MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242F16
Chromosome	11 (Build37)
Map Location	102,311,001 - 102,420,933
singlet/doublet	doublet
Overlap gene	Itga2b, Mdk-ps1
Upstream gene	Ifi35, Vat1, Rnd2, Brca1, Nbr1, Tmem106a, LOC667306, Rdm1, Arl4d, LOC100038842, Dhx8, Etv4, Meox1, LOC194960, Sost, Dusp3, 1700006E09Rik, Mpp3, Cd300lg, Mpp2, Ppy, Pyy, LOC100040687, LOC666411, Nags, Tmem101, Lsm12, G6pc3, Hdac5, BC030867, Asb16, 2010008E23Rik, Ubtf, Slc4a1, Rap2ip, Slc25a39, Grn, BC025575
Downstream gene	LOC100040792, Fzd2, 2810433D01Rik, Psmb5-ps, Gm1564, LOC100042456, Ccdc43, Adam11, Gja7, Higd1b, Eftud2, Ccdc103, LOC100042500, Gfap, 3000004C01Rik, C1ql1, Dcakd, Nmt1, Plcd3, Acbd4, Hexim1, Hexim2, Fmnl1, 4933400C05Rik, Map3k14, Arhgap27, 5730442P18Rik, Plekhm1, Lrrc37a, Gm884
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ifi35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70110 MGI:1917360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26949 MGI:1349450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11858 MGI:1338755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12189 MGI:104537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17966 MGI:108498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem106a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217203 MGI:1922056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rdm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66599 MGI:1913849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80981 MGI:1933155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217207 MGI:1306823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etv4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18612 MGI:99423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Meox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17285 MGI:103220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 6 Proteins

name	Sost (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74499 MGI:1921749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72349 MGI:1919599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700006E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75437 MGI:1922687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 2 Proteins

name	Mpp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13384 MGI:1328354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300lg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52685 MGI:1289168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50997 MGI:1858257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19064 MGI:97753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pyy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217212 MGI:99924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC666411 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 41 Proteins

name	Nags (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217214 MGI:2387600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76547 MGI:1923797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268490 MGI:1919592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	G6pc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68401 MGI:1915651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15184 MGI:1333784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC030867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217216 MGI:2387601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217217 MGI:2654437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010008E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72053 MGI:1919303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubtf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21429 MGI:98512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20533 MGI:109393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rap2ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51799 MGI:1858752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68066 MGI:1196386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14824 MGI:95832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217219 MGI:2448496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16399 MGI:96601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdk-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17243 MGI:103029
definition	gene_synonym : Mak-rs1 note : midkine pseudogene 1 pseudo : _no_value

name	LOC100040792 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Fzd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57265 MGI:1888513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810433D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77132 MGI:1924382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Psmb5-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19174 MGI:1194501
definition	note : proteasome (prosome, macropain) subunit, beta type 5, pseudogene pseudo : _no_value

name	Gm1564 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268491 MGI:2686410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins

name	LOC100042456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs

name	Ccdc43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52715 MGI:1289318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11488 MGI:1098667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gja7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14615 MGI:95718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75689 MGI:1922939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eftud2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20624 MGI:1336880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73293 MGI:1920543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 3 Proteins

name	Gfap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14580 MGI:95697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3000004C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70218 MGI:1917468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1ql1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23829 MGI:1344400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcakd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68087 MGI:1915337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18107 MGI:102579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72469 MGI:107451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acbd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67131 MGI:1914381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hexim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192231 MGI:2385923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hexim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71059 MGI:1918309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57778 MGI:1888994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933400C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328019 MGI:3045340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53859 MGI:1858204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544817 MGI:1916903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730442P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70559 MGI:1917809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353047 MGI:2443207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc37a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237954 MGI:2685097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Gm884 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380730 MGI:2685730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifi35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802826 GeneID:70110 MGI:1917360
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon-induced protein 35 transcript_id : NM_027320.3

name	Vat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364129 GeneID:26949 MGI:1349450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle amine transport protein 1 homolog (T californica) transcript_id : NM_012037.2

name	Rnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753115 GeneID:11858 MGI:1338755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho family GTPase 2 transcript_id : NM_009708.1

name	Brca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560811 GeneID:12189 MGI:104537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : breast cancer 1 transcript_id : NM_009764.2

name	Nbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130692 GeneID:17966 MGI:108498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neighbor of Brca1 gene 1 transcript_id : NM_008676.2

name	Tmem106a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803040 GeneID:217203 MGI:1922056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 106A transcript_id : NM_144830.3

name	Rdm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370751 GeneID:66599 MGI:1913849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD52 motif 1 transcript_id : NM_025654.2

name	Arl4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802517 GeneID:80981 MGI:1933155
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 4D transcript_id : NM_025404.2

name	LOC100038842 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262365 GeneID:100038842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038842 transcript_id : XM_001471772.1

name	Dhx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699439 GeneID:217207 MGI:1306823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 8 transcript_id : NM_144831.2

name	Etv4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582413 GeneID:18612 MGI:99423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 4 (E1A enhancer binding protein, E1AF) transcript_id : NM_008815.2

name	Meox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981618 GeneID:17285 MGI:103220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesenchyme homeobox 1 transcript_id : NM_010791.3

name	LOC194960 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262527 GeneID:194960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 6 Proteins product : similar to ribosomal protein L27 transcript_id : XM_110983.6

name	Sost (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803308 GeneID:74499 MGI:1921749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sclerostin transcript_id : NM_024449.4

name	Dusp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353670 GeneID:72349 MGI:1919599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) transcript_id : NM_028207.2

name	1700006E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390843 GeneID:75437 MGI:1922687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 2 Proteins product : RIKEN cDNA 1700006E09 gene transcript_id : XM_126493.4

