MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-236G20
Chromosome	11 (Build37)
Map Location	93,742,315 - 93,742,818
singlet/doublet	singlet
Overlap gene	Utp18
Upstream gene	LOC100039286, Car10, LOC629636
Downstream gene	Mbtd1, Nme2, Nme1, Spag9, LOC100039431, LOC100039440, Tob1, Wfikkn2, 3300001P08Rik, Ankrd40, Abcc3, Cacna1g, Spata20, Epn3, Mycbpap, Rsad1, BC018371, Chad, Lrrc59, Eme1, Mrpl27, Xylt2, OTTMUSG00000002038, Cdc34-ps, A430060F13Rik, Tmem92, LOC100039410, LOC544807, LOC544808, LOC665174, LOC432591, LOC100039739
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Car10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72605 MGI:1919855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Utp18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217109 MGI:1923402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbtd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103537 MGI:2143977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18103 MGI:97356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nme1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18102 MGI:97355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spag9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70834 MGI:1918084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC100039431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 764 ESTs, 6 Proteins

name	LOC100039440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tob1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22057 MGI:1349721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfikkn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278507 MGI:2669209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3300001P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67684 MGI:1914934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71452 MGI:1918702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Abcc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76408 MGI:1923658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12291 MGI:1201678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217116 MGI:2183449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71889 MGI:1919139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mycbpap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104601 MGI:2388726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rsad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237926 MGI:3039628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC018371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:264895 MGI:2388287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12643 MGI:1096866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98238 MGI:2138133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eme1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268465 MGI:3576783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94064 MGI:2137224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xylt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217119 MGI:2444797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000002038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432589 MGI:3650066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc34-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111266 MGI:1858429
definition	note : cell division cycle 34 homolog, pseudogene (S. cerevisiae) pseudo : _no_value

name	A430060F13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217122 MGI:3026970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 2 Proteins

name	Tmem92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544806 MGI:3034723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC544807 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC544808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC665174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC432591 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein

name	LOC100039739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100039286 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262378 GeneID:100039286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical protein LOC100039286 transcript_id : XM_001472611.1

name	Car10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625805 GeneID:72605 MGI:1919855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 10 transcript_id : NM_028296.2

name	Utp18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61656179 GeneID:217109 MGI:1923402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UTP18, small subunit (SSU) processome component, homolog (yeast) transcript_id : NM_001013375.1

name	Mbtd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892941 GeneID:103537 MGI:2143977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mbt domain containing 1 transcript_id : NM_134012.2

name	Nme2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606273 GeneID:18103 MGI:97356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 2, protein transcript_id : NM_008705.4

name	Nme2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606269 GeneID:18103 MGI:97356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 2, protein transcript_id : NM_001077529.1

name	Nme1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38327645 GeneID:18102 MGI:97355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 1, protein transcript_id : NM_008704.2

name	Spag9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887771 GeneID:70834 MGI:1918084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 9 transcript_id : NM_027569.2

name	LOC100039431 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262382 GeneID:100039431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 764 ESTs, 6 Proteins product : similar to ribosomal protein L27 transcript_id : XM_001473193.1

name	Spag9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887775 GeneID:70834 MGI:1918084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 9 transcript_id : NM_001025429.1

name	Spag9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887777 GeneID:70834 MGI:1918084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 9 transcript_id : NM_001025428.1

name	Spag9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887783 GeneID:70834 MGI:1918084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 9 transcript_id : NM_001025430.1

name	LOC100039440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262386 GeneID:100039440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039440 transcript_id : XM_001473216.1

name	Tob1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676218 GeneID:22057 MGI:1349721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducer of ErbB-2.1 transcript_id : NM_009427.2

name	Wfikkn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32451493 GeneID:278507 MGI:2669209
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 transcript_id : NM_181819.1

name	3300001P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956165 GeneID:67684 MGI:1914934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3300001P08 gene transcript_id : NM_026313.1

name	Ankrd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656160 GeneID:71452 MGI:1918702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 40 transcript_id : NM_027799.2

name	Ankrd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656166 GeneID:71452 MGI:1918702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 40 transcript_id : NM_146024.1

