MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-243M04
Chromosome	11 (Build37)
Map Location	109,155,723 - 109,302,229
singlet/doublet	doublet
Overlap gene	Rgs9, 1700096J18Rik, Gna13, 9930022D16Rik, X83328
Upstream gene	Prkca, Apoh, LOC100041381, Ccdc46, Olfr1397-ps1, LOC629945, Axin2, E030025P04Rik, LOC194985
Downstream gene	Slc16a6, Arsg, Wipi1, Prkar1a, BC029169, 1700012B07Rik, 1700023C21Rik, LOC100041492, Abca8b, Abca8a, Abca9, Abca6, Abca5, Map2k6
Link	Open Mouse BAC browser

Click to get alignment info.

name	Prkca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18750 MGI:97595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11818 MGI:88058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041381 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Ccdc46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76380 MGI:1923673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Olfr1397-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258193 MGI:3031231
definition	gene_synonym : MOR5-3 note : olfactory receptor 1397, pseudogene 1 pseudo : _no_value

name	LOC629945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Axin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12006 MGI:1270862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E030025P04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268498 MGI:2685510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC194985 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 24 Proteins pseudo : _no_value

name	Rgs9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19739 MGI:1338824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700096J18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67927 MGI:1915177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	Gna13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14674 MGI:95768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930022D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320509 MGI:2444178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	X83328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13929 MGI:104837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104681 MGI:2144585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Arsg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74008 MGI:1921258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wipi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52639 MGI:1261864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkar1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19084 MGI:104878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC029169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208659 MGI:2388266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012B07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69324 MGI:1916574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein

name	1700023C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73257 MGI:1920507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041492 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Abca8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27404 MGI:1351668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217258 MGI:2386846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217262 MGI:2386796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76184 MGI:1923434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217265 MGI:2386607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26399 MGI:1346870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364622 GeneID:18750 MGI:97595
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, alpha transcript_id : NM_011101.2

name	Apoh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400778 GeneID:11818 MGI:88058
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein H transcript_id : NM_013475.3

name	Ccdc46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125661051 GeneID:76380 MGI:1923673
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 46 transcript_id : NM_029606.3

name	Ccdc46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125661053 GeneID:76380 MGI:1923673
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 46 transcript_id : NM_145688.2

name	Ccdc46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125661055 GeneID:76380 MGI:1923673
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 46 transcript_id : NM_029586.2

name	LOC629945 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262550 GeneID:629945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to splicing factor, arginine/serine-rich 12 transcript_id : XM_001480021.1

name	Axin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254369 GeneID:12006 MGI:1270862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : axin2 transcript_id : NM_015732.3

name	E030025P04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390906 GeneID:268498 MGI:2685510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA E030025P04 gene transcript_id : XM_196056.4

name	Rgs9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755319 GeneID:19739 MGI:1338824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 9 transcript_id : NM_011268.1

name	1700096J18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262552 GeneID:67927 MGI:1915177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 1700096J18 gene transcript_id : XM_001480042.1

name	Gna13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89001108 GeneID:14674 MGI:95768
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha 13 transcript_id : NM_010303.3

name	X83328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115496472 GeneID:13929 MGI:104837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EST X83328 transcript_id : NM_025275.4

name	Slc16a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067106 GeneID:104681 MGI:2144585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 6 transcript_id : NM_001029842.1

name	Slc16a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067108 GeneID:104681 MGI:2144585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 6 transcript_id : NM_134038.2

name	Arsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607164 GeneID:74008 MGI:1921258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylsulfatase G transcript_id : NM_028710.2

name	Wipi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130229 GeneID:52639 MGI:1261864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain, phosphoinositide interacting 1 transcript_id : NM_145940.2

name	Prkar1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364451 GeneID:19084 MGI:104878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, cAMP dependent regulatory, type I, alpha transcript_id : NM_021880.2

name	BC029169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418882 GeneID:208659 MGI:2388266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC029169 transcript_id : NM_153782.1

name	1700012B07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94391041 GeneID:69324 MGI:1916574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : RIKEN cDNA 1700012B07 gene, transcript variant 2 transcript_id : XM_895288.2

name	1700023C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390908 GeneID:73257 MGI:1920507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700023C21 gene transcript_id : XM_987400.1