name	Mpp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026922 GeneID:13384 MGI:1328354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) transcript_id : NM_007863.2

name	Cd300lg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376657 GeneID:52685 MGI:1289168
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300 antigen like family member G transcript_id : NM_027987.2

name	Mpp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347754 GeneID:50997 MGI:1858257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) transcript_id : NM_016695.2

name	Ppy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679452 GeneID:19064 MGI:97753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pancreatic polypeptide transcript_id : NM_008918.1

name	Pyy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703867 GeneID:217212 MGI:99924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptide YY transcript_id : NM_145435.1

name	LOC666411 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390844 GeneID:666411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 41 Proteins product : similar to Peptidyl-prolyl cis-trans isomerase H (PPIase H) (Rotamase H) transcript_id : XM_983649.1

name	Nags (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003873 GeneID:217214 MGI:2387600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglutamate synthase transcript_id : NM_145829.1

name	Nags (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383079 GeneID:217214 MGI:2387600
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglutamate synthase transcript_id : NM_178053.3

name	Tmem101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313231 GeneID:76547 MGI:1923797
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 101 transcript_id : NM_029649.1

name	Lsm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360438 GeneID:268490 MGI:1919592
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM12 homolog (S. cerevisiae) transcript_id : NM_172947.2

name	G6pc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271523 GeneID:68401 MGI:1915651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose 6 phosphatase, catalytic, 3 transcript_id : NM_175935.3

name	Hdac5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136298 GeneID:15184 MGI:1333784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 5 transcript_id : NM_010412.3

name	Hdac5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136294 GeneID:15184 MGI:1333784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 5 transcript_id : NM_001077696.1

name	BC030867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347504 GeneID:217216 MGI:2387601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC030867 transcript_id : NM_153544.3

name	Asb16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130162 GeneID:217217 MGI:2654437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing 16 transcript_id : NM_148953.2

name	2010008E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368789 GeneID:72053 MGI:1919303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010008E23 gene transcript_id : NM_028076.2

name	Ubtf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205056 GeneID:21429 MGI:98512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding transcription factor, RNA polymerase I transcript_id : NM_011551.5

name	Ubtf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205052 GeneID:21429 MGI:98512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding transcription factor, RNA polymerase I transcript_id : NM_001044383.1

name	Slc4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755559 GeneID:20533 MGI:109393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 1 transcript_id : NM_011403.1

name	Rap2ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802231 GeneID:51799 MGI:1858752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap2 interacting protein transcript_id : NM_016759.2

name	Slc25a39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384727 GeneID:68066 MGI:1196386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 39 transcript_id : NM_026542.2

name	Grn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357784 GeneID:14824 MGI:95832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granulin transcript_id : NM_008175.3

name	BC025575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347501 GeneID:217219 MGI:2448496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025575 transcript_id : NM_199200.2

name	Itga2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754375 GeneID:16399 MGI:96601
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 2b transcript_id : NM_010575.1

name	LOC100040792 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262447 GeneID:100040792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100040792 transcript_id : XM_001475276.1

name	Fzd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628663 GeneID:57265 MGI:1888513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frizzled homolog 2 (Drosophila) transcript_id : NM_020510.2

name	2810433D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262449 GeneID:77132 MGI:1924382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2810433D01 gene transcript_id : XM_001475291.1

name	Gm1564 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262536 GeneID:268491 MGI:2686410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : gene model 1564, (NCBI), transcript variant 1 transcript_id : XM_196054.7

name	LOC100042456 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262537 GeneID:100042456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs product : hypothetical protein LOC100042456 transcript_id : XM_001479295.1

name	Ccdc43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801932 GeneID:52715 MGI:1289318
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 43 transcript_id : NM_025918.2

name	Adam11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752959 GeneID:11488 MGI:1098667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 11 transcript_id : NM_009613.1

name	Gja7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365183 GeneID:14615 MGI:95718
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 7 transcript_id : NM_008122.2

name	Higd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252785 GeneID:75689 MGI:1922939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 1B transcript_id : NM_080846.1

name	Eftud2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475933 GeneID:20624 MGI:1336880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor Tu GTP binding domain containing 2 transcript_id : NM_011431.2

name	Ccdc103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802920 GeneID:73293 MGI:1920543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 103 transcript_id : NM_028492.2

name	LOC100042500 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262539 GeneID:100042500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 3 Proteins product : similar to Coiled-coil domain containing 103 transcript_id : XM_001479358.1

name	Gfap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84000447 GeneID:14580 MGI:95697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial fibrillary acidic protein transcript_id : NM_010277.2

name	3000004C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537559 GeneID:70218 MGI:1917468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3000004C01 gene transcript_id : NM_197959.1

name	C1ql1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753221 GeneID:23829 MGI:1344400
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent-like 1 transcript_id : NM_011795.1

name	Dcakd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370255 GeneID:68087 MGI:1915337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dephospho-CoA kinase domain containing transcript_id : NM_026551.3

name	Nmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130678 GeneID:18107 MGI:102579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-myristoyltransferase 1 transcript_id : NM_008707.3

name	Plcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89363031 GeneID:72469 MGI:107451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 3 transcript_id : NM_152813.2

name	Acbd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628666 GeneID:67131 MGI:1914381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 4 transcript_id : NM_025988.2

name	Acbd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628667 GeneID:67131 MGI:1914381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 4 transcript_id : NM_001081495.1

name	Hexim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301215 GeneID:192231 MGI:2385923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexamethylene bis-acetamide inducible 1 transcript_id : NM_138753.2