name	Abcc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403594 GeneID:76408 MGI:1923658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 3 transcript_id : NM_029600.3

name	Cacna1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753231 GeneID:12291 MGI:1201678
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, T type, alpha 1G subunit transcript_id : NM_009783.1

name	Spata20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559394 GeneID:217116 MGI:2183449
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 20 transcript_id : NM_144827.3

name	Epn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130412 GeneID:71889 MGI:1919139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epsin 3 transcript_id : NM_027984.2

name	Mycbpap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24762233 GeneID:104601 MGI:2388726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mycbp associated protein transcript_id : NM_170671.1

name	Rsad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480061 GeneID:237926 MGI:3039628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : radical S-adenosyl methionine domain containing 1 transcript_id : NM_001013381.1

name	BC018371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130052 GeneID:264895 MGI:2388287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018371 transcript_id : NM_153807.2

name	Chad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801969 GeneID:12643 MGI:1096866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chondroadherin transcript_id : NM_007689.3

name	Lrrc59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527025 GeneID:98238 MGI:2138133
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 59 transcript_id : NM_133807.1

name	Eme1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384014 GeneID:268465 MGI:3576783
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : essential meiotic endonuclease 1 homolog 1 (S. pombe) transcript_id : NM_177752.3

name	Mrpl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254119 GeneID:94064 MGI:2137224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L27 transcript_id : NM_053161.2

name	Xylt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130214 GeneID:217119 MGI:2444797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xylosyltransferase II transcript_id : NM_145828.2

name	OTTMUSG00000002038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377100 GeneID:432589 MGI:3650066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000002038 transcript_id : NM_001007584.2

name	Tmem92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360342 GeneID:544806 MGI:3034723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 92 transcript_id : NM_001034896.2

name	LOC100039410 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262380 GeneID:100039410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001472839.1

name	LOC544807 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262396 GeneID:544807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical LOC544807, transcript variant 1 transcript_id : XM_001474160.1

name	LOC544807 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262398 GeneID:544807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : hypothetical LOC544807, transcript variant 2 transcript_id : XM_001474177.1

name	LOC544808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390825 GeneID:544808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : hypothetical LOC544808, transcript variant 1 transcript_id : XM_618920.3

name	LOC665174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390764 GeneID:665174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC665174 transcript_id : XM_975056.1

name	LOC432591 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262400 GeneID:432591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : hypothetical LOC432591, transcript variant 1 transcript_id : XM_001474263.1

name	LOC432591 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390766 GeneID:432591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : hypothetical LOC432591, transcript variant 2 transcript_id : XM_484066.4

name	LOC100039739 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262402 GeneID:100039739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : hypothetical protein LOC100039739 transcript_id : XM_001474282.1

name	LOC100039286 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262379 GeneID:100039286
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472661.1

name	Car10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037303 CCDS:CCDS25244.1 GeneID:72605 MGI:1919855
definition	codon_start : 1 note : carbonic anhydrase-related protein 10; CA-RP X product : carbonic anhydrase 10 protein_id : NP_082572.1

name	Utp18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656180 CCDS:CCDS25245.1 GeneID:217109 MGI:1923402
definition	codon_start : 1 product : WD repeat domain 50 protein_id : NP_001013393.1

name	Mbtd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527230 GeneID:103537 MGI:2143977
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : mbt domain containing 1 protein_id : NP_598773.1

name	Nme2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606270 GeneID:18103 MGI:97356
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0009209 - pyrimidine ribonucleoside triphosphate biosynthesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleoside diphosphate kinase B; expressed in non-metastatic cells 2 protein product : nucleoside-diphosphate kinase 2 protein_id : NP_001070997.1

name	Nme2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679078 CCDS:CCDS25246.1 GeneID:18103 MGI:97356
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0009209 - pyrimidine ribonucleoside triphosphate biosynthesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleoside diphosphate kinase B; expressed in non-metastatic cells 2 protein product : nucleoside-diphosphate kinase 2 protein_id : NP_032731.1

