MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-238C03
Chromosome	11 (Build37)
Map Location	98,844,693 - 98,970,211
singlet/doublet	doublet
Overlap gene	Top2a, Igfbp4, Tns4
Upstream gene	Plxdc1, Arl5c, Cacnb1, Rpl19, Stac2, Fbxl20, LOC665606, Pparbp, LOC666613, LOC100039982, Crkrs, Neurod2, Ppp1r1b, Stard3, Tcap, Pnmt, Perld1, Erbb2, 1810046J19Rik, Grb7, Ikzf3, Zpbp2, Ormdl3, Gm12, LOC100040117, Gsdm3, Gsdm2, Gsdm1, Psmd3, Csf3, Thrap4, Thra, Nr1d1, 4121402D02Rik, Casc3, Rapgefl1, Wipf2, Cdc6, Rara, Gjc1
Downstream gene	Ccr7, Smarce1, Krt222, Krt24, LOC100040200, Krt25, Krt26, Krt27, Krt10, A830036E02Rik, Krt20, Krt23, Krt39, Krt40, Krtap3-3, Krtap3-2, Krtap3-1, 2310043L02Rik, OTTMUSG00000004966, LOC435273, 2310040M23Rik, LOC100041412, LOC100041488, Krtap2-4, LOC100041477, A030010K20Rik, 1110033F04Rik, Krtap4-7, LOC546511, LOC100040248, 1110054P19Rik, LOC665922, LOC100040276, LOC665992, LOC665998, LOC670464, LOC670472, LOC670482, 2300006N05Rik, LOC670496, LOC629924, OTTMUSG00000002196, OTTMUSG00000002191, Krtap9-1, LOC670533, 4733401H21Rik, LOC670550, LOC630936, OTTMUSG00000002177, LOC435286, A030006P16Rik, Krt33a, Krt33b, Krt34, Krt31, Krt32, Krt35, Krt36
Link	Open Mouse BAC browser

Click to get alignment info.

name	Plxdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72324 MGI:1919574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217151 MGI:3028577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12295 MGI:102522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpl19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19921 MGI:98020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217154 MGI:2144518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72194 MGI:1919444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Pparbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC666613 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 465 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Crkrs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69131 MGI:1098802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neurod2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18013 MGI:107755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19049 MGI:94860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stard3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59045 MGI:1929618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21393 MGI:1330233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18948 MGI:97724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Perld1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320655 MGI:2444461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erbb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13866 MGI:95410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810046J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103742 MGI:1913678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14786 MGI:102683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikzf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22780 MGI:1342542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zpbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69376 MGI:1916626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ormdl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66612 MGI:1913862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192852 MGI:2684858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	LOC100040117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 218 ESTs

name	Gsdm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:450219 MGI:3044668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsdm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76758 MGI:1921490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsdm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57911 MGI:1889509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22123 MGI:98858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12985 MGI:1339751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thrap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23989 MGI:1344385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21833 MGI:98742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217166 MGI:2444210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4121402D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74026 MGI:1921276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192160 MGI:2179723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgefl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268480 MGI:3611446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wipf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68524 MGI:1924462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23834 MGI:1345150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rara (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19401 MGI:97856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gjc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353155 MGI:2384150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Top2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21973 MGI:98790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16010 MGI:96439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tns4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217169 MGI:2144377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12775 MGI:103011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57376 MGI:1927347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268481 MGI:2442728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75706 MGI:1922956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040200 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Krt25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70810 MGI:1918060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320864 MGI:2444913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16675 MGI:1339999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16661 MGI:96685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830036E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268482 MGI:3686876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66809 MGI:1914059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94179 MGI:2148866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237934 MGI:3588208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406221 MGI:3629968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap3-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66380 MGI:1913630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap3-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66708 MGI:1913958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap3-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69473 MGI:1916723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 6 Proteins

name	2310043L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69664 MGI:1916914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000004966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629873 MGI:3651229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins

name	2310040M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75586 MGI:1922836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC100041488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	Krtap2-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71453 MGI:1918703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins

name	LOC100041477 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	A030010K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665891 MGI:3622079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110033F04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68673 MGI:1915923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap4-7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76444 MGI:1923694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100040248 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	1110054P19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68768 MGI:1916018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 16 Proteins

name	LOC665922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 109 ESTs, 21 Proteins pseudo : _no_value

name	LOC100040276 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC665992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC665998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC670464 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC670472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 7 Proteins

name	LOC670482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 9 Proteins

name	2300006N05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69464 MGI:1916714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC629924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	OTTMUSG00000002196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435285 MGI:3651030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000002191 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432600 MGI:3652067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Krtap9-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16705 MGI:1309997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4733401H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70831 MGI:1918081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC630936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 168 ESTs, 21 Proteins pseudo : _no_value

name	OTTMUSG00000002177 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432602 MGI:3650789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	A030006P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77914 MGI:1925164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	Krt33a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71888 MGI:1919138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt33b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16671 MGI:1309991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 55 Proteins

name	Krt34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16672 MGI:1309994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16660 MGI:1309993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16670 MGI:1309995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53617 MGI:1858899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16673 MGI:109364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plxdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560780 GeneID:72324 MGI:1919574
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin domain containing 1 transcript_id : NM_028199.2

name	Arl5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402216 GeneID:217151 MGI:3028577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 5C transcript_id : NM_207231.1

name	Cacnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281727 GeneID:12295 MGI:102522
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 1 subunit transcript_id : NM_145121.1

name	Cacnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130728 GeneID:12295 MGI:102522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 1 subunit transcript_id : NM_031173.2

name	Rpl19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677772 GeneID:19921 MGI:98020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L19 transcript_id : NM_009078.1

name	Stac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801886 GeneID:217154 MGI:2144518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and cysteine rich domain 2 transcript_id : NM_146028.3

name	Fbxl20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494220 GeneID:72194 MGI:1919444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 20 transcript_id : NM_028149.1

name	LOC665606 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390779 GeneID:665606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical LOC665606 transcript_id : XM_978106.1

name	Pparbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583905 GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor binding protein transcript_id : NM_134027.2

name	Pparbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582397 GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor binding protein transcript_id : NM_001080118.1

name	Pparbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582429 GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor binding protein transcript_id : NM_013634.2

name	LOC100039982 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262405 GeneID:100039982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039982 transcript_id : XM_001473891.1

name	Crkrs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794423 GeneID:69131 MGI:1098802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc2-related kinase, arginine/serine-rich transcript_id : NM_026952.1

name	Neurod2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982780 GeneID:18013 MGI:107755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurogenic differentiation 2 transcript_id : NM_010895.2

name	Ppp1r1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21536255 GeneID:19049 MGI:94860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 1B transcript_id : NM_144828.1

name	Stard3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892541 GeneID:59045 MGI:1929618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : START domain containing 3 transcript_id : NM_021547.2

name	Tcap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248559 GeneID:21393 MGI:1330233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : titin-cap transcript_id : NM_011540.2

name	Pnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679404 GeneID:18948 MGI:97724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phenylethanolamine-N-methyltransferase transcript_id : NM_008890.1

name	Perld1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326507 GeneID:320655 MGI:2444461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : per1-like domain containing 1 transcript_id : NM_001033537.2

name	Erbb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873609 GeneID:13866 MGI:95410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) transcript_id : NM_001003817.1

name	1810046J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074525 GeneID:103742 MGI:1913678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810046J19 gene transcript_id : NM_025559.2

name	Grb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325997 GeneID:14786 MGI:102683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 7 transcript_id : NM_010346.2

name	Ikzf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374151 GeneID:22780 MGI:1342542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IKAROS family zinc finger 3 transcript_id : NM_011771.1