name	Hexim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625828 GeneID:71059 MGI:1918309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexamthylene bis-acetamide inducible 2 transcript_id : NM_027658.1

name	Fmnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136289 GeneID:57778 MGI:1888994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin-like 1 transcript_id : NM_019679.2

name	Fmnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136287 GeneID:57778 MGI:1888994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin-like 1 transcript_id : NM_001077698.1

name	4933400C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376242 GeneID:328019 MGI:3045340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933400C05 gene transcript_id : NM_177801.3

name	Map3k14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388182 GeneID:53859 MGI:1858204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 14 transcript_id : NM_016896.3

name	Arhgap27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378265 GeneID:544817 MGI:1916903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 27 transcript_id : NM_133715.3

name	5730442P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130869 GeneID:70559 MGI:1917809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730442P18 gene transcript_id : NM_183288.2

name	Plekhm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942119 GeneID:353047 MGI:2443207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family M (with RUN domain) member 1 transcript_id : NM_183034.1

name	Lrrc37a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262452 GeneID:237954 MGI:2685097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : leucine rich repeat containing 37A transcript_id : XM_137868.8

name	Gm884 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701938 GeneID:380730 MGI:2685730
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 884, (NCBI) transcript_id : NM_001033434.1

name	Ifi35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312544 CCDS:CCDS25471.1 GeneID:70110 MGI:1917360
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : interferon-induced protein 35 protein_id : NP_081596.1

name	Vat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859662 CCDS:CCDS25472.1 GeneID:26949 MGI:1349450
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : membrane protein of cholinergic synaptic vesicles product : vesicle amine transport protein 1 homolog (T californica) protein_id : NP_036167.1

name	Rnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753116 CCDS:CCDS25473.1 GeneID:11858 MGI:1338755
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007266 - Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : aplysia ras-related homolog N (RhoN); ras homolog N (RhoN); ras homolog gene family, member N product : Rho family GTPase 2 protein_id : NP_033838.1

name	Brca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560812 CCDS:CCDS25474.1 GeneID:12189 MGI:104537
definition	GO_component : GO:0005813 - centrosome [Evidence TAS]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0008274 - gamma-tubulin ring complex [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence TAS]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0015631 - tubulin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007098 - centrosome cycle [Evidence IGI]; GO:0051298 - centrosome duplication [Evidence TAS]; GO:0006978 - DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator [Evidence ISS]; GO:0008630 - DNA damage response, signal transduction resulting in induction of apoptosis [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IMP]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0045739 - positive regulation of DNA repair [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0006359 - regulation of transcription from RNA polymerase III promoter [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : breast cancer 1 protein_id : NP_033894.2

name	Nbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679020 CCDS:CCDS25475.1 GeneID:17966 MGI:108498
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : next to the Brca1 product : neighbor of Brca1 gene 1 protein_id : NP_032702.1

name	Tmem106a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450215 CCDS:CCDS25476.1 GeneID:217203 MGI:1922056
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217203 protein_id : NP_659079.1

name	Rdm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385116 CCDS:CCDS25477.1 GeneID:66599 MGI:1913849
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : RAD52B homolog; RAD52 homolog B product : RAD52 motif 1 protein_id : NP_079930.1

name	Arl4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384792 GeneID:80981 MGI:1933155
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : ADP-ribosylation factor-like 5 product : ADP-ribosylation factor 4-like protein_id : NP_079680.1

name	LOC100038842 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262366 GeneID:100038842
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471822.1

name	Dhx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699440 CCDS:CCDS25479.1 GeneID:217207 MGI:1306823
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 8; RNA helicase product : DEAH (Asp-Glu-Ala-His) box polypeptide 8 protein_id : NP_659080.2

name	Etv4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582414 GeneID:18612 MGI:99423
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IPI] [Evidence IDA] GO_process : GO:0008045 - motor axon guidance [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA] [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : polyomavirus enhancer activator 3 product : ets variant gene 4 (E1A enhancer binding protein, E1AF) protein_id : NP_032841.2

name	Meox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754680 CCDS:CCDS25480.1 GeneID:17285 MGI:103220
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001757 - somite specification [Evidence IGI] codon_start : 1 product : mesenchyme homeobox 1 protein_id : NP_034921.1

name	LOC194960 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:20344851 GeneID:194960
definition	codon_start : 1 product : hypothetical protein protein_id : XP_110983.1

name	Sost (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14209688 CCDS:CCDS25481.1 GeneID:74499 MGI:1921749
definition	GO_process : GO:0030514 - negative regulation of BMP signaling pathway [Evidence ISS]; GO:0001503 - ossification [Evidence IDA] codon_start : 1 exception : mismatches in translation product : sclerostin protein_id : NP_077769.2

name	Dusp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312314 CCDS:CCDS25482.1 GeneID:72349 MGI:1919599
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) protein_id : NP_082483.1

name	1700006E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20913257 GeneID:75437 MGI:1922687
definition	codon_start : 1 product : hypothetical protein LOC75437 protein_id : XP_126493.1

name	Mpp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026923 GeneID:13384 MGI:1328354
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : membrane protein palmitoylated 3 (MAGUK p55 subfamily member 3) product : Mpp3 membrane protein, palmitoylated 3 protein_id : NP_031889.2

name	Cd300lg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61696144 CCDS:CCDS25484.1 GeneID:52685 MGI:1289168
definition	codon_start : 1 exception : mismatches in translation note : nepmucin product : CMRF-35-like molecule-9 protein_id : NP_082263.1

name	Mpp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710062 CCDS:CCDS25485.1 GeneID:50997 MGI:1858257
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006461 - protein complex assembly [Evidence ISS] codon_start : 1 note : p55 subfamily member of MAGUK family; membrane protein palmitoylated 2 (MAGUK p55 subfamily member 2) product : membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) protein_id : NP_057904.1