name	Abca8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956075 GeneID:27404 MGI:1351668
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 8b transcript_id : NM_013851.1

name	Abca8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749663 GeneID:217258 MGI:2386846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 8a transcript_id : NM_153145.2

name	Abca9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22267465 GeneID:217262 MGI:2386796
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette transporter sub-family A member 9 transcript_id : NM_147220.1

name	Abca6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22267461 GeneID:76184 MGI:1923434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 6 transcript_id : NM_147218.1

name	Abca5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22267467 GeneID:217265 MGI:2386607
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 5 transcript_id : NM_147219.1

name	Map2k6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802082 GeneID:26399 MGI:1346870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 6 transcript_id : NM_011943.2

name	Prkca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755078 CCDS:CCDS25573.1 GeneID:18750 MGI:97595
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004698 - calcium-dependent protein kinase C activity [Evidence IDA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004697 - protein kinase C activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0002026 - cardiac inotropy [Evidence IMP]; GO:0000188 - inactivation of MAPK activity [Evidence IMP]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence IMP]; GO:0050930 - induction of positive chemotaxis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0046325 - negative regulation of glucose import [Evidence IMP]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence IMP]; GO:0001933 - negative regulation of protein amino acid phosphorylation [Evidence IMP]; GO:0006469 - negative regulation of protein kinase activity [Evidence IMP]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0050729 - positive regulation of inflammatory response [Evidence IMP]; GO:0001934 - positive regulation of protein amino acid phosphorylation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006937 - regulation of muscle contraction [Evidence IMP]; GO:0050730 - regulation of peptidyl-tyrosine phosphorylation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : protein kinase c-alpha product : protein kinase C, alpha protein_id : NP_035231.1

name	Apoh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400779 CCDS:CCDS25574.1 GeneID:11818 MGI:88058
definition	GO_function : GO:0008201 - heparin binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : beta-2-glycoprotein 1 product : apolipoprotein H protein_id : NP_038503.3

name	Ccdc46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125661052 GeneID:76380 MGI:1923673
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : coiled-coil domain containing 46 isoform 2 protein_id : NP_083882.3

name	Ccdc46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125661054 GeneID:76380 MGI:1923673
definition	codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : coiled-coil domain containing 46 isoform 3 protein_id : NP_663721.2

name	Ccdc46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729780 GeneID:76380 MGI:1923673
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : coiled-coil domain containing 46 isoform 1 protein_id : NP_083862.1

name	LOC629945 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262551 GeneID:629945
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480071.1

name	Axin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254370 CCDS:CCDS25575.1 GeneID:12006 MGI:1270862
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0001957 - intramembranous ossification [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0030111 - regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0001756 - somitogenesis [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : axin2 protein_id : NP_056547.3

name	E030025P04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935421 GeneID:268498 MGI:2685510
definition	codon_start : 1 product : hypothetical protein protein_id : XP_196056.2

name	Rgs9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755320 CCDS:CCDS25576.1 GeneID:19739 MGI:1338824
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ROS GAP product : regulator of G-protein signaling 9 protein_id : NP_035398.1

name	1700096J18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262553 GeneID:67927 MGI:1915177
definition	codon_start : 1 product : hypothetical protein LOC67927 protein_id : XP_001480092.1

name	Gna13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001109 CCDS:CCDS25577.1 GeneID:14674 MGI:95768
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence TAS]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0030168 - platelet activation [Evidence IMP]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0030334 - regulation of cell migration [Evidence IMP]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha 13 protein_id : NP_034433.3

name	X83328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75812978 CCDS:CCDS25579.1 GeneID:13929 MGI:104837
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : archaemetzincins-2 protein_id : NP_079551.3

name	Slc16a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067107 CCDS:CCDS25580.1 GeneID:104681 MGI:2144585
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; monocarboxylate transporter 6 product : solute carrier family 16, member 6 isoform a protein_id : NP_001025013.1

name	Slc16a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527254 GeneID:104681 MGI:2144585
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; monocarboxylate transporter 6 product : solute carrier family 16, member 6 isoform b protein_id : NP_598799.1