name	Nme1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37700232 CCDS:CCDS25247.1 GeneID:18102 MGI:97355
definition	GO_component : GO:0005792 - microsome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0030879 - mammary gland development [Evidence IMP]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0009209 - pyrimidine ribonucleoside triphosphate biosynthesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleotide diphosphate kinase; expressed in non-metastatic cells 1 protein; nucleoside diphosphate kinase product : nucleoside-diphosphate kinase 1 protein_id : NP_032730.1

name	Spag9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887772 CCDS:CCDS25248.1 GeneID:70834 MGI:1918084
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0008432 - JUN kinase binding [Evidence IDA]; GO:0019894 - kinesin binding [Evidence IDA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; JNK-associated leucine-zipper; JNK-interacting protein 4 product : sperm associated antigen 9 isoform 1 protein_id : NP_081845.2

name	LOC100039431 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262383 GeneID:100039431
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473243.1

name	Spag9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887776 GeneID:70834 MGI:1918084
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0008432 - JUN kinase binding [Evidence IDA]; GO:0019894 - kinesin binding [Evidence IDA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; JNK-associated leucine-zipper; JNK-interacting protein 4 product : sperm associated antigen 9 isoform 3 protein_id : NP_001020600.1

name	Spag9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887778 GeneID:70834 MGI:1918084
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0008432 - JUN kinase binding [Evidence IDA]; GO:0019894 - kinesin binding [Evidence IDA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; JNK-associated leucine-zipper; JNK-interacting protein 4 product : sperm associated antigen 9 isoform 2 protein_id : NP_001020599.1

name	Spag9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887784 CCDS:CCDS25249.1 GeneID:70834 MGI:1918084
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0008432 - JUN kinase binding [Evidence IDA]; GO:0019894 - kinesin binding [Evidence IDA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; JNK-associated leucine-zipper; JNK-interacting protein 4 product : sperm associated antigen 9 isoform 4 protein_id : NP_001020601.1

name	LOC100039440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262387 GeneID:100039440
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473266.1

name	Tob1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676219 CCDS:CCDS25250.1 GeneID:22057 MGI:1349721
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046332 - SMAD binding [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence IMP]; GO:0007184 - SMAD protein nuclear translocation [Evidence IDA] codon_start : 1 note : transducer of erbB2 product : transducer of ErbB-2.1 protein_id : NP_033453.2

name	Wfikkn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32451494 CCDS:CCDS25251.1 GeneID:278507 MGI:2669209
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation note : WFIKKN-like; growth and differentiation factor-associated serum protein 1 product : WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 protein_id : NP_861540.1

name	3300001P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956166 CCDS:CCDS25252.1 GeneID:67684 MGI:1914934
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : cisplatin resistance-associated overexpressed protein protein_id : NP_080589.1

name	Ankrd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656161 CCDS:CCDS25253.1 GeneID:71452 MGI:1918702
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; granule cell antiserum positive 15 product : ankyrin repeat domain 40 isoform 1 protein_id : NP_082075.2

name	Ankrd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656167 GeneID:71452 MGI:1918702
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; granule cell antiserum positive 15 product : ankyrin repeat domain 40 isoform 2 protein_id : NP_666136.1

name	Abcc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90403595 CCDS:CCDS25254.1 GeneID:76408 MGI:1923658
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence ISS] [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015722 - canalicular bile acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : transporter; ATP-binding cassette protein C3; ATP-binding cassette transporter; multidrug resistance-associated protein 3 product : ATP-binding cassette, sub-family C (CFTR/MRP), member 3 protein_id : NP_083876.3

name	Cacna1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753232 CCDS:CCDS25255.1 GeneID:12291 MGI:1201678
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005245 - voltage-gated calcium channel activity [Evidence IDA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : calcium channel, voltage-dependent, T type, alpha 1G subunit protein_id : NP_033913.1

name	Spata20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46485467 CCDS:CCDS25256.1 GeneID:217116 MGI:2183449
definition	codon_start : 1 note : sperm protein SSP411; transcript increased in spermiogenesis 78 product : spermatogenesis associated 20 protein_id : NP_659076.2

name	Epn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794400 CCDS:CCDS25257.1 GeneID:71889 MGI:1919139
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 product : epsin 3 protein_id : NP_082260.1