name	Ppy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679453 CCDS:CCDS25486.1 GeneID:19064 MGI:97753
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0001664 - G-protein-coupled receptor binding [Evidence IDA]; GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : pancreatic polypeptide protein_id : NP_032944.1

name	Pyy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703868 GeneID:217212 MGI:99924
definition	GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0042755 - eating behavior [Evidence IDA] codon_start : 1 note : Peptide tyrosine tyrosine product : peptide YY protein_id : NP_663410.1

name	LOC666411 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390845 GeneID:666411
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988743.1

name	Nags (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003874 CCDS:CCDS25488.1 GeneID:217214 MGI:2387600
definition	EC_number : 2.3.1.1 GO_component : GO:0005739 - mitochondrion [Evidence TAS] GO_function : GO:0003991 - acetylglutamate kinase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004042 - amino-acid N-acetyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0006536 - glutamate metabolism [Evidence IDA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; amino-acid N-acetyltransferase; N-acetylglutamate synthase (Nags) product : N-acetylglutamate synthase isoform 1 protein_id : NP_665828.1

name	Nags (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017345 GeneID:217214 MGI:2387600
definition	EC_number : 2.3.1.1 GO_component : GO:0005739 - mitochondrion [Evidence TAS] GO_function : GO:0003991 - acetylglutamate kinase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004042 - amino-acid N-acetyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0006536 - glutamate metabolism [Evidence IDA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; amino-acid N-acetyltransferase; N-acetylglutamate synthase (Nags) product : N-acetylglutamate synthase isoform 2 protein_id : NP_835154.1

name	Tmem101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313232 CCDS:CCDS25489.1 GeneID:76547 MGI:1923797
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76547 protein_id : NP_083925.1

name	Lsm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31711990 CCDS:CCDS25490.1 GeneID:268490 MGI:1919592
definition	codon_start : 1 product : LSM12 homolog protein_id : NP_766535.1

name	G6pc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271524 CCDS:CCDS25491.1 GeneID:68401 MGI:1915651
definition	codon_start : 1 note : glucose-6-phosphatase catalytic subunit-related; glucose 6 phosphatase catalytic 3 product : glucose-6-phosphatase catalytic subunit 3 protein_id : NP_787949.2

name	Hdac5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136299 GeneID:15184 MGI:1333784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016566 - specific transcriptional repressor activity [Evidence TAS]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030183 - B cell differentiation [Evidence TAS]; GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0007507 - heart development [Evidence IGI]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0045843 - negative regulation of striated muscle development [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence TAS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; histone deacetylase 4 product : histone deacetylase 5 isoform 2 protein_id : NP_034542.3

name	Hdac5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136295 GeneID:15184 MGI:1333784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016566 - specific transcriptional repressor activity [Evidence TAS]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030183 - B cell differentiation [Evidence TAS]; GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0007507 - heart development [Evidence IGI]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0045843 - negative regulation of striated muscle development [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence TAS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; histone deacetylase 4 product : histone deacetylase 5 isoform 1 protein_id : NP_001071164.1

name	BC030867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347505 GeneID:217216 MGI:2387601
definition	codon_start : 1 product : hypothetical protein LOC217216 protein_id : NP_705772.3

name	Asb16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507369 CCDS:CCDS25493.1 GeneID:217217 MGI:2654437
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : ankyrin repeat domain-containing SOCS box protein Asb-16 product : ankyrin repeat and SOCS box-containing 16 protein_id : NP_683755.1

name	2010008E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625900 CCDS:CCDS25494.1 GeneID:72053 MGI:1919303
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72053 protein_id : NP_082352.1

name	Ubtf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205053 GeneID:21429 MGI:98512
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transcription factor UBF product : upstream binding transcription factor, RNA polymerase I isoform 2 protein_id : NP_001037848.1

name	Ubtf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205057 CCDS:CCDS25495.1 GeneID:21429 MGI:98512
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; transcription factor UBF product : upstream binding transcription factor, RNA polymerase I isoform 1 protein_id : NP_035681.2

name	Slc4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755560 CCDS:CCDS25496.1 GeneID:20533 MGI:109393
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015380 - anion exchanger activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0005452 - inorganic anion exchanger activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : erythrocyte membrane protein band 3 product : solute carrier family 4 (anion exchanger), member 1 protein_id : NP_035533.1

name	Rap2ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949125 CCDS:CCDS25497.1 GeneID:51799 MGI:1858752
definition	codon_start : 1 note : Rap2 interacting protein 8 product : Rap2 interacting protein protein_id : NP_058039.1

name	Slc25a39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386046 CCDS:CCDS25498.1 GeneID:68066 MGI:1196386
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to human CGI-69 protein product : solute carrier family 25, member 39 protein_id : NP_080818.1

name	Grn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680107 GeneID:14824 MGI:95832
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0001835 - blastocyst hatching [Evidence IDA]; GO:0007566 - embryo implantation [Evidence IDA]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IDA] codon_start : 1 note : acrogranulin; progranulin; PC cell-derived growth factor product : granulin protein_id : NP_032201.1

name	BC025575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347502 GeneID:217219 MGI:2448496
definition	codon_start : 1 product : hypothetical protein LOC217219 protein_id : NP_954670.2

name	Itga2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754376 CCDS:CCDS25500.1 GeneID:16399 MGI:96601
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0050840 - extracellular matrix binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : integrin alpha 2b (Cd41b); platelet glycoprotein IIb of IIb/II Ia complex; GP IIb; alpha IIb product : integrin alpha 2b protein_id : NP_034705.1

name	LOC100040792 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262448 GeneID:100040792
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475326.1

