatgctcttcttctggtgtgtctttgaa gacagttgcagtgtactcatatacatgaaataataaataaatctttaaaa caaccaaacaaacctcactgaaaggcctcatccacagaagtgggctcata ataagacagtgtcagggcttgagaccggtagggagaacttgagttcaaag acaatgtgaaaacatccttaaaaacacagggatgggaaacattgaagatc tttggggactaccctgacagaccaaatcctttaacttatgagcataaagg aggagtcatg	caggttcagtgaaaaacccaacctgtctttaaaaataaggttggagctga gcgtggtggtacatgcctttaagtcccagcactcgggaggcagaggcagg aagatctatgcaagttcaaggccagccctgtctataaagtgagttccagg aaagccagggctacacagagaaaccctgtctcaagaaaacataaagaaag aaagaaaaa
quality values	Open. Hide. 58 36 27 22 58 25 18 42 58 46 62 62 62 31 35 50 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 19 14 15 11 10 17 30 24 18 18 18 18 23 24 43 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 56 30 30 34 27 34 34 34 23 25 27 23 30 22 34 49 59 62 62 59 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 48 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 49 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 56 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 54 62 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 50 59 62 62 59 59 59 59 59 62 56 62 62 62 59 62 62 59 62 59 45 56 56 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 34 36 40 51 28 34 29 43 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 62 62 59 59 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 47 47 62 56 62 62 47 56 62 62 62 56 62 56 62 62 62 56 47 51 62 62 62 56 62 62 47 49 62 62 56 56 62 62 42 31 40 56 56 56 51 50 56 56 51 56 51 56 56 51 62 62 47 62 62 62 62 62 62 50 47 43 56 56 56 62 43 62 62 47 56 56 62 62 56 56 47 62 56 56 42 62 56 62 62 62 56 62 62 62 62 62 62 56 56 47 56 46 43 56 50 42 49 40 22 62 62 52 52 54 46 41 35 52 54 54 47 45 62 62 52 62 52 46 62 62 62 47 48 47 43 62 62 62 54 52 47 44 52 52 58 46 41 54 58 52 52 52 52 52 52 45 46 52 52 52 39 52 49 46 41 39 37 45 32 42 54 54 52 52 52 41 33 41 33 34 33 42 33 50 27 33 22 32 42 35 16 38 42 58 43 46 52 52 40 22 33 42 54 54 54 52 50 50 37 37 30 50 41 58 50 50 37 50 37 50 43 25 33 35 50 32 25 47 30 18 25 46 34 41 38 37 24 40 47 50 50 53 39 53 30 47 38 48 32 35 22 32 31 50 27 42 48 50 50 46 32 48 46 42 35 46 54 31 39 30 42 30 30 49 51 19 22 17 13 12 18 28 50 17 28 19 12 18 29 38 17 10 7 19 25 32 32 25 37 47 35 29 37 31 30 32 27 15 25 40 34 40 54 18 16 16 19 19 26 39 13 19 32 37 14 27 22 33 14 8 49 6 9 14 31 46 29 20 17 14 14 39 40 40 35 33 29 53 7 9 16 33 18 51 29 28 33 34 32 30 25 23 21 13 42 34 29 53 40 39 20 21 20 53 23 25 26 32 32 35 52 26 31 16 24 20 21 27 29 30 24 51 20 14 23 24 32 27 9 12 19 11 9 19 27 6 21 37 27 21 32 11 13 12 9 11 25 31 21 19 9 11 31 27 12 8 21 18 27 15 13 10 15 9 24 28 33 27 22 21 23 6 25 16 46 18 23 31 8 6 24 27 14 5 19 30 7 17 6 17 20 19 31 31 9 32 29 39 18 10 15 46 19 20 4 17 7 6 5 5 5 7 22 34 16 26 5 12 14 10 7 12 19 33 9 10 12 7 12 32 11 14 14 7 5 18 20 11 8 8 35 31 37 27 8 5 6 12 6 7 12 12 13 19 19 8 8 6 11 7 11 14 11 6 7 14 31 9 29 34 10 15 10 24 4 5 6 5 6 32 18 5 23 39 12 20 34 32 9 28 7 5 6 6 34 21 9 3 3 3 7 5 5 8 13 6 13 28 10 19 27 11 38 15 8 8 4 15 15 10 16 12 13 8 23 5 5 4 10 23 15 14 16 9 18 16 5 13 4 4 19 13	Open. Hide. 47 43 59 62 15 16 14 5 10 12 17 13 23 18 10 16 7 10 13 19 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 54 42 62 62 62 59 59 10 25 18 23 34 23 18 28 25 18 23 23 34 50 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 54 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 54 54 54 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_135011251_135012209
seq2: B6Ng01-232B16.b_183_1156

seq1  TCAGAAATCCGCCTGCCTCTGCCTCCCCAGTGCTGGGATTAAAGGCGTGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAAATCCGCCTGCCTCTGCCTCCCCAGTGCTGGGATTAAAGGCGTGC  50

seq1  GCCACCACGCCCGGCCCCGCCTAAATGTATTTAAACATGACAGGAATAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACCACGCCCGGCCCCGCCTAAATGTATTTAAACATGACAGGAATAAA  100

seq1  TTCCTCAACAAATTCTAAGAAAACACAAAAAAACTGAAATAAATTGGAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCAACAAATTCTAAGAAAACACAAAAAAACTGAAATAAATTGGAAG  150