name	Arsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607165 CCDS:CCDS25581.1 GeneID:74008 MGI:1921258
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] GO_function : GO:0004065 - arylsulfatase activity [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004168 - dolichol kinase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008484 - sulfuric ester hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Arylsulfatase G protein_id : NP_082986.2

name	Wipi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122367 CCDS:CCDS25582.1 GeneID:52639 MGI:1261864
definition	GO_process : GO:0006914 - autophagy [Evidence IEA] codon_start : 1 product : WD40 repeat protein Interacting with phosphoInositides of 49kDa protein_id : NP_666052.1

name	Prkar1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794476 CCDS:CCDS25583.1 GeneID:19084 MGI:104878
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0031594 - neuromuscular junction [Evidence IDA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IGI] [Evidence IMP] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008283 - cell proliferation [Evidence TAS]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS] codon_start : 1 note : protein kinase, cAMP dependent regulatory, type 1, alpha product : protein kinase, cAMP dependent regulatory, type I, alpha protein_id : NP_068680.1

name	BC029169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418883 CCDS:CCDS25584.1 GeneID:208659 MGI:2388266
definition	codon_start : 1 note : ortholog of human family with sequence similarity 20, member A FAM20A product : hypothetical protein LOC208659 protein_id : NP_722477.1

name	1700012B07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935340 GeneID:69324 MGI:1916574
definition	codon_start : 1 product : hypothetical protein LOC69324 isoform 2 protein_id : XP_900381.1

name	1700023C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390909 GeneID:73257 MGI:1920507
definition	codon_start : 1 product : hypothetical protein LOC73257 protein_id : XP_992494.1

name	Abca8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956076 CCDS:CCDS25587.1 GeneID:27404 MGI:1351668
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence ISS] codon_start : 1 exception : mismatches in translation product : ATP-binding cassette, sub-family A (ABC1), member 8b protein_id : NP_038879.1

name	Abca8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346593 GeneID:217258 MGI:2386846
definition	GO_function : GO:0016887 - ATPase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATP-binding cassette, sub-family A (ABC1), member 8a protein_id : NP_694785.1

name	Abca9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267466 CCDS:CCDS25589.1 GeneID:217262 MGI:2386796
definition	GO_function : GO:0016887 - ATPase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATP-binding cassette transporter sub-family A member 9 protein_id : NP_671753.1

name	Abca6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267462 CCDS:CCDS25590.1 GeneID:76184 MGI:1923434
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ATP-binding cassette transporter sub-family A member 6 product : ATP-binding cassette, sub-family A (ABC1), member 6 protein_id : NP_671751.1

name	Abca5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267468 CCDS:CCDS25591.1 GeneID:217265 MGI:2386607
definition	GO_function : GO:0016887 - ATPase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATP-binding cassette transporter sub-family A member 5 product : ATP-binding cassette, sub-family A (ABC1), member 5 protein_id : NP_671752.1

name	Map2k6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859654 CCDS:CCDS25592.1 GeneID:26399 MGI:1346870
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IPI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : protein kinase, mitogen activated, kinase 6; MAP kinase kinase 6 product : mitogen activated protein kinase kinase 6 protein_id : NP_036073.1

name	LOC100041381 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041381
definition	number : 1 pseudo : _no_value

name	LOC100041381 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041381
definition	number : 2 pseudo : _no_value

name	LOC100041492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041492
definition	number : 3 pseudo : _no_value

name	LOC100041492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041492
definition	number : 2 pseudo : _no_value

name	LOC100041492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041492
definition	number : 1 pseudo : _no_value

name	LOC194985 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262474 GeneID:194985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 24 Proteins product : similar to LOC654472 protein pseudo : _no_value transcript_id : XR_032701.1

name	9930022D16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262477 GeneID:320509 MGI:2444178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 9930022D16 gene transcript_id : XR_035312.1