name	Zpbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40786388 GeneID:69376 MGI:1916626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida binding protein 2 transcript_id : NM_027061.1

name	Zpbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789100 GeneID:69376 MGI:1916626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida binding protein 2 transcript_id : NM_199419.2

name	Ormdl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373134 GeneID:66612 MGI:1913862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ORM1-like 3 (S. cerevisiae) transcript_id : NM_025661.2

name	Gm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262454 GeneID:192852 MGI:2684858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : gene model 12, (NCBI) transcript_id : XM_001476985.1

name	LOC100040117 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262411 GeneID:100040117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 218 ESTs product : hypothetical protein LOC100040117 transcript_id : XM_001474109.1

name	Gsdm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55925615 GeneID:450219 MGI:3044668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin 3 transcript_id : NM_001007461.1

name	Gsdm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270962 GeneID:76758 MGI:1921490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin 2 transcript_id : NM_029727.2

name	Gsdm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385860 GeneID:57911 MGI:1889509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin 1 transcript_id : NM_021347.3

name	Psmd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19705423 GeneID:22123 MGI:98858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 transcript_id : NM_009439.1

name	Csf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753535 GeneID:12985 MGI:1339751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 3 (granulocyte) transcript_id : NM_009971.1

name	Thrap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119220578 GeneID:23989 MGI:1344385
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor associated protein 4 transcript_id : NM_011869.2

name	Thra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130347 GeneID:21833 MGI:98742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor alpha transcript_id : NM_178060.3

name	Nr1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625907 GeneID:217166 MGI:2444210
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group D, member 1 transcript_id : NM_145434.2

name	4121402D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311987 GeneID:74026 MGI:1921276
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4121402D02 gene transcript_id : NM_028722.1

name	Casc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149743 GeneID:192160 MGI:2179723
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cancer susceptibility candidate 3 transcript_id : NM_138660.1

name	Rapgefl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124257962 GeneID:268480 MGI:3611446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF)-like 1 transcript_id : NM_001080925.1

name	Wipf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537555 GeneID:68524 MGI:1924462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS/WASL interacting protein family, member 2 transcript_id : NM_197940.1

name	Cdc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061452 GeneID:23834 MGI:1345150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 6 homolog (S. cerevisiae) transcript_id : NM_001025779.1

name	Cdc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061472 GeneID:23834 MGI:1345150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 6 homolog (S. cerevisiae) transcript_id : NM_011799.2

name	Rara (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116734872 GeneID:19401 MGI:97856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid receptor, alpha transcript_id : NM_009024.2

name	Gjc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174743 GeneID:353155 MGI:2384150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein chi 1 transcript_id : NM_178596.2

name	Top2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755848 GeneID:21973 MGI:98790
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : topoisomerase (DNA) II alpha transcript_id : NM_011623.1

name	Igfbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130042 GeneID:16010 MGI:96439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 4 transcript_id : NM_010517.3

name	Tns4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382709 GeneID:217169 MGI:2144377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tensin 4 transcript_id : NM_172564.2

name	Ccr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268120 GeneID:12775 MGI:103011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 7 transcript_id : NM_007719.2

name	Smarce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41055974 GeneID:57376 MGI:1927347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 transcript_id : NM_020618.3

name	Krt222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348964 GeneID:268481 MGI:2442728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 222 transcript_id : NM_172946.2

name	Krt24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122425579 GeneID:75706 MGI:1922956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 24 transcript_id : NM_029393.1

name	Krt25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526921 GeneID:70810 MGI:1918060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 25 transcript_id : NM_133730.1

name	Krt26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375557 GeneID:320864 MGI:2444913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 26 transcript_id : NM_001033397.2

name	Krt27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106336 GeneID:16675 MGI:1339999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 27 transcript_id : NM_010666.1

name	Krt10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983635 GeneID:16661 MGI:96685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 10 transcript_id : NM_010660.2

name	A830036E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130980 GeneID:268482 MGI:3686876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830036E02 gene transcript_id : NM_010661.2

name	Krt20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21592284 GeneID:66809 MGI:1914059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 20 transcript_id : NM_023256.1

name	Krt23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15431280 GeneID:94179 MGI:2148866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 23 transcript_id : NM_033373.1

name	Krt39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523982 GeneID:237934 MGI:3588208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 39 transcript_id : NM_213730.1

name	Krt40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179317 GeneID:406221 MGI:3629968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 40 transcript_id : NM_001039666.1

name	Krtap3-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367458 GeneID:66380 MGI:1913630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 3-3 transcript_id : NM_025524.2

name	Krtap3-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801669 GeneID:66708 MGI:1913958
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 3-2 transcript_id : NM_025720.2

name	Krtap3-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390787 GeneID:69473 MGI:1916723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 6 Proteins product : keratin associated protein 3-1 transcript_id : XM_894811.2

name	2310043L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801820 GeneID:69664 MGI:1916914
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310043L02 gene transcript_id : NM_027157.2

name	OTTMUSG00000004966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363747 GeneID:629873 MGI:3651229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000004966 transcript_id : NM_001039502.2

name	LOC435273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262469 GeneID:435273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : novel protein similar to keratin associated protein 1 family KRTAP1 member (Homo sapiens), transcript variant 2 transcript_id : XM_001477708.1

name	LOC435273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262467 GeneID:435273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : novel protein similar to keratin associated protein 1 family KRTAP1 member (Homo sapiens), transcript variant 1 transcript_id : XM_001477694.1

name	2310040M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378018 GeneID:75586 MGI:1922836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310040M23 gene transcript_id : NM_029351.2

name	LOC100041412 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262471 GeneID:100041412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Krtap2-4 protein transcript_id : XM_001477731.1

name	LOC100041488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262480 GeneID:100041488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Krtap2-4 protein transcript_id : XM_001477787.1

name	Krtap2-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262475 GeneID:71453 MGI:1918703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins product : keratin associated protein 2-4 transcript_id : XM_001477761.1

name	LOC100041477 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262478 GeneID:100041477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Krtap2-4 protein transcript_id : XM_001477779.1

name	A030010K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796651 GeneID:665891 MGI:3622079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030010K20 gene transcript_id : NM_001048196.1

name	1110033F04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687894 GeneID:68673 MGI:1915923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110033F04 gene transcript_id : NM_026807.2

name	Krtap4-7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539646 GeneID:76444 MGI:1923694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 4-7 transcript_id : NM_029613.1

name	LOC546511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262482 GeneID:546511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to novel member of the keratin associated protein 4 (Krtap4) family transcript_id : XM_001477815.1

name	LOC100040248 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262417 GeneID:100040248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to Keratin associated protein 4-7 transcript_id : XM_001474347.1

name	1110054P19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390798 GeneID:68768 MGI:1916018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 16 Proteins product : RIKEN cDNA 1110054P19 gene transcript_id : XM_980319.1

name	LOC100040276 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262421 GeneID:100040276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001474404.1

name	LOC665992 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390802 GeneID:665992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : novel member of the keratin associated protein 4 (Krtap4) family transcript_id : XM_980769.1

name	LOC665998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390804 GeneID:665998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : novel member of the keratin associated protein 4 (Krtap4) family transcript_id : XM_980798.1

name	LOC670464 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262485 GeneID:670464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001477853.1

name	LOC670472 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262489 GeneID:670472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 7 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001477869.1

name	LOC670482 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262491 GeneID:670482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1 EST, 9 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001477882.1

name	2300006N05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802685 GeneID:69464 MGI:1916714
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2300006N05 gene transcript_id : NM_027087.2

name	LOC670496 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262423 GeneID:670496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to 2300006N05Rik protein transcript_id : XM_001474444.1