name	Mycbpap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24762234 GeneID:104601 MGI:2388726
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 exception : mismatches in translation note : AMY1-associating protein 1 product : Myc-binding protein-associated protein protein_id : NP_733771.1

name	Rsad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480062 CCDS:CCDS25258.1 GeneID:237926 MGI:3039628
definition	codon_start : 1 product : radical S-adenosyl methionine domain containing 1 protein_id : NP_001013399.1

name	BC018371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418933 CCDS:CCDS25259.1 GeneID:264895 MGI:2388287
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC264895 protein_id : NP_722502.1

name	Chad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680926 CCDS:CCDS25260.1 GeneID:12643 MGI:1096866
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : chondroadherin protein_id : NP_031715.1

name	Lrrc59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527026 CCDS:CCDS25261.1 GeneID:98238 MGI:2138133
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 59 protein_id : NP_598568.1

name	Eme1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244242 CCDS:CCDS25262.1 GeneID:268465 MGI:3576783
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : essential meiotic endonuclease 1 homolog 1 protein_id : NP_808420.1

name	Mrpl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716447 CCDS:CCDS25263.1 GeneID:94064 MGI:2137224
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L27 protein_id : NP_444391.1

name	Xylt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003872 GeneID:217119 MGI:2444797
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008375 - acetylglucosaminyltransferase activity [Evidence IEA]; GO:0030158 - protein xylosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : xylosyltransferase 2 product : xylosyltransferase II protein_id : NP_665827.1

name	OTTMUSG00000002038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090519 GeneID:432589 MGI:3650066
definition	codon_start : 1 product : hypothetical protein LOC432589 protein_id : NP_001007585.1

name	Tmem92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702254 GeneID:544806 MGI:3034723
definition	codon_start : 1 product : hypothetical protein LOC544806 protein_id : NP_001030068.1

name	LOC100039410 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262381 GeneID:100039410
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472889.1

name	LOC544807 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262397 GeneID:544807
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474210.1

name	LOC544807 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262399 GeneID:544807
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474227.1

name	LOC544808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63617748 GeneID:544808
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_618920.1

name	LOC665174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390765 GeneID:665174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980150.1

name	LOC432591 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51766385 GeneID:432591
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_484066.1

name	LOC432591 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262401 GeneID:432591
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474313.1

name	LOC100039739 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262403 GeneID:100039739
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474332.1

name	LOC629636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629636
definition	number : 1 pseudo : _no_value

name	LOC629636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629636
definition	number : 2 pseudo : _no_value

name	Cdc34-ps (CDS detail)
type	polyA_site
link	vega ensembl
xref
definition

name	Cdc34-ps (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition

name	A430060F13Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262395 GeneID:217122 MGI:3026970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 97 ESTs, 2 Proteins product : RIKEN cDNA A430060F13 gene transcript_id : XR_035209.1