seq1  ACAACAGAGGTTATAAAAATAGAATTCAGGGAAGAGATAGAAACACTGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACAGAGGTTATAAAAATAGAATTCAGGGAAGAGATAGAAACACTGAA  200

seq1  GAGAACCCAAACTTGAAATTAAAAACAGTGGTGGAGGGAGGTGGCCAAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACCCAAACTTGAAATTAAAAACAGTGGTGGAGGGAGGTGGCCAAGA  250

seq1  GACTAAAAGCACTCGTTTGCAAACCTGTTTGGAACCCCCAGAATCCATGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTAAAAGCACTCGTTTGCAAACCTGTTTGGAACCCCCAGAATCCATGT  300

seq1  AACCACAGCATGCAGTGAGGCAAGTGTCTGTGACCCTGCATACACTATTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCACAGCATGCAGTGAGGCAAGTGTCTGTGACCCTGCATACACTATTA  350

seq1  GGAGATGGGAGGCAGAGACAGGAGAATCTATGGGAGCTCGAAGGCCAACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGATGGGAGGCAGAGACAGGAGAATCTATGGGAGCTCGAAGGCCAACT  400

seq1  AGCCTGGCCTACACAGCAGGAAAGAGACCGTGACTCAAACAAGGCAGAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGGCCTACACAGCAGGAAAGAGACCGTGACTCAAACAAGGCAGAAA  450

seq1  GGTAAAGACAGACCACAGAAGGGTATCCACTGACCTCCACATGTCCACTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAAAGACAGACCACAGAAGGGTATCCACTGACCTCCACATGTCCACTG  500

seq1  CAGCATGCATGTGCCTACTCCCACAGCAACAAACAAGCACAAACATACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCATGCATGTGCCTACTCCCACAGCAACAAACAAGCACAAACATACAC  550

seq1  TCAAGGGTATCACATCTTATACACATCCAAGCTCAACAGGCCAAATACAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGGTATCACATCTTATACACATCCAAGCTCAACAGGCCAAATACAA  600

seq1  AACTCAACGGAAGGGAGCTGGAGAGATGGCTCAGTGGTTTCCCAGGAACC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCAACGGAAGGGAGCTGGAGAGATGGCTCAGTGGTTTCCCAGGAACC  650

seq1  ACA-TGGTGGCTCACAAACCATCTGTAACGGGATCAGATGC-CCTCTTCT  698
      ||| ||||||||||||||||||||||||||||||||||||| | ||||||
seq2  ACATTGGTGGCTCACAAACCATCTGTAACGGGATCAGATGCTCTTCTTCT  700

seq1  GGTGTGTC-TTGAAGACAGTTGCAGTGTACTCATATACATGAAATAAATA  747
      |||||||| |||||||||||||||||||||||||||||||||||| ||||
seq2  GGTGTGTCTTTGAAGACAGTTGCAGTGTACTCATATACATGAAAT-AATA  749

seq1  AATAAATCTTT-AAACAAACAAACAAACCTCACTGAAAGGCCTCATCCAC  796
      ||||||||||| |||||| |||||||||||||||||||||||||||||||
seq2  AATAAATCTTTAAAACAACCAAACAAACCTCACTGAAAGGCCTCATCCAC  799

seq1  AG-AGT-GGCTCAT-AGAAGACAGTGTCAGGGCTTGAAGACAGGTA-GGA  842
      || ||| ||||||| | ||||||||||||||||||| |||| |||| |||
seq2  AGAAGTGGGCTCATAATAAGACAGTGTCAGGGCTTG-AGACCGGTAGGGA  848

seq1  GAAC-TGAG-TCAAAGACAA--TGAAAACA-CCT--AAAACACAGGGATG  885
      |||| |||| ||||||||||  |||||||| |||  ||||||||||||||
seq2  GAACTTGAGTTCAAAGACAATGTGAAAACATCCTTAAAAACACAGGGATG  898

seq1  G--AACATTTGAGATCTTT-GGGAC-ACCCTGGCAAGAACCAAACCTTTA  931
      |  ||||||  |||||||| ||||| |||||| | ||| | || ||||||
seq2  GGAAACATTGAAGATCTTTGGGGACTACCCTGAC-AGACCAAATCCTTTA  947

seq1  AATTATGAGCATAAAAGGAGGAGTCATG  959
      | |||||||||| |||||||||||||||
seq2  ACTTATGAGCAT-AAAGGAGGAGTCATG  974

seq1: chr11_79810965_79811119
seq2: B6Ng01-232B16.g_139_283 (reverse)

seq1  TTTTTCTTTCTTTCTTTTTTCTTTTTTTTTTTTCTTTCGAGACAGGGTTT  50
      ||||||||||||||         ||| | |||||||  ||||||||||||
seq2  TTTTTCTTTCTTTC---------TTTATGTTTTCTT--GAGACAGGGTTT  39

seq1  CTCTGTGTAACAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCT  100
      ||||||||   |||||||||| |||||||||||||||| |||||  ||||
seq2  CTCTGTGT---AGCCCTGGCTTTCCTGGAACTCACTTTATAGACAGGGCT  86

seq1  GGCC-TCTACT--CAGAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGA  147
      |||| |  |||  || | |||| |||||||||||||||||||||||||||
seq2  GGCCTTGAACTTGCATAGATCTTCCTGCCTCTGCCTCCCGAGTGCTGGGA  136

seq1  -TTAAAGGC  155
       ||||||||
seq2  CTTAAAGGC  145

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information