name	Fzd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048406 CCDS:CCDS25501.1 GeneID:57265 MGI:1888513
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004926 - non-G-protein coupled 7TM receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IGI] [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : frizzled 2 protein_id : NP_065256.1

name	2810433D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262450 GeneID:77132 MGI:1924382
definition	codon_start : 1 product : hypothetical protein LOC77132 protein_id : XP_001475341.1

name	Gm1564 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390864 GeneID:268491 MGI:2686410
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_196054.6

name	LOC100042456 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262538 GeneID:100042456
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479345.1

name	Ccdc43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385406 CCDS:CCDS25502.1 GeneID:52715 MGI:1289318
definition	codon_start : 1 product : coiled-coil domain containing 43 protein_id : NP_080194.1

name	Adam11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752960 CCDS:CCDS25503.1 GeneID:11488 MGI:1098667
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : a disintegrin and metalloprotease domain (ADAM) 11 product : a disintegrin and metalloprotease domain 11 protein_id : NP_033743.1

name	Gja7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680007 CCDS:CCDS25504.1 GeneID:14615 MGI:95718
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0048738 - cardiac muscle development [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0048468 - cell development [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : connexin 45 product : gap junction membrane channel protein alpha 7 protein_id : NP_032148.1

name	Higd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252786 GeneID:75689 MGI:1922939
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : CLST 11240 protein protein_id : NP_543122.1

name	Eftud2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755594 GeneID:20624 MGI:1336880
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : U5 small nuclear ribonucleoprotein 116 kDa product : elongation factor Tu GTP binding domain containing 2 protein_id : NP_035561.1

name	Ccdc103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037317 CCDS:CCDS25506.1 GeneID:73293 MGI:1920543
definition	codon_start : 1 product : coiled-coil domain containing 103 protein_id : NP_082768.1

name	LOC100042500 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262540 GeneID:100042500
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479408.1

name	Gfap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000448 CCDS:CCDS25507.1 GeneID:14580 MGI:95697
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005882 - intermediate filament [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IMP] GO_process : GO:0045103 - intermediate filament-based process [Evidence IMP] codon_start : 1 note : intermediate filament protein product : glial fibrillary acidic protein protein_id : NP_034407.2

name	3000004C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537560 CCDS:CCDS25508.1 GeneID:70218 MGI:1917468
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70218 protein_id : NP_932063.1

name	C1ql1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753222 CCDS:CCDS25509.1 GeneID:23829 MGI:1344400
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : C1q related factor product : complement component 1, q subcomponent-like 1 protein_id : NP_035925.1

name	Dcakd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754054 CCDS:CCDS25510.1 GeneID:68087 MGI:1915337
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004140 - dephospho-CoA kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : dephospho-CoA kinase domain containing protein_id : NP_080827.2

name	Nmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679082 CCDS:CCDS25511.1 GeneID:18107 MGI:102579
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004379 - glycylpeptide N-tetradecanoyltransferase activity [Evidence IEA] [Evidence IMP] [Evidence ISS] [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0018008 - N-terminal peptidyl-glycine N-myristoylation [Evidence ISS]; GO:0006499 - N-terminal protein myristoylation [Evidence IMP] [Evidence IEA] codon_start : 1 product : N-myristoyltransferase 1 protein_id : NP_032733.1

name	Plcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779905 CCDS:CCDS25512.1 GeneID:72469 MGI:107451
definition	GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0001890 - placenta development [Evidence IGI] codon_start : 1 exception : mismatches in translation product : phospholipase C, delta 3 protein_id : NP_690026.1

name	Acbd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794460 GeneID:67131 MGI:1914381
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : acyl-Coenzyme A binding domain containing 4 isoform 1 protein_id : NP_080264.1

name	Acbd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628668 GeneID:67131 MGI:1914381
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : acyl-Coenzyme A binding domain containing 4 isoform 2 protein_id : NP_001074964.1

name	Hexim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270289 CCDS:CCDS25513.1 GeneID:192231 MGI:2385923
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0017069 - snRNA binding [Evidence ISS]; GO:0016566 - specific transcriptional repressor activity [Evidence IDA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : cardiac lineage protein 1 product : hexamethylene bis-acetamide inducible 1 protein_id : NP_620092.1

name	Hexim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625829 CCDS:CCDS25514.1 GeneID:71059 MGI:1918309
definition	codon_start : 1 product : hexamthylene bis-acetamide inducible 2 protein_id : NP_081934.1

name	Fmnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136288 GeneID:57778 MGI:1888994
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0016043 - cell organization and biogenesis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IMP]; GO:0006929 - substrate-bound cell migration [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lymphocyte specific formin related protein; formin-related gene in leukocytes; formin-like product : formin-like 1 isoform 2 protein_id : NP_001071166.1

name	Fmnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136290 GeneID:57778 MGI:1888994
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0016043 - cell organization and biogenesis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IMP]; GO:0006929 - substrate-bound cell migration [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lymphocyte specific formin related protein; formin-related gene in leukocytes; formin-like product : formin-like 1 isoform 1 protein_id : NP_062653.2

name	4933400C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244338 CCDS:CCDS25515.1 GeneID:328019 MGI:3045340
definition	codon_start : 1 product : hypothetical protein LOC328019 protein_id : NP_808469.1

name	Map3k14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393835 CCDS:CCDS25516.1 GeneID:53859 MGI:1858204
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : alymphoplasia; Nfkb inducing kinase; protein kinase; NF kappa B-inducing kinase product : mitogen-activated protein kinase kinase kinase 14 protein_id : NP_058592.1