clone name	MSMg01-361E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-440O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-333O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379D18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-236G20.b	B6Ng01-236G20.g
ACC	GA047647	GA047648
length	1,203	498
definition	B6Ng01-236G20.b	B6Ng01-236G20.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggcccatacctaaacatagtaaaagcaatctacagcaaacca ggagccaacatcaaagtaaatggagagaagctggaagcaatcccactaaa atcagggactagacaatgctgcccactttctccctaccttttcaacatag tacttgaactattagccagagcaattcgacaacaaaaggagatcaagggg atacaaattggaaaagaggaagtcaaaatatcactttttgcagatggtat gatagtatatataagtgaccctaaaaattccaccagagaactcctaaacc tgataaacagctttggtgaagtagctggatataaaattaactcaaacaag tcaatggcctttctctacacaaagaataaacaggctgagaaagaaagtag ggaaacaacacccttctcaatagtcacaaataatataaaatatctcggcg tgactctaactaaggaagtgaaagatctgcatgataaaaacttcaagtct ctgaagaaagaaattaaagaagatctcagaagatggaaagatctcccatg ctcatggattggcaggatcaacattgtaaaaatggctatcttgccaaaag caatctacagattcaatgcaatccccatcaaaattccaactcaattcttc aacgaattagaaggagcaatttgcaaattcatctggaataacaaaaaacc taggatagcaaaaagtcttctcaaggataaaagaacctctggtggaatca ccatgcctgatctaaagctttactacagagcaattgtgataaaaactgca tggtactggtatagagacagacaagtagaccaatggaatagaattgaaga cccagaaatgaacccacacacctatggtcacgtgatctttgacaagggag ctaaaaccatccactggaagaaagacagcattttcaacaattggtgctgg cacaactggttgttatcatgtagaagaatgcgatcgatccatacttatct ccttgtactaagtcaaatctaagtggatcaggacttcacataaaaccaga gacactgaacttatagaggagaaagtggagaaaagtctttgaagattatg gcacagggcaaaattcctgaaccgacaggcatggccttgtgcgtagatcg aattgacaatgggaccttatgaaactccaaggtttctgtgcaaagggcat gac	ctctgtgggaatcagaaaccatatgatcaaggaggttttctttcattttc agtatcatgtctaagaaactagcagctgaccaattaatattaagttctgt tgactctcataatccaccaatgtacttaccttcattgctttttctttaac ataatgatttcattatttgtttttgtttgttttaaaaaaatgttcactcc ttactgtgtatgagaggtcaatagacaacttcctggagtcagaaagtttt ctctttccaccatatgggttccagggattgaatttaggtcattaggcttg gtgacaagtactgttattacctgctggtagccagaggagtcttaccccac cttctcccagtctctcattgcctgggctggcctcggcctcactatagagc tgaagatgatcttgacctttgatcatcctgcctgcctgctttttccaaga gttgggattacaggtgtatgttgggtatgtatgtatgtatgtatgtat
quality values	Open. Hide. 62 31 26 37 62 37 15 47 62 62 62 62 47 33 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 49 51 34 28 32 48 33 46 51 59 59 59 62 62 62 62 59 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 56 50 54 62 62 62 62 54 62 62 59 43 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 58 54 54 58 58 58 58 52 58 58 54 54 36 58 58 58 58 58 58 54 54 54 58 58 58 54 54 58 58 58 54 58 54 58 58 58 54 46 58 58 58 58 54 58 58 54 54 58 52 54 54 54 54 58 58 58 54 58 58 58 52 58 58 58 52 58 52 58 54 58 54 58 43 29 27 51 58 54 50 54 50 58 58 58 49 48 47 50 50 58 54 58 53 50 48 51 58 47 50 52 58 58 54 39 33 40 58 54 52 58 58 38 49 54 47 37 27 58 51 58 50 49 48 49 58 53 54 51 53 34 51 58 50 58 54 53 53 51 50 58 51 38 51 50 37 49 51 52 50 58 58 50 49 50 58 50 51 53 52 40 53 53 53 54 51 51 49 50 41 42 44 33 49 58 43 54 50 42 43 46 51 37 54 38 38 53 49 49 51 54 54 54 49 39 41 52 49 54 43 42 42 31 38 49 54 32 29 54 54 54 39 35 54 35 42 37 50 52 37 51 54 38 49 32 33 35 32 37 33 29 39 37 45 51 46 28 34 47 42 32 42 39 19 54 47 40 42 52 54 41 31 45 42 37 41 25 31 35 24 31 29 41 34 47 52 45 42 31 31 40 49 49 53 32 32 32 34 29 31 29 32 47 19 26 32 32 32 39 32 27 42 28 37 51 42 30 30 26 31 43 30 31 35 31 45 34 27 29 18 38 27 43 31 41 46 30 33 35 31 32 51 30 24 31 31 31 38 32 31 10 40 35 18 24 46 48 31 27 42 30 31 32 40 32 13 42 26 31 25 34 33 32 31 32 37 42 28 31 26 31 25 27 27 21 25 26 32 47 32 31 31 34 25 22 19 47 22 21 18 32 27 33 36 31 20 16 16 16 32 33 31 13 22 27 31 34 21 27 20 27 48 38 32 20 14 13 22 32 23 31 44 43 33 32 22 27 31 21 12 22 13 30 26 12 34 34 33 25 17 18 30 31 10 15 33 31 21 24 8 17 37 29 24 19 21 27 27 29 32 26 21 14 32 28 22 23 20 18 25 19 10 23 6 16 22 32 34 19 27 17 30 24 34 29 22 21 21 19 15 19 20 9 24 32 16 27 34 25 11 7 3 6 17 11 28 19 20 15 11 15 14 7 10 8 26 17 24 11 27 19 19 16 6 15 20 26 13 24 20 28 22 34 22 18 8 20 17 18 21 6 6 8 7 16 19 8 19 7 17 28 24 7 11 10 11 16 12 17 12 6 9 27 19 16 16 25 8 9 6 14 30 21 22 7 5 17 6 17 8 6 13 5 6 11 5 4 4 10 14 17 4 3 7 5 14 29 2 1 9 28 28 9 15 17 4 11 19 15 14 14 5 5 5 9 3 5 4 4 16 14 4 6 14 5 5 25 16 10 4 4 4 3 1 2 2 22 10 5 3 2 5 5 8 6 7 6 7 10 4 10 6 17 6 6 11 10 10 10 3 6 14 30 7 13 7 6 8 5 8 8 4 8 20 5 5 11 10 8 9 17 7 6 6 22 13 8 2 3 1 1 2 3	Open. Hide. 62 62 62 62 62 43 46 32 28 29 28 40 43 36 48 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 59 59 62 59 59 62 54 35 62 62 62 62 59 62 62 54 54 62 62 59 59 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 47 54 62 62 62 38 62 56 56 62 56 62 62 56 62 62 62 62 62 62 62 62 56 47 41 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 52 52 52 62 62 62 62 47 42 62 62 62 62 62 62 62 62 62 62 47 52 52 52 52 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 47 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_93742315_93742818
seq2: B6Ng01-236G20.g_67_570 (reverse)