name	LOC629924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390814 GeneID:629924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to SMT3B protein transcript_id : XM_894864.2

name	OTTMUSG00000002196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000679 GeneID:435285 MGI:3651030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000002196 transcript_id : NM_001013823.1

name	OTTMUSG00000002191 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262428 GeneID:432600 MGI:3652067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : predicted gene, OTTMUSG00000002191 transcript_id : XM_001474519.1

name	Krtap9-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657286 GeneID:16705 MGI:1309997
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 9-1 transcript_id : NM_015741.1

name	LOC670533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262430 GeneID:670533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to ultra-high sulphur keratin transcript_id : XM_001474555.1

name	4733401H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803049 GeneID:70831 MGI:1918081
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4733401H21 gene transcript_id : NM_027568.2

name	OTTMUSG00000002177 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803535 GeneID:432602 MGI:3650789
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000002177 transcript_id : NM_001025244.2

name	LOC435286 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390819 GeneID:435286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : putative novel member of the keratin associated protein (Krtap) family transcript_id : XM_487191.3

name	A030006P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262502 GeneID:77914 MGI:1925164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA A030006P16 gene transcript_id : XM_001477954.1

name	Krt33a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803035 GeneID:71888 MGI:1919138
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 33A transcript_id : NM_027983.2

name	Krt33b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262434 GeneID:16671 MGI:1309991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 55 Proteins product : keratin 33B transcript_id : XM_981536.2

name	Krt34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803093 GeneID:16672 MGI:1309994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 34 transcript_id : NM_027563.2

name	Krt31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754483 GeneID:16660 MGI:1309993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 31 transcript_id : NM_010659.1

name	Krt32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378049 GeneID:16670 MGI:1309995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 32 transcript_id : NM_010665.2

name	Krt35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393683 GeneID:53617 MGI:1858899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 35 transcript_id : NM_016880.1

name	Krt36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803029 GeneID:16673 MGI:109364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 36 transcript_id : NM_008472.2

name	Plxdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560781 CCDS:CCDS25333.1 GeneID:72324 MGI:1919574
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : tumor endothelial marker 7 product : plexin domain containing 1 protein_id : NP_082475.2

name	Arl5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402217 CCDS:CCDS25334.1 GeneID:217151 MGI:3028577
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : ADP-ribosylation factor-like 12 product : ADP-ribosylation-like factor 12 protein protein_id : NP_997114.1

name	Cacnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281728 CCDS:CCDS25335.1 GeneID:12295 MGI:102522
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015270 - dihydropyridine-sensitive calcium channel activity [Evidence IDA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform B is encoded by transcript variant variant 2; voltage-dependent calcium channel beta1 subunit product : calcium channel, voltage-dependent, beta 1 isoform B protein_id : NP_660099.1

name	Cacnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626026 CCDS:CCDS25336.1 GeneID:12295 MGI:102522
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015270 - dihydropyridine-sensitive calcium channel activity [Evidence IDA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform A is encoded by transcript variant variant 1; voltage-dependent calcium channel beta1 subunit product : calcium channel, voltage-dependent, beta 1 isoform A protein_id : NP_112450.1

name	Rpl19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677773 CCDS:CCDS25337.1 GeneID:19921 MGI:98020
definition	GO_component : GO:0005842 - cytosolic large ribosomal subunit (sensu Eukaryota) [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ribosomal protein L19 protein_id : NP_033104.1

name	Stac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122509 CCDS:CCDS25338.1 GeneID:217154 MGI:2144518
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : SH3 and cysteine rich domain 2 protein_id : NP_666140.1

name	Fbxl20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111494221 CCDS:CCDS25339.1 GeneID:72194 MGI:1919444
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 20 protein_id : NP_082425.1

name	LOC665606 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390780 GeneID:665606
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983200.1

name	Pparbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583906 GeneID:19014 MGI:1100846
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0035257 - nuclear hormone receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence TAS] [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP] [Evidence ISS]; GO:0007507 - heart development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence IMP] [Evidence IDA]; GO:0006590 - thyroid hormone generation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Ppar binding protein isoform 2 protein_id : NP_598788.2

name	Pparbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582398 GeneID:19014 MGI:1100846
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0035257 - nuclear hormone receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence TAS] [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP] [Evidence ISS]; GO:0007507 - heart development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence IMP] [Evidence IDA]; GO:0006590 - thyroid hormone generation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : Ppar binding protein isoform 3 protein_id : NP_001073587.1

name	Pparbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582430 CCDS:CCDS25341.1 GeneID:19014 MGI:1100846
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0035257 - nuclear hormone receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence TAS] [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP] [Evidence ISS]; GO:0007507 - heart development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence IMP] [Evidence IDA]; GO:0006590 - thyroid hormone generation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Ppar binding protein isoform 1 protein_id : NP_038662.2

name	LOC100039982 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262406 GeneID:100039982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473941.1

name	Crkrs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794424 CCDS:CCDS25342.1 GeneID:69131 MGI:1098802
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : protein kinase for splicing component; CDC2-related kinase 7 product : CDC2-related protein kinase 7 protein_id : NP_081228.1

name	Neurod2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982781 CCDS:CCDS25343.1 GeneID:18013 MGI:107755
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008306 - associative learning [Evidence IMP]; GO:0001662 - behavioral fear response [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048666 - neuron development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : neurogenic differentiation 2 protein_id : NP_035025.2

name	Ppp1r1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536256 CCDS:CCDS25344.1 GeneID:19049 MGI:94860
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence TAS]; GO:0008599 - protein phosphatase type 1 regulator activity [Evidence IEA]; GO:0004865 - type 1 serine/threonine specific protein phosphatase inhibitor activity [Evidence TAS] GO_process : GO:0007621 - negative regulation of female receptivity [Evidence IMP] [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IMP] codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 1B protein_id : NP_659077.1

name	Stard3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946984 CCDS:CCDS25345.1 GeneID:59045 MGI:1929618
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005770 - late endosome [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015485 - cholesterol binding [Evidence IEA]; GO:0017127 - cholesterol transporter activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : steroidogenic acute regulatory protein related product : START domain containing 3 protein_id : NP_067522.1

name	Tcap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248560 CCDS:CCDS25346.1 GeneID:21393 MGI:1330233
definition	GO_component : GO:0030018 - Z disc [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045214 - sarcomere organization [Evidence ISS] codon_start : 1 note : Telethonin product : titin-cap protein_id : NP_035670.2

name	Pnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679405 CCDS:CCDS25347.1 GeneID:18948 MGI:97724
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0004603 - phenylethanolamine N-methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042423 - catecholamine biosynthesis [Evidence IEA] codon_start : 1 product : phenylethanolamine-N-methyltransferase protein_id : NP_032916.1

name	Perld1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326508 CCDS:CCDS25348.1 GeneID:320655 MGI:2444461
definition	codon_start : 1 product : per1-like domain containing 1 protein_id : NP_001028709.2

name	Erbb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873610 CCDS:CCDS25349.1 GeneID:13866 MGI:95410
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence NAS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0042552 - myelination [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0045765 - regulation of angiogenesis [Evidence NAS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 note : Neu oncogene; avian erythroblastosis oncogene B 2 product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog protein_id : NP_001003817.1

name	1810046J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384990 CCDS:CCDS25350.1 GeneID:103742 MGI:1913678
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 note : novel protein similar to C17orf37 product : hypothetical protein LOC103742 protein_id : NP_079835.1

name	Grb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754066 CCDS:CCDS25351.1 GeneID:14786 MGI:102683
definition	GO_component : GO:0005829 - cytosol [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : growth factor receptor bound protein 7 protein_id : NP_034476.1