clone name	MSMg01-217C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-376F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-243M04.b	B6Ng01-243M04.g
ACC	GA053060	GA053061
length	1,126	1,095
definition	B6Ng01-243M04.b	B6Ng01-243M04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(109,301,094 - 109,302,229)	(109,155,723 - 109,156,809)
sequence	gaattctccctgcactctaaagcagaggccctcctgagctacattcagct tgcgcatcaggaagacctgcatgacatggtccccagctcagcatttctct actgatgcctcagtcttaagggtcctccttcccaggtagactctagagca gtatgaatcccaagctgtgatgtgcatcacagtaccacagtcacacgggg ctgccagctagagttgagatagcggatggtatgatgtttttgaagatttg gtaagaaaaacgaataaaaaactctattcgtaccgtgattccgtgttgag atggcgttttggtggcactcaacacctaatgttactgaaatgaattccag cagaggggctactggacagttaaaattgcacgcgtggcttgtggtacttt tctattggacagaattgctccagataaaagaatacaagttagattgggga ccagaggagtgtgaacccacgaatttttatgcaagagttacacacccccc aacacgatatttgaggggtttttggcagaagagcgttgcaagttctctaa agtagaactgattccacccacggttcaggtgccttctagcccggccttgg tgagagtcggggtggccgggatctccccgcagtggggtgcatcaggctgt ggtggtttacctgagtttccgacgccccgcaggccaagctgccaatttcg ctctcctcccaggggcggccacaggtgttgcccgccaccgccaccagcgg aggcggatccgcgcgagggacggacttggggcgcagctggggacagcgac gtgcttcctgcctgggaagggcccgttcgccggcaatagcagtcccgcgg ctgcctgcttggatttttatcactagagctttggagaggaaacaaccgac aacccaggcccgctgttcctcgagggatttgagatgagtcacagccccac gtcagagaaatgcatgctttccaaaagcaagcgcttgtgatcccaagctc agagaggcgcccagcgggcagaagatgcagatcaagcccagtctgagcta cattggggagactgtccaagaacagtaggatggagatatgggatacgtac aaacctgaacaaaatcttgcattgct	gaattcactctgtagagtgaatgctggccttgaactcagtagaagaagga atcttaataaagaaaatgcctcaataggattagcctgtaagccagcctat ggggcattttcttgattgaggattaatatgggaaggcccagcttactgta ggcagtggcaccactgagctagcagtcctggatgctatcagacatcaggc tgagcaagcactggggaacaattcagtaagcagtgttcctctgtagcctc tgcttcacttcctgcctccgggtttgggccctgacttccctcagtgataa actgctacctagaagtataagataaaacaaacccattcctccccaaattg cactgagcttgaggtggaggtctgtgatggaaacactttgactcacagga gacaaggccctactgagcagcatcggtctcccgcctttgagaagagcctc catttccagggtgtctggagtaatggggcaggtacaggagacccttacat tgacttgctggactcgggggaaatgaagatagcttattatccatctgtct caccacagtggtcatcttagcttacagtcaggcacatcatttgtctgttc caaactttgcaatgattccctagggtgggtaggggatcaaactgccttca aggcattctgggggctcattattatcgggctcattattgtctcccctgct ccctctacctttctgcctgtttcttgtgctttaaaatatgtctacgaagg gccaacagaccctcagactcaccagatcccctgtgtctttgcacttccat accttggtgcatgttgtcctctcttcctgcagtctcatctatctgtccct cccccccccttccctcctctgtctctctctgtctctctatctctgtgtgt ttgtctctgtctctctctcccttccctccttcttcctttctctgtctccc tgtctatctctgtgtgtttgtctgtctctctccttctctccttcttcttc ccccctcctttcctctctgtgtctctctatgtctctgtctgtctgtctgt ctctcttccctccttctcctcccctcctcttttctccctcctcct
quality values	Open. Hide. 62 31 22 39 62 62 62 62 62 49 62 62 47 42 47 62 62 47 56 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 56 38 33 28 43 46 59 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 54 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 53 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 49 52 58 52 58 58 52 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 54 54 52 58 58 54 58 58 54 54 58 58 58 52 58 58 58 54 58 54 58 58 58 54 52 42 58 54 58 58 58 58 58 58 53 58 50 58 58 58 58 58 51 58 58 43 51 58 50 58 58 40 58 58 51 53 58 58 58 58 51 58 51 42 58 58 58 58 28 49 58 54 51 58 58 51 58 53 53 47 41 58 58 58 44 41 58 50 50 58 51 52 49 58 50 58 58 52 46 44 46 58 41 36 58 49 42 39 51 49 58 44 36 58 58 50 50 58 39 58 32 52 54 58 58 58 53 49 39 16 58 35 49 32 41 52 