seq1  ATACATACATACATACATACATACCCAACATACACCTGTAATCCCAACTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATACATACATACATACATACCCAACATACACCTGTAATCCCAACTC  50

seq1  TTGGAAAAAGCAGGCAGGCAGGATGATCAAAGGTCAAGATCATCTTCAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAAAAAGCAGGCAGGCAGGATGATCAAAGGTCAAGATCATCTTCAGC  100

seq1  TCTATAGTGAGGCCGAGGCCAGCCCAGGCAATGAGAGACTGGGAGAAGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATAGTGAGGCCGAGGCCAGCCCAGGCAATGAGAGACTGGGAGAAGGT  150

seq1  GGGGTAAGACTCCTCTGGCTACCAGCAGGTAATAACAGTACTTGTCACCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTAAGACTCCTCTGGCTACCAGCAGGTAATAACAGTACTTGTCACCA  200

seq1  AGCCTAATGACCTAAATTCAATCCCTGGAACCCATATGGTGGAAAGAGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTAATGACCTAAATTCAATCCCTGGAACCCATATGGTGGAAAGAGAA  250

seq1  AACTTTCTGACTCCAGGAAGTTGTCTATTGACCTCTCATACACAGTAAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTCTGACTCCAGGAAGTTGTCTATTGACCTCTCATACACAGTAAGG  300

seq1  AGTGAACATTTTTTTAAAACAAACAAAAACAAATAATGAAATCATTATGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAACATTTTTTTAAAACAAACAAAAACAAATAATGAAATCATTATGT  350

seq1  TAAAGAAAAAGCAATGAAGGTAAGTACATTGGTGGATTATGAGAGTCAAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGAAAAAGCAATGAAGGTAAGTACATTGGTGGATTATGAGAGTCAAC  400

seq1  AGAACTTAATATTAATTGGTCAGCTGCTAGTTTCTTAGACATGATACTGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACTTAATATTAATTGGTCAGCTGCTAGTTTCTTAGACATGATACTGA  450

seq1  AAATGAAAGAAAACCTCCTTGATCATATGGTTTCTGATTCCCACAGAGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGAAAGAAAACCTCCTTGATCATATGGTTTCTGATTCCCACAGAGGA  500

seq1  ATTC  504
      ||||
seq2  ATTC  504

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information