name	Ikzf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374152 CCDS:CCDS25352.1 GeneID:22780 MGI:1342542
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein, subfamily 1A, 3 (Aiolos) product : aiolos protein_id : NP_035901.1

name	Zpbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40786389 CCDS:CCDS25353.1 GeneID:69376 MGI:1916626
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : zona pellucida binding protein 2 isoform 1 protein_id : NP_081337.1

name	Zpbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40786536 CCDS:CCDS25354.1 GeneID:69376 MGI:1916626
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : zona pellucida binding protein 2 isoform 2 protein_id : NP_955451.1

name	Ormdl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385128 CCDS:CCDS25355.1 GeneID:66612 MGI:1913862
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : ORM1-like 3 protein_id : NP_079937.1

name	Gm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262455 GeneID:192852 MGI:2684858
definition	codon_start : 1 product : similar to hCG2044133 protein_id : XP_001477035.1

name	LOC100040117 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262412 GeneID:100040117
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474159.1

name	Gsdm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925616 CCDS:CCDS25356.1 GeneID:450219 MGI:3044668
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0042637 - catagen [Evidence IMP]; GO:0042633 - hair cycle [Evidence IMP]; GO:0001942 - hair follicle development [Evidence IMP]; GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0001949 - sebaceous gland cell differentiation [Evidence IMP] codon_start : 1 note : bare skin; defolliculated product : gasdermin 3 protein_id : NP_001007462.1

name	Gsdm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270963 GeneID:76758 MGI:1921490
definition	codon_start : 1 product : gasdermin 2 protein_id : NP_084003.2

name	Gsdm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946666 CCDS:CCDS25358.1 GeneID:57911 MGI:1889509
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] codon_start : 1 product : gasdermin 1 protein_id : NP_067322.1

name	Psmd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19705424 CCDS:CCDS25359.1 GeneID:22123 MGI:98858
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : tissue specific transplantation antigen P91A product : proteasome 26S non-ATPase subunit 3 protein_id : NP_033465.1

name	Csf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753536 CCDS:CCDS25360.1 GeneID:12985 MGI:1339751
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] [Evidence NAS]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005138 - interleukin-6 receptor binding [Evidence IEA] GO_process : GO:0030851 - granulocyte differentiation [Evidence NAS]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : colony stimulating factor 3 protein_id : NP_034101.1

name	Thrap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119220579 CCDS:CCDS25361.1 GeneID:23989 MGI:1344385
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006366 - transcription from RNA polymerase II promoter [Evidence IMP] codon_start : 1 note : peroxisome proliferation activation receptor binding protein 2; thyroid hormone receptor-associated protein 100 kDa; genetic suppressor element 2 product : thyroid hormone receptor-associated protein 4 protein_id : NP_035999.2

name	Thra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017357 CCDS:CCDS25362.1 GeneID:21833 MGI:98742
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001502 - cartilage condensation [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0001503 - ossification [Evidence IMP]; GO:0007582 - physiological process [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TR alpha 1; c-erbAalpha; TR alpha 2 product : thyroid hormone receptor alpha protein_id : NP_835161.1

name	Nr1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625908 CCDS:CCDS25363.1 GeneID:217166 MGI:2444210
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : rev-erbA(alpha); REV-ERBalpha; Rev-ErbA-alpha protein; nuclear receptor protein; rev-erb alpha; rev-erbA alpha; orphan nuclear receptor product : nuclear receptor subfamily 1, group D, member 1 protein_id : NP_663409.2

name	4121402D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311988 CCDS:CCDS25364.1 GeneID:74026 MGI:1921276
definition	codon_start : 1 exception : mismatches in translation note : male-specific lethal-1 homolog product : hampin protein_id : NP_082998.1

name	Casc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149744 GeneID:192160 MGI:2179723
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008298 - intracellular mRNA localization [Evidence IDA]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : Barentsz product : metastatic lymph node 51 protein_id : NP_619601.1

name	Rapgefl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124257963 GeneID:268480 MGI:3611446
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : Rap guanine nucleotide exchange factor (GEF)-like 1 protein_id : NP_001074394.1

name	Wipf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537556 CCDS:CCDS25366.1 GeneID:68524 MGI:1924462
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : WASP-binding protein; novel protein similar to WIRE protein product : Wire protein protein_id : NP_922922.1

name	Cdc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753368 CCDS:CCDS25367.1 GeneID:23834 MGI:1345150
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CDC18(S.pombe); cell division cycle 18 homolog (S.pombe)-like product : cell division cycle 6 homolog isoform a protein_id : NP_035929.1

name	Cdc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061453 CCDS:CCDS25368.1 GeneID:23834 MGI:1345150
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CDC18(S.pombe); cell division cycle 18 homolog (S.pombe)-like product : cell division cycle 6 homolog isoform b protein_id : NP_001020950.1

name	Rara (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116734873 GeneID:19401 MGI:97856
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003708 - retinoic acid receptor activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA]; GO:0001657 - ureteric bud development [Evidence IMP] codon_start : 1 note : RAR alpha 1 product : retinoic acid receptor, alpha protein_id : NP_033050.2

name	Gjc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174744 CCDS:CCDS25369.1 GeneID:353155 MGI:2384150
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005922 - connexon complex [Evidence ISS]; GO:0005921 - gap junction [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0015285 - connexon channel activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007154 - cell communication [Evidence ISS]; GO:0016264 - gap junction assembly [Evidence ISS] codon_start : 1 note : connexin-30.2; connexin 30.2 product : gap junction membrane channel protein chi 1 protein_id : NP_848711.2

name	Top2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755849 CCDS:CCDS25370.1 GeneID:21973 MGI:98790
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003918 - DNA topoisomerase (ATP-hydrolyzing) activity [Evidence IGI] [Evidence IDA]; GO:0003916 - DNA topoisomerase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030261 - chromosome condensation [Evidence IMP]; GO:0007059 - chromosome segregation [Evidence IMP] [Evidence IDA]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006265 - DNA topological change [Evidence IDA]; GO:0006268 - DNA unwinding during replication [Evidence IEA]; GO:0040016 - embryonic cleavage [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DNA Topoisomerase II alpha product : topoisomerase (DNA) II alpha protein_id : NP_035753.1

name	Igfbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6981086 CCDS:CCDS25371.1 GeneID:16010 MGI:96439
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : differentially expressed in B16F10 2; Band 3A product : insulin-like growth factor binding protein 4 protein_id : NP_034647.1

name	Tns4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369790 CCDS:CCDS25372.1 GeneID:217169 MGI:2144377
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C-terminal tensin-like protein_id : NP_766152.1

name	Ccr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268121 CCDS:CCDS25373.1 GeneID:12775 MGI:103011
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-C) receptor 7 product : chemokine (C-C motif) receptor 7 protein_id : NP_031745.2

name	Smarce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181166 CCDS:CCDS25374.1 GeneID:57376 MGI:1927347
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 note : BAF57 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 protein_id : NP_065643.1

name	Krt222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370460 CCDS:CCDS25375.1 GeneID:268481 MGI:2442728
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : RIKEN cDNA 6330509G02 protein_id : NP_766534.1

name	Krt24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122425580 GeneID:75706 MGI:1922956
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : ortholog of keratin 24 KRT24 product : keratin 24 protein_id : NP_083669.1

name	Krt25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526922 CCDS:CCDS25377.1 GeneID:70810 MGI:1918060
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : type I keratin KA38 product : keratin 25A protein_id : NP_598491.1

name	Krt26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701899 CCDS:CCDS25378.1 GeneID:320864 MGI:2444913
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin 25B protein_id : NP_001028569.1

name	Krt27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106337 CCDS:CCDS25379.1 GeneID:16675 MGI:1339999
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin complex-1, gene C29 product : keratin complex-1, acidic, gene C29 protein_id : NP_034796.1