54 53 53 39 50 27 37 54 58 54 49 37 40 53 53 51 42 51 49 45 54 54 37 39 49 49 54 50 50 54 29 51 37 53 40 29 54 41 49 50 50 41 38 54 51 49 41 46 38 53 51 42 51 39 36 53 53 31 40 52 53 51 32 8 51 40 31 54 32 29 40 54 43 53 38 51 37 37 32 54 54 37 21 36 46 27 20 46 51 52 51 49 47 42 32 32 45 25 32 39 32 52 53 53 31 28 40 39 53 34 30 32 26 42 34 40 43 39 32 45 32 45 21 45 30 30 51 42 51 31 19 47 28 20 46 40 34 41 34 31 31 45 37 27 46 25 27 15 31 32 35 31 33 24 18 31 46 38 27 43 31 43 32 43 33 26 42 30 41 29 31 31 30 34 16 22 48 48 47 32 31 32 34 38 32 31 31 19 32 23 30 37 48 27 21 31 37 19 30 18 26 31 46 31 26 16 25 29 31 24 31 20 28 14 30 38 15 25 17 30 27 46 35 23 31 28 19 11 25 8 19 26 29 31 37 34 47 32 28 19 48 33 26 31 13 29 27 27 32 23 33 33 29 26 31 16 32 44 44 38 16 29 25 33 32 27 19 33 8 34 37 26 21 32 18 21 32 30 32 30 34 33 10 11 14 34 43 26 15 21 17 23 16 11 12 14 25 9 22 19 23 31 32 27 36 30 7 17 21 29 28 27 6 3 5 7 16 15 5 6 18 18 27 21 10 13 28 18 30 25 9 14 17 27 7 3 3 10 19 34 7 13 28 20 16 11 7 3 3 27 10 14 23 24 27 28 20 23 9 28 25 16 16 8 15 10 16 28 30 7 10 5 11 6 11 10 3 8 11 3 7 11 14 17 8 3 6 8 9 17 17 6 12 12 7 12 10 23 12 21 6 18 28 22 18 16 16 15 6 6 4 6 7 26 25 5 7 17 6 16 12 14 10 17 22 4 5 5 1 2 2 2 3 3 7 7 11 7	Open. Hide. 62 47 56 44 62 47 62 47 62 62 43 51 30 27 19 28 36 36 34 37 62 59 59 59 62 62 59 62 62 62 62 59 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 54 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 54 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 48 62 62 62 62 62 62 62 49 42 47 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 52 47 58 47 58 58 58 54 42 58 58 58 54 58 35 58 58 58 58 58 46 38 49 54 58 58 54 54 58 58 58 58 58 58 58 54 54 54 58 54 58 58 58 58 58 58 54 54 58 54 54 58 58 58 42 58 58 54 54 50 54 58 58 58 54 54 58 54 53 58 54 58 58 58 58 58 54 58 58 58 58 58 51 58 47 46 52 58 58 51 58 58 54 58 49 46 58 58 58 51 49 58 51 58 58 58 58 41 58 58 52 58 58 58 50 49 51 58 58 58 42 33 51 49 58 58 50 58 58 42 58 50 58 50 53 40 40 49 42 37 49 58 52 53 58 58 58 58 58 42 51 46 53 54 49 53 50 51 50 51 50 50 58 58 46 53 50 50 50 40 49 41 51 58 42 51 53 40 49 49 58 41 58 52 53 41 58 54 33 41 39 52 40 38 44 58 50 50 52 53 50 58 40 58 39 49 37 49 52 51 54 40 52 37 49 54 53 39 54 54 50 52 42 34 49 49 42 52 39 40 24 54 37 22 51 51 24 27 44 51 38 33 39 53 31 49 33 41 29 45 32 35 18 53 40 34 45 39 45 33 34 32 29 54 54 42 31 46 40 53 32 40 32 54 35 40 40 33 37 53 52 31 29 21 34 35 31 33 28 26 53 46 31 35 29 35 31 42 32 41 53 32 45 29 41 32 32 32 53 30 24 31 32 41 31 43 31 31 31 32 31 34 39 30 31 31 42 30 31 42 32 31 51 36 27 28 51 51 46 46 46 46 46 38 31 19 26 51 30 31 32 46 24 42 22 46 22 42 24 42 33 46 31 42 24 28 10 25 31 46 26 46 24 46 19 46 24 41 23 46 14 46 19 46 34 41 30 48 19 35 23 39 16 46 23 39 12 31 23 36 19 36 18 18 46 25 26 31 31 46 30 29 31 33 25 10 24 24 24 24 33 31 48 31 23 14 29 27 38 24 24 17 18 48 31 15 29 18 31 22 37 31 26 21 29 22 36 13 38 19 38 17 36 29 31 9 19 14 31 21 23 14 24 22 21 13 24 31 7 7 17 31 30 19 18 19 17 10 11 15 12 20 11 18 18 37 47 43 48 17 20 11 34 13 36 8 33 17 10 16 19 30 7 23 9 34 17 17 10 10 5 12 10 23 11 31 19 24 6 13 13 20 4 5 6 38 13 16 7 30 8 17 7 20 6 7 3 4 5 8 5 6 24 38 15 7 6 15 3 5 4 3 9 18 21 13 38 32 19 11 18 13 11 10 9 20 25 7 11 5 4 17 8 11 11 9 8 18 15 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_109301094_109302229
seq2: B6Ng01-243M04.b_45_1170 (reverse)