name	Arhgap27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776555 CCDS:CCDS25517.1 GeneID:544817 MGI:1916903
definition	GO_component : GO:0005768 - endosome [Evidence ISS]; GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005096 - GTPase activator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0030675 - Rac GTPase activator activity [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0043089 - positive regulation of Cdc42 GTPase activity [Evidence ISS]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Rho GTPase activating protein 27 isoform 1 protein_id : NP_598476.2

name	5730442P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130870 GeneID:70559 MGI:1917809
definition	codon_start : 1 note : novel protein similar to Rho GTPase activating protein 12 (Arhgap12) product : hypothetical protein LOC70559 protein_id : NP_899111.2

name	Plekhm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942120 CCDS:CCDS25518.1 GeneID:353047 MGI:2443207
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : pleckstrin homology domain containing, family M (with RUN domain) member 1 protein_id : NP_898855.1

name	Lrrc37a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262453 GeneID:237954 MGI:2685097
definition	codon_start : 1 product : hypothetical protein protein_id : XP_137868.8

name	Gm884 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701939 GeneID:380730 MGI:2685730
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC380730 protein_id : NP_001028606.1

name	LOC100040687 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040687
definition	number : 2 pseudo : _no_value

name	LOC100040687 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040687
definition	number : 1 pseudo : _no_value

name	Mdk-ps1 (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition	gene_synonym : Mak-rs1

name	(CDS detail)
type	repeat_region
link
xref
definition	satellite : microsatellite:DNA

name	Mdk-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Mak-rs1 note : Mrg, highly homologous to exons (II, III, IV and V) of Mdk. pseudo : _no_value

name	LOC667306 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262524 GeneID:667306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC667306 transcript_id : XR_035353.1

clone name	MSMg01-430M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308A02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-542N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-097F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028D16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242F16.b	B6Ng01-242F16.g
ACC	GA052022	GA052023
length	815	942
definition	B6Ng01-242F16.b	B6Ng01-242F16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(102,311,001 - 102,311,815)	(102,419,992 - 102,420,933)
sequence	gaattcagtgttcaaggcgtgtctgctcagccaccacccctgcctcccta acaaacaagtaccccagggccctccccacccggctccagcctcagcaact ccctctttgccagaacttgcccccttgttactggcagaaatttttttttt ctgaacactttgctccatgcagggaacggctctttcattgcctcagatca accgtcagagccctgtccttgactacctggcttccctttgaagacttcgg gaagtggcgcctccaccagcacccactgatatctcctcaccactcccctc cttccatgcctccttccgcctcacctcacctctcctcttcttcttctcct tctttttttcctaagatttatttatttattttatgtattatgagtacaat tatagctgtcttcagaagagggtgtcagctctctgacagatttttgtgtc attacagatggttgtgagccaccatgtggctgctgggaattgaacttggg acctctggaagagcagtcagtgctcttaaccattgagccatctctccagc ctccctcctctcctctcttctctcctgtcctcccctaccccctttcctcc cctcccctttcctctccacatcccccttctcctctccacatcaccctcct ctgtctttctccccaccctcagtactgaagattgaactcagggtcttgga catagtaaacgactgctcccctactgaaagttgtctcagctttctttttc cttactttctaaaaatgtgatagaaataggaccgttattaaggaggaatg ggagtagggtggtat	gaattcaaggatattcttgtctacatagtgactttgacatcaatctaggg tacaggagaccctatttcagaacaaaatattagcaccaggagaggtaacc aaagtgaatggaataaaatattttaatttccaagagttctgtctttcttt ctctctcttttttaaaagattcatttattttatgttctgtcatgactgct tacttgtgtgtgtctctatgtactaagatatagcagtttcctctgaaaac cttcagccctgcagggaagctccgtcagctcaggttgtaaacaacccaaa ggcttccggaagttcctgaaatggatgggattcacctctcctgctacaag catagagaagcagtaagaactgctgagcaacatgctaagactggaccaga tacctagaagagtctcagacaaggtaaccacataaaagaggctgggtggg actgctgttatgcagtgtgctccaggtacccagcttttgtgacctgtcag ccttgctgacaggctttcagctttgcagctgtgtatagttactcttcccc catactccagtaagtaactgcaataaaactcatgtgttcaccaagttgga cttgggaagtttctgtactttggtctgttcttggctccttatctgggata agtagatgcttattcatctctcctgaggaaaagtgtcacacagtatgtac aacatgcctgcagacatgatgccctctagactgcctatagaggccaggaa agggcatcatatttcctggaatgagaagtacaggttatgagccgggcgtg gtggtacacgcctttaatcccaacacttgggaggcagaggcgggcagatt tctgagttcgaggccagcctggtctacaaagtgagttccaggacagccag ggctatatagagaaactctgtctcgggggggggggggggggg
quality values	Open. Hide. 62 31 26 29 62 31 24 56 62 62 62 62 32 32 47 62 62 62 62 62 62 62 62 62 59 59 62 59 49 62 62 59 39 59 59 43 43 54 59 62 62 59 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 59 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 54 62 46 62 62 62 47 62 62 62 62 62 62 62 62 62 62 47 39 62 56 62 62 62 62 62 62 56 62 42 62 62 56 56 62 62 56 62 62 62 62 62 62 62 54 62 62 62 42 62 62 62 62 52 62 49 62 62 52 62 62 62 62 54 47 52 54 58 45 58 58 58 58 54 58 58 54 54 58 54 54 54 54 54 52 52 54 52 52 52 54 54 52 58 52 41 41 52 52 52 54 54 54 52 32 52 52 52 58 58 58 54 54 54 54 58 43 47 49 58 51 48 47 48 50 49 45 37 38 48 52 49 34 28 37 47 48 53 50 48 47 48 47 47 48 49 43 44 43 49 51 47 37 49 39 52 49 58 44 49 50 49 49 49 49 50 51 40 43 58 28 46 48 58 46 38 23 32 51 49 50 30 28 37 36 33 47 51 37 50 49 41 40 51 58 51 25 54 36 49 41 17 26 33 52 31 34 39 54 39 27 41 47 50 51 25 49 32 50 50 47 19 35 37 54 44 40 40 54 39 42 51 40 54 35 51 47 46 29 26 45 37 42 35 54 40 30 25 24 54 24 28 30 41 37 18 54 45 52 54 46 49 49 46 47 31 31 53 19 25 15 22 25 40 36 31 33 45 52 31 30 17 13 36 29 34 30 21 22 32 52 47 30 34 21 28 45 51 25 26 25 15 21 31 18 17 32 22 14 33 41 7 27 37 31 27 46 41 26 51 24 32 31 6 46 13 27 32 33 24 30 14	Open. Hide. 62 59 56 59 62 44 51 59 62 62 46 43 46 28 48 56 48 48 62 62 62 59 62 62 59 62 62 54 49 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 54 62 62 62 62 59 62 62 54 54 54 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 41 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 52 54 54 58 52 58 58 58 54 46 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 43 45 58 58 52 58 58 58 58 48 58 58 58 58 48 58 58 58 58 58 58 54 58 51 50 58 58 54 58 58 58 50 46 45 46 48 51 58 58 54 58 58 51 45 58 44 44 58 58 58 49 39 58 58 58 50 58 58 58 52 58 51 58 49 51 58 50 51 58 58 52 58 53 53 58 58 41 41 53 53 58 51 58 52 51 51 51 58 58 43 29 39 52 58 40 51 50 40 37 30 38 50 47 41 44 30 40 41 29 54 49 53 53 51 42 54 45 49 39 18 39 51 54 54 44 27 51 54 49 41 34 49 49 51 52 49 39 52 49 54 52 41 46 37 46 40 42 52 52 45 46 42 52 51 37 33 35 31 27 47 33 32 34 47 45 46 47 53 52 52 39 37 38 31 31 51 41 40 42 45 52 31 31 45 41 53 31 40 31 37 53 51 49 19 12 46 38 31 33 52 43 36 45 37 42 51 51 31 36 31 40 16 51 31 31 30 43 35 51 34 23 35 35 36 31 18 37 31 35 18 26 31 46 29 33 31 46 36 32 32 30 30 40 46 18 31 46 28 28 32 28 30 30 29 46 34 42 32 22 22 26 29 48 35 32 31 30 31 31 32 35 31 48 31 36 12 23 24 38 24 30 13 31 31 28 46 27 17 23 20 33 32 48 31 32 30 25 30 10 25 22 31 18 26 13 22 6 14 17 19 21 31 38 18 24 11 33 28 27 20 19 44 32 20 27 35 42 33 32 11 29 31 16 31 26 32 24 23 14 26 22 15 11 39 34 25 30 16 30 31 32 32 23 32 14 29 43 23 23 29 31 32 33 27 32 24 23 18 34 39 37 39 39 39 39 34 39 34 33 30 26 33 21 25 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_102311001_102311815
seq2: B6Ng01-242F16.b_50_864