name	Krt10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983636 CCDS:CCDS25380.1 GeneID:16661 MGI:96685
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : suprabasal cytokeratin 10; epidermal keratin 10; intermediate filament protein product : keratin complex 1, acidic, gene 10 protein_id : NP_034790.2

name	A830036E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130981 GeneID:268482 MGI:3686876
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin 12 product : keratin complex 1, acidic, gene 12 protein_id : NP_034791.2

name	Krt20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21592285 CCDS:CCDS25381.1 GeneID:66809 MGI:1914059
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : cytokeratin 20 product : keratin 20 protein_id : NP_075745.1

name	Krt23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15431281 CCDS:CCDS25382.1 GeneID:94179 MGI:2148866
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : type I intermediate filament cytokeratin product : keratin complex 1, acidic, gene 23 protein_id : NP_203537.1

name	Krt39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523983 CCDS:CCDS25383.1 GeneID:237934 MGI:3588208
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 exception : mismatches in translation product : type I hair keratin KA35 protein_id : NP_998895.1

name	Krt40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179318 GeneID:406221 MGI:3629968
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : ortholog of type I hair keratin KA36 product : type I hair keratin KA36 protein_id : NP_001034755.1

name	Krtap3-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536226 CCDS:CCDS25385.1 GeneID:66380 MGI:1913630
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : keratin associated protein 3-2 product : keratin associated protein 3-3 protein_id : NP_079800.1

name	Krtap3-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094993 CCDS:CCDS25386.1 GeneID:66708 MGI:1913958
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin associated protein 3-2 protein_id : NP_079996.1

name	Krtap3-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935164 GeneID:69473 MGI:1916723
definition	codon_start : 1 product : keratin associated protein 3-1 protein_id : XP_899904.1

name	2310043L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386206 CCDS:CCDS25388.1 GeneID:69664 MGI:1916914
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69664 protein_id : NP_081433.1

name	OTTMUSG00000004966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87196521 GeneID:629873 MGI:3651229
definition	codon_start : 1 note : novel protein similar to keratin associated protein 1 family KRTAP1 member product : hypothetical protein LOC629873 protein_id : NP_001034591.1

name	LOC435273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262470 GeneID:435273
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477758.1

name	LOC435273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262468 GeneID:435273
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477744.1

name	2310040M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378019 GeneID:75586 MGI:1922836
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : novel protein similar to keratin associated protein 1 family KRTAP1 member product : hypothetical protein LOC75586 protein_id : NP_083627.2

name	LOC100041412 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262472 GeneID:100041412
definition	codon_start : 1 product : similar to Krtap2-4 protein protein_id : XP_001477781.1

name	LOC100041488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262481 GeneID:100041488
definition	codon_start : 1 product : similar to Krtap2-4 protein protein_id : XP_001477837.1

name	Krtap2-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262476 GeneID:71453 MGI:1918703
definition	codon_start : 1 product : keratin associated protein 2-4 protein_id : XP_001477811.1

name	LOC100041477 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262479 GeneID:100041477
definition	codon_start : 1 product : similar to Krtap2-4 protein protein_id : XP_001477829.1

name	A030010K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114796652 GeneID:665891 MGI:3622079
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : novel member of the keratin associated protein 4 (Krtap4) family product : hypothetical protein LOC665891 protein_id : NP_001041661.1

name	1110033F04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114687895 CCDS:CCDS25392.1 GeneID:68673 MGI:1915923
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : novel member of the keratin associated protein 4 (Krtap4) family product : hypothetical protein LOC68673 protein_id : NP_081083.2

name	Krtap4-7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539647 CCDS:CCDS25393.1 GeneID:76444 MGI:1923694
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 product : keratin associated protein 4-7 protein_id : NP_083889.1

name	LOC546511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262483 GeneID:546511
definition	codon_start : 1 product : similar to novel member of the keratin associated protein 4 (Krtap4) family protein_id : XP_001477865.1

name	LOC100040248 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262418 GeneID:100040248
definition	codon_start : 1 product : similar to Keratin associated protein 4-7 protein_id : XP_001474397.1

name	1110054P19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390799 GeneID:68768 MGI:1916018
definition	codon_start : 1 product : hypothetical protein LOC68768 protein_id : XP_985413.1

name	LOC100040276 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262422 GeneID:100040276
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474454.1

name	LOC665992 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390803 GeneID:665992
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985863.1

name	LOC665998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390805 GeneID:665998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985892.1

name	LOC670464 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262486 GeneID:670464
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477903.1

name	LOC670472 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262490 GeneID:670472
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477919.1

name	LOC670482 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262492 GeneID:670482
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477932.1

name	2300006N05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386198 GeneID:69464 MGI:1916714
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 note : novel member of the keratin associated protein 4 (Krtap4) family product : hypothetical protein LOC69464 protein_id : NP_081363.1

name	LOC670496 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262424 GeneID:670496
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474494.1

name	LOC629924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390815 GeneID:629924
definition	codon_start : 1 product : similar to SMT3B protein protein_id : XP_899957.2

name	OTTMUSG00000002196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000680 GeneID:435285 MGI:3651030
definition	codon_start : 1 product : keratin associated protein 4 family member protein_id : NP_001013845.1

name	OTTMUSG00000002191 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262429 GeneID:432600 MGI:3652067
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474569.1

name	Krtap9-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657287 CCDS:CCDS25399.1 GeneID:16705 MGI:1309997
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 9.1; keratin-associated protein 9-1 product : keratin associated protein 9-1 protein_id : NP_056556.1

name	LOC670533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262431 GeneID:670533
definition	codon_start : 1 product : similar to ultra-high sulphur keratin protein_id : XP_001474605.1

name	4733401H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312558 CCDS:CCDS25400.1 GeneID:70831 MGI:1918081
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 note : keratin-associated protein; novel member of the keratin associated protein (Krtap) family product : hypothetical protein LOC70831 protein_id : NP_081844.1

name	OTTMUSG00000002177 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68989245 GeneID:432602 MGI:3650789
definition	codon_start : 1 note : novel member of the keratin associated protein (Krtap) family product : hypothetical protein LOC432602 protein_id : NP_001020415.1

name	LOC435286 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390820 GeneID:435286
definition	codon_start : 1 product : similar to putative novel member of the keratin associated protein (Krtap) family protein_id : XP_487191.3

name	A030006P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262503 GeneID:77914 MGI:1925164
definition	codon_start : 1 product : similar to ortholog of human keratin associated protein 17-1 KRTAP17-1 protein_id : XP_001478004.1

name	Krt33a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386274 CCDS:CCDS25403.1 GeneID:71888 MGI:1919138
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2310015J09 protein_id : NP_082259.1

name	Krt33b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262435 GeneID:16671 MGI:1309991
definition	codon_start : 1 product : keratin complex 1, acidic, gene 3 protein_id : XP_986630.2

name	Krt34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386238 CCDS:CCDS25404.1 GeneID:16672 MGI:1309994
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : keratin complex 1, acidic, gene 4 protein_id : NP_081839.1

name	Krt31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754484 CCDS:CCDS25405.1 GeneID:16660 MGI:1309993
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : keratin complex 1, gene 1 product : keratin complex 1, acidic, gene 1 protein_id : NP_034789.1

name	Krt32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754486 CCDS:CCDS25406.1 GeneID:16670 MGI:1309995
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : keratin complex 1, gene 2 product : keratin complex 1, acidic, gene 2 protein_id : NP_034795.1

name	Krt35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393684 CCDS:CCDS25407.1 GeneID:53617 MGI:1858899
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : hair keratin acidic 5; keratin complex 1, gene 24; keratin complex 1, acidic, gene 24 product : keratin, hair, acidic, 5 protein_id : NP_058576.1