seq1  AGCAATGGCAAGGATTTTTGTTCA-GTTTGTACGTATCCCATTATCTCAT  49
      |||||| |||||   ||||||||| |||||||||||||||| ||||||  
seq2  AGCAAT-GCAAG--ATTTTGTTCAGGTTTGTACGTATCCCA-TATCTCCA  46

seq1  CCCTACTGGTTCTTTGGGACCAGTTCTCCCAATGTAGCTCAGACTGGCCT  99
       |||||| ||||||  ||| ||||   |||||||||||||||||||| ||
seq2  TCCTACT-GTTCTT--GGA-CAGTCTCCCCAATGTAGCTCAGACTGGGCT  92

seq1  TGATCTGGCATCCTTCTGCCCGCTGGGCGCCTCTCCTGAGCTTGGGATCA  149
      |||||| |||| |||||||||||||||||||||| |||||||||||||||
seq2  TGATCT-GCAT-CTTCTGCCCGCTGGGCGCCTCT-CTGAGCTTGGGATCA  139

seq1  CAAGCGCTTGCTTTTGGAAAGCATGCATTTCTCTGACGTGGGGCTGTGAC  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCGCTTGCTTTTGGAAAGCATGCATTTCTCTGACGTGGGGCTGTGAC  189

seq1  TCATCTCAAATCCCTCGAGGAACAGCGGGCCTGGGTTGTCGGTTGTTTCC  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTCAAATCCCTCGAGGAACAGCGGGCCTGGGTTGTCGGTTGTTTCC  239

seq1  TCTCCAAAGCTCTAGTGATAAAAATCCAAGCAGGCAGCCGCGGGACTGCT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCAAAGCTCTAGTGATAAAAATCCAAGCAGGCAGCCGCGGGACTGCT  289

seq1  ATTGCCGGCGAACGGGCCCTTCCCAGGCAGGAAGCACGTCGCTGTCCCCA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCCGGCGAACGGGCCCTTCCCAGGCAGGAAGCACGTCGCTGTCCCCA  339

seq1  GCTGCGCCCCAAGTCCGTCCCTCGCGCGGATCCGCCTCCGCTGGTGGCGG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCGCCCCAAGTCCGTCCCTCGCGCGGATCCGCCTCCGCTGGTGGCGG  389

seq1  TGGCGGGCAACACCTGTGGCCGCCCCTGGGAGGAGAGCGAAATTGGCAGC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCGGGCAACACCTGTGGCCGCCCCTGGGAGGAGAGCGAAATTGGCAGC  439

seq1  TTGGCCTGCGGGGCGTCGGAAACTCAGGTAAACCACCACAGCCTGATGCA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCCTGCGGGGCGTCGGAAACTCAGGTAAACCACCACAGCCTGATGCA  489

seq1  CCCCACTGCGGGGAGATCCCGGCCACCCCGACTCTCACCAAGGCCGGGCT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACTGCGGGGAGATCCCGGCCACCCCGACTCTCACCAAGGCCGGGCT  539