seq1  GAATTCAGTGTTCAAGGCGTGTCTGCTCAGCCACCACCCCTGCCTCCCTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTGTTCAAGGCGTGTCTGCTCAGCCACCACCCCTGCCTCCCTA  50

seq1  ACAAACAAGTACCCCAGGGCCCTCCCCACCCGGCTCCAGCCTCAGCAACT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAGTACCCCAGGGCCCTCCCCACCCGGCTCCAGCCTCAGCAACT  100

seq1  CCCTCTTTGCCAGAACTTGCCCCCTTGTTACTGGCAGAAATTTTTTTTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTTTGCCAGAACTTGCCCCCTTGTTACTGGCAGAAATTTTTTTTTT  150

seq1  CTGAACACTTTGCTCCATGCAGGGAACGGCTCTTTCATTGCCTCAGATCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACACTTTGCTCCATGCAGGGAACGGCTCTTTCATTGCCTCAGATCA  200

seq1  ACCGTCAGAGCCCTGTCCTTGACTACCTGGCTTCCCTTTGAAGACTTCGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGTCAGAGCCCTGTCCTTGACTACCTGGCTTCCCTTTGAAGACTTCGG  250

seq1  GAAGTGGCGCCTCCACCAGCACCCACTGATATCTCCTCACCACTCCCCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTGGCGCCTCCACCAGCACCCACTGATATCTCCTCACCACTCCCCTC  300

seq1  CTTCCATGCCTCCTTCCGCCTCACCTCACCTCTCCTCTTCTTCTTCTCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCATGCCTCCTTCCGCCTCACCTCACCTCTCCTCTTCTTCTTCTCCT  350

seq1  TCTTTTTTTCCTAAGATTTATTTATTTATTTTATGTATTATGAGTACAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTTTTCCTAAGATTTATTTATTTATTTTATGTATTATGAGTACAAT  400

seq1  TATAGCTGTCTTCAGAAGAGGGTGTCAGCTCTCTGACAGATTTTTGTGTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGCTGTCTTCAGAAGAGGGTGTCAGCTCTCTGACAGATTTTTGTGTC  450

seq1  ATTACAGATGGTTGTGAGCCACCATGTGGCTGCTGGGAATTGAACTTGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACAGATGGTTGTGAGCCACCATGTGGCTGCTGGGAATTGAACTTGGG  500

seq1  ACCTCTGGAAGAGCAGTCAGTGCTCTTAACCATTGAGCCATCTCTCCAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCTGGAAGAGCAGTCAGTGCTCTTAACCATTGAGCCATCTCTCCAGC  550