name	Krt36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625599 CCDS:CCDS25408.1 GeneID:16673 MGI:109364
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin complex 1, gene 5; keratin 5 product : keratin complex 1, acidic, gene 5 protein_id : NP_032498.1

name	LOC100040200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040200
definition	number : 2 pseudo : _no_value

name	LOC100040200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040200
definition	number : 1 pseudo : _no_value

name	LOC666613 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262451 GeneID:666613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 465 ESTs, 5 Proteins product : similar to ribosomal protein S6 pseudo : _no_value transcript_id : XR_035670.1

name	LOC665922 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262473 GeneID:665922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 109 ESTs, 21 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_033379.1

name	LOC670550 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262500 GeneID:670550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to novel member of the keratin associated protein (Krtap) family pseudo : _no_value transcript_id : XR_033451.1

name	LOC630936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262501 GeneID:630936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 168 ESTs, 21 Proteins product : similar to nuclease sensitive element binding protein 1 pseudo : _no_value transcript_id : XR_001819.2

clone name	MSMg01-548B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304H22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358N18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-173B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-394L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388O06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-172P12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-452B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-300D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-174N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-324A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148K18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-150G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548P13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-483K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-238C03.b	B6Ng01-238C03.g
ACC	GA048908	GA048909
length	1,117	1,034
definition	B6Ng01-238C03.b	B6Ng01-238C03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(98,969,077 - 98,970,211)	(98,844,693 - 98,845,728)
sequence	gaattcctccagagatcagggagaggagaaagatgaggagggacccacac tgtgtactcccctcctgttcatgagatatcgcctggtttaatcctcacag ccaccatttaagggtgactctctgacacccctatttgataaatggtaagg ctgagctcagcaggaagccttgacctaagcttgccaggccaggaagcaga cgtgaatacaagagcctccacacttgcacagggagatagaactcagaaga caaacacccctgaccctagttcacagtgcccctggctgtgcacattgacg aagatactgactaaagggctcagagactgctctgagcactgcattctcca gggtgtggtgaactactcctaattctgcaggatgtgtctgtgtttgtatt gctgagtctccagggatgtaaggtgaccacagggaattcccttggaggcc tggttcctacagctcactggaggacattccacatggaaccattcatccat cctgacgagactggggagttctggggaggcatcgccaacataaagccaaa gtatggacagactgtgaaggtcagaatggaccaggggactccaggggcag cagagaatttaagagtaaggttcactcaccaggatgttgtgacagaggat gcaggctctgcctcctgtggtcctgccttggtgacattaaacttttacaa gtaaggaaacaggggctggtgagatggcttagttggtaagagtacccgac tgctcttcagaagtccagagttcaaatcctagcaaccacatggtggctca caaccatctgtaacgagatctgatgccctcttctggagtgtctgaagaca gctacagtgtactttacatataataaataaataaatcttgaaaaaaaaaa aacaagtaaaggaaacagaggccaaagaaccccccccaccatgcaagtca ggtcagctttggccttctgtcacatctcacagccagttcagctacagagt gagacactatccaaaaatgtgctcagagatacagggactcaggttctctg gatttagtacctggcttgaaccaagagactctgttagctgtagttcctgg gggaggttaagttctcc	gaattctacgttccttctgtttgagacccctgggagcaaggggagggcca ggccgggtgagcccccactgtctcctttctctctcacctcgcagcaggga acgccttttggggttggaagctgacacagaagcctgtttttccaacttag gatctctcgcccgccctcaatcttcccttcctcaccaacctcagccaagg agaccgggcacagccccctcgactcctctctgatagcaattatcaagcat ctcttgtaagcctccccagacacacagaatacaccacgtcccgtccctgt agacccttagtggcctctagatgtccccaaccccacttaccccgggacct gggccttagagctgagcggaggaccttgagagacagctgggacctgtccc tctgggtccctctttcattttcctttttggctttggccgggatggatgat aggacaagtatggctgagaggggctagctctcccccttctcttaaaggga cagggtgacctgtggtccggctccaccctggaaatagatccagggccaca ccccttgttgggtccttcctgccttctctttccatcccttaccccccatg cccatcccatagccatgtctccatctggcgatggacggaggctaactaga gctacatttttttttttaattgagggagccagagagatcaatcatgggaa ccctatctcctggcagactcctcaaactgaagactaggtccaccacaacc aactgaccccatttttgaagggtcttgtgggccagagggagataacttcg gcttttaggggacaacaaatatggcttgggggggggggcttttggttctt gcccactattggaccctgggatgagccatgtaggtcacttgggctaagat ctctggtctgtccacctgagccagactaaactctaagatcttacttggtc ccaagaccgagtctcgctgtgtagtcagctggccaggaccttaccgtagt aggctcaggctgccctgaggtaatgatctcctgc
quality values	Open. Hide. 62 41 22 35 62 62 62 62 62 39 18 56 62 47 20 31 47 38 62 49 44 47 62 62 62 62 62 62 59 62 62 62 59 21 59 62 43 49 37 33 49 54 59 49 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 49 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 54 62 49 49 62 54 62 62 62 62 62 62 54 62 54 38 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 47 38 62 47 43 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 50 62 62 62 52 62 58 58 58 58 45 45 54 58 49 54 54 58 58 58 58 58 54 48 58 58 52 58 58 58 58 58 54 41 49 52 54 58 58 54 58 58 52 58 52 54 58 54 58 58 58 45 48 39 58 58 52 58 52 54 58 58 58 52 52 58 58 46 58 58 54 58 58 54 38 54 52 54 54 52 58 42 49 58 58 54 39 45 49 50 58 58 58 45 39 58 53 51 42 53 58 58 58 51 58 51 58 52 41 58 32 58 50 35 58 52 50 58 49 58 32 52 47 58 38 49 58 54 53 52 41 58 53 33 49 47 52 33 58 49 30 51 49 58 51 49 58 35 35 32 52 46 17 58 36 25 49 50 49 18 58 35 51 52 52 46 47 58 52 50 58 50 58 50 58 41 33 50 51 50 50 46 49 53 53 51 39 47 50 41 26 37 58 53 32 58 51 50 52 58 58 39 39 50 40 58 52 52 50 49 33 51 41 58 24 23 37 26 58 58 51 42 42 49 54 32 49 51 39 42 31 33 54 36 54 42 38 19 53 53 53 54 30 40 44 32 54 32 52 33 53 54 49 32 49 29 32 52 31 40 41 35 41 37 31 30 54 6 7 18 40 41 37 36 53 27 39 49 37 37 54 42 37 31 45 40 40 24 34 32 41 33 33 31 41 28 31 31 53 32 33 24 23 32 37 31 32 31 45 31 40 36 40 32 34 51 29 28 32 34 31 42 36 30 31 29 30 31 31 31 31 29 46 34 36 39 35 45 30 27 22 26 42 24 32 38 23 32 31 14 21 31 18 31 23 30 31 38 37 24 30 26 31 24 46 25 31 31 38 48 27 31 34 24 31 29 32 28 29 31 30 48 34 31 29 46 29 29 27 46 33 30 31 31 25 37 37 48 48 48 47 43 41 41 41 44 36 26 19 19 21 22 31 11 44 9 28 20 42 48 31 22 13 13 36 11 29 12 10 4 22 26 21 26 21 16 25 25 31 36 32 37 25 18 14 27 18 27 34 31 17 21 32 24 13 28 13 11 13 27 14 6 5 20 37 11 11 11 18 14 21 16 14 10 21 10 21 9 17 14 28 19 26 8 6 16 22 16 15 22 16 28 18 7 28 24 20 24 15 15 13 5 5 4 6 21 27 18 7 13 6 28 21 12 15 28 10 8 7 25 30 30 25 17 12 1 4 8 4 6 6 7 21 5 11 5 2 5 5 7 29 5 19 8 19 19 16 11 14 8 4 4 10 10 8 7 7 16 13 30 20 7 4 5 6 23 24 14 18 18 4 7 10 5 8 7 11 7 4 6 5 21 5 15 2 2 3 4 8 16 16 9 4 6 4 4 4 4 5 10 10 6 4 3 2 1 29 28 7 6 1 2 2 6 10 17 4 3 2 1 3 6 7	Open. Hide. 58 31 41 34 62 62 62 52 62 62 62 62 56 56 46 32 32 56 62 56 56 62 62 62 62 47 42 62 62 62 49 49 62 62 41 47 62 56 62 62 49 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 46 46 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 47 62 47 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 54 62 62 62 62 62 47 54 62 62 62 62 62 54 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 32 54 54 62 62 62 62 62 62 62 62 62 62 62 52 62 46 62 62 62 62 62 52 62 62 48 52 62 62 46 62 62 42 47 54 62 62 62 52 62 47 42 62 62 62 62 62 58 52 58 58 54 54 43 58 54 58 41 42 58 58 58 54 48 58 58 58 46 58 52 58 58 52 36 39 48 30 34 46 45 52 58 54 54 58 58 58 58 54 54 52 52 39 38 41 33 48 58 52 58 52 52 52 58 52 58 52 58 52 54 54 54 58 52 52 42 32 54 52 58 58 58 52 50 52 58 58 58 58 29 35 51 54 58 54 51 40 51 52 58 51 50 53 42 38 47 45 40 46 58 52 53 52 33 48 28 53 53 46 54 54 50 53 47 34 51 49 41 26 50 58 39 18 54 37 50 50 50 50 49 39 50 41 30 50 50 37 50 29 45 58 58 58 58 58 58 58 58 58 52 35 32 40 50 40 41 25 58 44 43 31 50 50 27 39 58 30 49 50 29 31 34 31 32 52 50 31 38 50 58 51 50 27 16 49 53 39 39 52 42 42 35 33 30 37 42 39 35 31 38 18 45 35 33 41 26 39 54 42 31 45 45 41 41 34 31 21 34 28 18 38 28 31 51 31 37 43 32 45 29 33 53 31 19 51 32 32 39 20 12 54 54 34 22 32 52 52 52 53 30 27 28 21 49 41 29 40 53 26 47 18 40 47 46 16 20 31 13 30 22 49 26 41 21 33 17 26 42 34 37 44 27 18 10 15 33 51 46 31 25 15 46 40 26 34 19 27 26 31 16 51 26 30 28 31 24 44 25 23 22 22 46 46 46 43 46 46 41 41 46 37 15 14 46 30 29 14 18 14 27 25 9 7 9 21 42 9 12 28 29 31 41 20 31 14 18 16 37 8 18 6 38 17 25 18 23 11 6 13 28 31 24 25 18 10 6 31 31 11 14 15 19 25 21 33 21 12 33 38 33 11 32 19 28 16 31 31 13 24 9 17 21 37 18 23 7 8 13 38 28 30 11 9 21 17 21 20 6 6 13 23 44 30 13 20 11 6 21 28 10 26 14 29 7 11 19 27 31 8 10 16 26 15 15 4 4 5 9 17 5 4 4 8 5 22 9 16 9 18 18 6 8 7 15 11 5 6 30 19 30 15 15 11 17 8 7 14 17 9 11 15 8 18 11 20 27 16 15 23 7 14 5 6 8 9 27 20 6 6 19 15 14 27 25 28 15 25 8 12 5 13 5 5 6 13 30 27 28 26 27 38 11 10 15 11 19 27