seq1  AGAAGGCACCTGAACCGTGGGTGGAATCAGTTCTACTTTAGAGAACTTGC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGGCACCTGAACCGTGGGTGGAATCAGTTCTACTTTAGAGAACTTGC  589

seq1  AACGCTCTTCTGCCAAAAACCCCTCAAATATCGTGTTGGGGGGTGTGTAA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGCTCTTCTGCCAAAAACCCCTCAAATATCGTGTTGGGGGGTGTGTAA  639

seq1  CTCTTGCATAAAAATTCGTGGGTTCACACTCCTCTGGTCCCCAATCTAAC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGCATAAAAATTCGTGGGTTCACACTCCTCTGGTCCCCAATCTAAC  689

seq1  TTGTATTCTTTTATCTGGAGCAATTCTGTCCAATAGAAAAGTACCACAAG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATTCTTTTATCTGGAGCAATTCTGTCCAATAGAAAAGTACCACAAG  739

seq1  CCACGCGTGCAATTTTAACTGTCCAGTAGCCCCTCTGCTGGAATTCATTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACGCGTGCAATTTTAACTGTCCAGTAGCCCCTCTGCTGGAATTCATTT  789

seq1  CAGTAACATTAGGTGTTGAGTGCCACCAAAACGCCATCTCAACACGGAAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAACATTAGGTGTTGAGTGCCACCAAAACGCCATCTCAACACGGAAT  839

seq1  CACGGTACGAATAGAGTTTTTTATTCGTTTTTCTTACCAAATCTTCAAAA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGGTACGAATAGAGTTTTTTATTCGTTTTTCTTACCAAATCTTCAAAA  889

seq1  ACATCATACCATCCGCTATCTCAACTCTAGCTGGCAGCCCCGTGTGACTG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCATACCATCCGCTATCTCAACTCTAGCTGGCAGCCCCGTGTGACTG  939

seq1  TGGTACTGTGATGCACATCACAGCTTGGGATTCATACTGCTCTAGAGTCT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTACTGTGATGCACATCACAGCTTGGGATTCATACTGCTCTAGAGTCT  989

seq1  ACCTGGGAAGGAGGACCCTTAAGACTGAGGCATCAGTAGAGAAATGCTGA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGGGAAGGAGGACCCTTAAGACTGAGGCATCAGTAGAGAAATGCTGA  1039

seq1  GCTGGGGACCATGTCATGCAGGTCTTCCTGATGCGCAAGCTGAATGTAGC  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGGGACCATGTCATGCAGGTCTTCCTGATGCGCAAGCTGAATGTAGC  1089

seq1  TCAGGAGGGCCTCTGCTTTAGAGTGCAGGGAGAATTC  1136
      |||||||||||||||||||||||||||||||||||||
seq2  TCAGGAGGGCCTCTGCTTTAGAGTGCAGGGAGAATTC  1126

seq1: chr11_109155723_109156809
seq2: B6Ng01-243M04.g_68_1162

seq1  GAATTCACTCTGTAGAGTGAATGCTGGCCTTGAACTCAGTAGAAGAAGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCTGTAGAGTGAATGCTGGCCTTGAACTCAGTAGAAGAAGGA  50

seq1  ATCTTAATAAAGAAAATGCCTCAATAGGATTAGCCTGTAAGCCAGCCTAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTAATAAAGAAAATGCCTCAATAGGATTAGCCTGTAAGCCAGCCTAT  100

seq1  GGGGCATTTTCTTGATTGAGGATTAATATGGGAAGGCCCAGCTTACTGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCATTTTCTTGATTGAGGATTAATATGGGAAGGCCCAGCTTACTGTA  150

seq1  GGCAGTGGCACCACTGAGCTAGCAGTCCTGGATGCTATCAGACATCAGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGTGGCACCACTGAGCTAGCAGTCCTGGATGCTATCAGACATCAGGC  200

seq1  TGAGCAAGCACTGGGGAACAATTCAGTAAGCAGTGTTCCTCTGTAGCCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCAAGCACTGGGGAACAATTCAGTAAGCAGTGTTCCTCTGTAGCCTC  250