seq1  CTCCCTCCTCTCCTCTCTTCTCTCCTGTCCTCCCCTACCCCCTTTCCTCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCTCCTCTCCTCTCTTCTCTCCTGTCCTCCCCTACCCCCTTTCCTCC  600

seq1  CCTCCCCTTTCCTCTCCACATCCCCCTTCTCCTCTCCACATCACCCTCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCCTTTCCTCTCCACATCCCCCTTCTCCTCTCCACATCACCCTCCT  650

seq1  CTGTCTTTCTCCCCACCCTCAGTACTGAAGATTGAACTCAGGGTCTTGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTTTCTCCCCACCCTCAGTACTGAAGATTGAACTCAGGGTCTTGGA  700

seq1  CATAGTAAACGACTGCTCCCCTACTGAAAGTTGTCTCAGCTTTCTTTTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGTAAACGACTGCTCCCCTACTGAAAGTTGTCTCAGCTTTCTTTTTC  750

seq1  CTTACTTTCTAAAAATGTGATAGAAATAGGACCGTTATTAAGGAGGAATG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACTTTCTAAAAATGTGATAGAAATAGGACCGTTATTAAGGAGGAATG  800

seq1  GGAGTAGGGTGGTAT  815
      |||||||||||||||
seq2  GGAGTAGGGTGGTAT  815

seq1: chr11_102419992_102420933
seq2: B6Ng01-242F16.g_67_1008 (reverse)

seq1  CCCCCCCCCCCCCCCCCCGAGACAGAGTTTCTCTATATAGCCCTGGCTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCCCCCCCCCCCCCGAGACAGAGTTTCTCTATATAGCCCTGGCTGT  50

seq1  CCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCC  100

seq1  CGCCTCTGCCTCCCAAGTGTTGGGATTAAAGGCGTGTACCACCACGCCCG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCTCTGCCTCCCAAGTGTTGGGATTAAAGGCGTGTACCACCACGCCCG  150

seq1  GCTCATAACCTGTACTTCTCATTCCAGGAAATATGATGCCCTTTCCTGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCATAACCTGTACTTCTCATTCCAGGAAATATGATGCCCTTTCCTGGC  200

seq1  CTCTATAGGCAGTCTAGAGGGCATCATGTCTGCAGGCATGTTGTACATAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATAGGCAGTCTAGAGGGCATCATGTCTGCAGGCATGTTGTACATAC  250

seq1  TGTGTGACACTTTTCCTCAGGAGAGATGAATAAGCATCTACTTATCCCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGACACTTTTCCTCAGGAGAGATGAATAAGCATCTACTTATCCCAG  300

seq1  ATAAGGAGCCAAGAACAGACCAAAGTACAGAAACTTCCCAAGTCCAACTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGAGCCAAGAACAGACCAAAGTACAGAAACTTCCCAAGTCCAACTT  350

seq1  GGTGAACACATGAGTTTTATTGCAGTTACTTACTGGAGTATGGGGGAAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGAACACATGAGTTTTATTGCAGTTACTTACTGGAGTATGGGGGAAGA  400

seq1  GTAACTATACACAGCTGCAAAGCTGAAAGCCTGTCAGCAAGGCTGACAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAACTATACACAGCTGCAAAGCTGAAAGCCTGTCAGCAAGGCTGACAGG  450

seq1  TCACAAAAGCTGGGTACCTGGAGCACACTGCATAACAGCAGTCCCACCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAAAAGCTGGGTACCTGGAGCACACTGCATAACAGCAGTCCCACCCA  500

seq1  GCCTCTTTTATGTGGTTACCTTGTCTGAGACTCTTCTAGGTATCTGGTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCTTTTATGTGGTTACCTTGTCTGAGACTCTTCTAGGTATCTGGTCC  550

seq1  AGTCTTAGCATGTTGCTCAGCAGTTCTTACTGCTTCTCTATGCTTGTAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTAGCATGTTGCTCAGCAGTTCTTACTGCTTCTCTATGCTTGTAGC  600

seq1  AGGAGAGGTGAATCCCATCCATTTCAGGAACTTCCGGAAGCCTTTGGGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAGGTGAATCCCATCCATTTCAGGAACTTCCGGAAGCCTTTGGGTT  650

seq1  GTTTACAACCTGAGCTGACGGAGCTTCCCTGCAGGGCTGAAGGTTTTCAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTACAACCTGAGCTGACGGAGCTTCCCTGCAGGGCTGAAGGTTTTCAG  700

seq1  AGGAAACTGCTATATCTTAGTACATAGAGACACACACAAGTAAGCAGTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAACTGCTATATCTTAGTACATAGAGACACACACAAGTAAGCAGTCA  750

seq1  TGACAGAACATAAAATAAATGAATCTTTTAAAAAAGAGAGAGAAAGAAAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGAACATAAAATAAATGAATCTTTTAAAAAAGAGAGAGAAAGAAAG  800

seq1  ACAGAACTCTTGGAAATTAAAATATTTTATTCCATTCACTTTGGTTACCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAACTCTTGGAAATTAAAATATTTTATTCCATTCACTTTGGTTACCT  850

seq1  CTCCTGGTGCTAATATTTTGTTCTGAAATAGGGTCTCCTGTACCCTAGAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGGTGCTAATATTTTGTTCTGAAATAGGGTCTCCTGTACCCTAGAT  900

seq1  TGATGTCAAAGTCACTATGTAGACAAGAATATCCTTGAATTC  942
      ||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGTCAAAGTCACTATGTAGACAAGAATATCCTTGAATTC  942

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information