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_98969077_98970211
seq2: B6Ng01-238C03.b_46_1162 (reverse)

seq1  GGAGAAACTTAACCTCCCCCAGGAAC-ACAGCTAACAGATGTTCTCTTGG  49
      |||| ||||||||||||||||||||| ||||||||||||   ||||||||
seq2  GGAG-AACTTAACCTCCCCCAGGAACTACAGCTAACAGA--GTCTCTTGG  47

seq1  GTCTAGCCCAGGGTACTAAAATCCAGAG-ACCTGAGTCCCTTGGTATCTC  98
       || ||||   |||||| |||||||||| ||||||||||||  |||||||
seq2  TTCAAGCC--AGGTACT-AAATCCAGAGAACCTGAGTCCCT--GTATCTC  92

seq1  TGAGGCACCATTTTTTGGATAGGTTGTCTCACTTCCTTGTAGCTGGACTG  148
      ||| ||||   |||||||||||  |||||||||    |||||||| ||||
seq2  TGA-GCAC--ATTTTTGGATAG--TGTCTCACT---CTGTAGCTGAACTG  134

seq1  GCTGTGAGATGTGACAGAAGGCCAAAAGCCTGACCTTGACTTGCATGGTG  198
      ||||||||||||||||||||||||||   |||||| ||||||||||||||
seq2  GCTGTGAGATGTGACAGAAGGCCAAA--GCTGACC-TGACTTGCATGGTG  181

seq1  GGGGGGGTTCTTTGGGCCTCTGTTTCC-TTACTTGTTTTTTTTTTTTCAA  247
      ||||||||||||| ||||||||||||| ||||||||||||||||||||||
seq2  GGGGGGGTTCTTT-GGCCTCTGTTTCCTTTACTTGTTTTTTTTTTTTCAA  230

seq1  GATTTATTTATTTATTATATGTAAAGTACACTGTAGCTGTCTTCAGACAC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTATTTATTTATTATATGTAAAGTACACTGTAGCTGTCTTCAGACAC  280

seq1  TCCAGAAGAGGGCATCAGATCTCGTTACAGATGGTTGTGAGCCACCATGT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGAAGAGGGCATCAGATCTCGTTACAGATGGTTGTGAGCCACCATGT  330

seq1  GGTTGCTAGGATTTGAACTCTGGACCTTCTGAAGAGCAGTCGGGTACTCT  397
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  GGTTGCTAGGATTTGAACTCTGGA-CTTCTGAAGAGCAGTCGGGTACTCT  379

seq1  TACCAACTAAGCCATCTCACCAGCCCCTGTTTCCTTACTTGTAAAAGTTT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAACTAAGCCATCTCACCAGCCCCTGTTTCCTTACTTGTAAAAGTTT  429

seq1  AATGTCACCAAGGCAGGACCACAGGAGGCAGAGCCTGCATCCTCTGTCAC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTCACCAAGGCAGGACCACAGGAGGCAGAGCCTGCATCCTCTGTCAC  479

seq1  AACATCCTGGTGAGTGAACCTTACTCTTAAATTCTCTGCTGCCCCTGGAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATCCTGGTGAGTGAACCTTACTCTTAAATTCTCTGCTGCCCCTGGAG  529

seq1  TCCCCTGGTCCATTCTGACCTTCACAGTCTGTCCATACTTTGGCTTTATG  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTGGTCCATTCTGACCTTCACAGTCTGTCCATACTTTGGCTTTATG  579

seq1  TTGGCGATGCCTCCCCAGAACTCCCCAGTCTCGTCAGGATGGATGAATGG  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCGATGCCTCCCCAGAACTCCCCAGTCTCGTCAGGATGGATGAATGG  629

seq1  TTCCATGTGGAATGTCCTCCAGTGAGCTGTAGGAACCAGGCCTCCAAGGG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCATGTGGAATGTCCTCCAGTGAGCTGTAGGAACCAGGCCTCCAAGGG  679