seq1  TGCTTCACTTCCTGCCTCCGGGTTTGGGCCCTGACTTCCCTCAGTGATAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTCACTTCCTGCCTCCGGGTTTGGGCCCTGACTTCCCTCAGTGATAA  300

seq1  ACTGCTACCTAGAAGTATAAGATAAAACAAACCCATTCCTCCCCAAATTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTACCTAGAAGTATAAGATAAAACAAACCCATTCCTCCCCAAATTG  350

seq1  CACTGAGCTTGAGGTGGAGGTCTGTGATGGAAACACTTTGACTCACAGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGAGCTTGAGGTGGAGGTCTGTGATGGAAACACTTTGACTCACAGGA  400

seq1  GACAAGGCCCTACTGAGCAGCATCGGTCTCCCGCCTTTGAGAAGAGCCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAGGCCCTACTGAGCAGCATCGGTCTCCCGCCTTTGAGAAGAGCCTC  450

seq1  CATTTCCAGGGTGTCTGGAGTAATGGGGCAGGTACAGGAGACCCTTACAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTCCAGGGTGTCTGGAGTAATGGGGCAGGTACAGGAGACCCTTACAT  500

seq1  TGACTTGCTGGACTCGGGGGAAATGAAGATAGCTTATTATCCATCTGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTTGCTGGACTCGGGGGAAATGAAGATAGCTTATTATCCATCTGTCT  550

seq1  CACCACAGTGGTCATCTTAGCTTACAGTCAGGCACATCATTTGTCTGTTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACAGTGGTCATCTTAGCTTACAGTCAGGCACATCATTTGTCTGTTC  600

seq1  CAAACTTTGCAATGATTCCCTAGGGTGGGTAGGGGATCAAACTGCCTTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACTTTGCAATGATTCCCTAGGGTGGGTAGGGGATCAAACTGCCTTCA  650

seq1  AGGCATTCTGGGGGCTCATTATTATCGGGCTCATTATTGTCTCCCCTGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATTCTGGGGGCTCATTATTATCGGGCTCATTATTGTCTCCCCTGCT  700

seq1  CCCTCTACCTTTCTGCCTGTTTCTTGTGCTTTAAAATATGTCTACGAAGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTACCTTTCTGCCTGTTTCTTGTGCTTTAAAATATGTCTACGAAGG  750

seq1  GCCAACAGACCCTCAGACTCACCAGATCCCCTGTGTCTTTGCACTTCCAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAACAGACCCTCAGACTCACCAGATCCCCTGTGTCTTTGCACTTCCAT  800

seq1  ACCTTGGTGCATGTTGTCCTCTCTTCCTGCAGTCTCATCTATCTGTCCCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGGTGCATGTTGTCCTCTCTTCCTGCAGTCTCATCTATCTGTCCCT  850

seq1  -CCCCCCCCTTCCCTCCTCTGTCTCTCTCTGTCTCTCTATCTCTGTGTGT  899
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCCCCTTCCCTCCTCTGTCTCTCTCTGTCTCTCTATCTCTGTGTGT  900

seq1  TTGTCTCTGTCTCTCTCT-CCTTCCCTCCTTCTTCCTTTCTCTGTCTCCC  948
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  TTGTCTCTGTCTCTCTCTCCCTTCCCTCCTTCTTCCTTTCTCTGTCTCCC  950

seq1  TGTCTATCTCTGTGTGTTTGTCTGTCTCTCTCCCTCTCTCCTTCTTCTT-  997
      ||||||||||||||||||||||||||||||||| ||||||||||||||| 
seq2  TGTCTATCTCTGTGTGTTTGTCTGTCTCTCTCCTTCTCTCCTTCTTCTTC  1000

seq1  CCCCCTCC-TTCCTCTCTGTGTCTCTCTATGTCTCTGTCTGTCTGTCTGT  1046
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCTCCTTTCCTCTCTGTGTCTCTCTATGTCTCTGTCTGTCTGTCTGT  1050

seq1  CTCTC-TCCCTCCTTCTCCT-CCCTCCTC-TTTCT-CCTCCTCCT  1087
      ||||| |||||||||||||| |||||||| ||||| |||||||||
seq2  CTCTCTTCCCTCCTTCTCCTCCCCTCCTCTTTTCTCCCTCCTCCT  1095

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information