seq1  AATTCCCTGTGGTCACCTTACATCCCTGGAGACTCAGCAATACAAACACA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCCCTGTGGTCACCTTACATCCCTGGAGACTCAGCAATACAAACACA  729

seq1  GACACATCCTGCAGAATTAGGAGTAGTTCACCACACCCTGGAGAATGCAG  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACATCCTGCAGAATTAGGAGTAGTTCACCACACCCTGGAGAATGCAG  779

seq1  TGCTCAGAGCAGTCTCTGAGCCCTTTAGTCAGTATCTTCGTCAATGTGCA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCAGAGCAGTCTCTGAGCCCTTTAGTCAGTATCTTCGTCAATGTGCA  829

seq1  CAGCCAGGGGCACTGTGAACTAGGGTCAGGGGTGTTTGTCTTCTGAGTTC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCAGGGGCACTGTGAACTAGGGTCAGGGGTGTTTGTCTTCTGAGTTC  879

seq1  TATCTCCCTGTGCAAGTGTGGAGGCTCTTGTATTCACGTCTGCTTCCTGG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTCCCTGTGCAAGTGTGGAGGCTCTTGTATTCACGTCTGCTTCCTGG  929

seq1  CCTGGCAAGCTTAGGTCAAGGCTTCCTGCTGAGCTCAGCCTTACCATTTA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCAAGCTTAGGTCAAGGCTTCCTGCTGAGCTCAGCCTTACCATTTA  979

seq1  TCAAATAGGGGTGTCAGAGAGTCACCCTTAAATGGTGGCTGTGAGGATTA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATAGGGGTGTCAGAGAGTCACCCTTAAATGGTGGCTGTGAGGATTA  1029

seq1  AACCAGGCGATATCTCATGAACAGGAGGGGAGTACACAGTGTGGGTCCCT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCAGGCGATATCTCATGAACAGGAGGGGAGTACACAGTGTGGGTCCCT  1079

seq1  CCTCATCTTTCTCCTCTCCCTGATCTCTGGAGGAATTC  1135
      ||||||||||||||||||||||||||||||||||||||
seq2  CCTCATCTTTCTCCTCTCCCTGATCTCTGGAGGAATTC  1117

seq1: chr11_98844693_98845728
seq2: B6Ng01-238C03.g_66_1099

seq1  GAATTCTACGTTCCTTCTGTTTGAGACCCCTGGGAGCAAGGGGAGGGCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACGTTCCTTCTGTTTGAGACCCCTGGGAGCAAGGGGAGGGCCA  50

seq1  GGCCGGGTGAGCCCCCACTGTCTCCTTTCTCTCTCACCTCGCAGCAGGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCGGGTGAGCCCCCACTGTCTCCTTTCTCTCTCACCTCGCAGCAGGGA  100

seq1  ACGCCTTTTGGGGTTGGAAGCTGACACAGAAGCCTGTTTTTCCAACTTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCCTTTTGGGGTTGGAAGCTGACACAGAAGCCTGTTTTTCCAACTTAG  150

seq1  GATCTCTCGCCCGCCCTCAATCTTCCCTTCCTCACCAACCTCAGCCAAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTCTCGCCCGCCCTCAATCTTCCCTTCCTCACCAACCTCAGCCAAGG  200

seq1  AGACCGGGCACAGCCCCCTCGACTCCTCTCTGATAGCAATTATCAAGCAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCGGGCACAGCCCCCTCGACTCCTCTCTGATAGCAATTATCAAGCAT  250

seq1  CTCTTGTAAGCCTCCCCAGACACACAGAATACACCACGTCCCGTCCCTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGTAAGCCTCCCCAGACACACAGAATACACCACGTCCCGTCCCTGT  300

seq1  AGACCCTTAGTGGCCTCTAGATGTCCCCAACCCCACTTACCCCGGGACCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCTTAGTGGCCTCTAGATGTCCCCAACCCCACTTACCCCGGGACCT  350

seq1  GGGCCTTAGAGCTGAGCGGAGGACCTTGAGAGACAGCTGGGACCTGTCCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCTTAGAGCTGAGCGGAGGACCTTGAGAGACAGCTGGGACCTGTCCC  400

seq1  TCTGGGTCCCTCTTTCATTTTCCTTTTTGGCTTTGGCCGGGATGGATGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGTCCCTCTTTCATTTTCCTTTTTGGCTTTGGCCGGGATGGATGAT  450

seq1  AGGACAAGTATGGCTGAGAGGGGCTAGCTCTCCCCCTTCTCTTAAAGGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACAAGTATGGCTGAGAGGGGCTAGCTCTCCCCCTTCTCTTAAAGGGA  500

seq1  CAGGGTGACCTGTGGTCCGGCTCCACCCTGGAAATAGATCCAGGGCCACA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTGACCTGTGGTCCGGCTCCACCCTGGAAATAGATCCAGGGCCACA  550

seq1  CCCCTTGTTGGGTCCTTCCTGCCTTCTCTTTCCATCCCTTACCCCCCATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTGTTGGGTCCTTCCTGCCTTCTCTTTCCATCCCTTACCCCCCATG  600

seq1  CCCATCCCATAGCCATGTCTCCATCTGGCGATGGACGGAGGCTAACTAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCCCATAGCCATGTCTCCATCTGGCGATGGACGGAGGCTAACTAGA  650

seq1  GCTACATTTTTTTTTTTAATTGAGGGAGCCAGAGAGATCAATCATGGGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTACATTTTTTTTTTTAATTGAGGGAGCCAGAGAGATCAATCATGGGAA  700

seq1  CCCTATCTCCTGGCAGACTCCTCAAACTGAAGACTAGGTCCACCACAACC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTATCTCCTGGCAGACTCCTCAAACTGAAGACTAGGTCCACCACAACC  750

seq1  AACTGACCCCATTTTTGAAGGGTCTTGTGGGCCAGAGGGAGATAACTTCG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGACCCCATTTTTGAAGGGTCTTGTGGGCCAGAGGGAGATAACTTCG  800

seq1  GCTTTTAGGGGACAACAAATATGGCTTTGGGGGGGGGGGGCTTTTGGTTC  850
      |||||||||||||||||||||||||||  |||||||||||||||||||||
seq2  GCTTTTAGGGGACAACAAATATGGCTT--GGGGGGGGGGGCTTTTGGTTC  848

seq1  T--GCCACTATTGGA-CCTTGGATGAGCCATGTAGGTCACTTGGGCTAAG  897
      |   ||||||||||| ||| ||||||||||||||||||||||||||||||
seq2  TTGCCCACTATTGGACCCTGGGATGAGCCATGTAGGTCACTTGGGCTAAG  898

seq1  ATCTCTTGGTCTGT-CACCTGAGCCAG-CTAAACTCTAAGATTCTTACTT  945
      ||||| |||||||| |||||||||||| ||||||||||||| ||||||||
seq2  ATCTC-TGGTCTGTCCACCTGAGCCAGACTAAACTCTAAGA-TCTTACTT  946

seq1  TGTTCCGAGACAGAGTCTCGCTGTGTAGTTCAAGCTGGCCAGGACCTTAC  995
       || || |||| |||||||||||||||||   ||||||||||||||||||
seq2  GGTCCCAAGACCGAGTCTCGCTGTGTAGT--CAGCTGGCCAGGACCTTAC  994

seq1  CGTA-TAGGC-CAGGCTGCCCTTGAAGTAAATGATCCTCCTGC  1036
      |||| ||||| |||||||||| ||| || |||||| |||||||
seq2  CGTAGTAGGCTCAGGCTGCCC-TGAGGT-AATGAT-CTCCTGC  1034

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information