MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-251G15
Chromosome	11 (Build37)
Map Location	116,576,124 - 116,717,319
singlet/doublet	doublet
Overlap gene	LOC634720, BC018473, St6galnac1, Mxra7, Jmjd6, 1110005A03Rik, LOC100043293, Sfrs2, Mfsd11
Upstream gene	LOC100043184, 2310067B10Rik, Caskin2, Tsen54, Llgl2, Recql5, 2210020M01Rik, Sap30bp, Itgb4, Galk1, H3f3b, Unk, Unc13d, Wbp2, Trim47, Trim65, Mrpl38, Fbf1, Acox1, 2310004N24Rik, Cdk3, Evpl, Srp68, Galr2, Exoc7, Foxj1, LOC668255, 1110014K08Rik, Qrich2, Prpsap1, LOC629971, Sphk1, Ube2o, Aanat, Rhbdf2, Cygb, OTTMUSG00000003947, 1810032O08Rik, St6galnac2
Downstream gene	Mgat5b, LOC100042036, Sec14l1, Sept9, EG667423, Tnrc6c, Tmc6, Tmc8, 6030468B19Rik, Syngr2, Tk1, Afmid, Birc5
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1127 ESTs, 10 Proteins

name	2310067B10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71947 MGI:1919197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Caskin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140721 MGI:2157062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsen54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76265 MGI:1923515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Llgl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217325 MGI:1918843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Recql5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170472 MGI:2156841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210020M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66528 MGI:1913778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sap30bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57230 MGI:1927479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192897 MGI:96613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Galk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14635 MGI:95730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H3f3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15081 MGI:1101768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217331 MGI:2442456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc13d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70450 MGI:1917700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22378 MGI:104709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217333 MGI:1917374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338364 MGI:2442815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60441 MGI:1926269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217335 MGI:1922033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11430 MGI:1330812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310004N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69535 MGI:1916785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 74 ESTs, 1 Protein

name	Cdk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69681 MGI:1916931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14027 MGI:107507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srp68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217337 MGI:1917447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14428 MGI:1337018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53413 MGI:1859270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15223 MGI:1347474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668255 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 146 ESTs, 4 Proteins pseudo : _no_value

name	1110014K08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319370 MGI:1914635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qrich2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217341 MGI:2684912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpsap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67763 MGI:1915013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 139 ESTs, 2 Proteins

name	LOC629971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Sphk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20698 MGI:1316649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ube2o (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217342 MGI:2444266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aanat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11298 MGI:1328365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217344 MGI:2442473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cygb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114886 MGI:2149481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000003947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038570 MGI:3649529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	1810032O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66293 MGI:1913543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	St6galnac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20446 MGI:107553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634720 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 5 Proteins pseudo : _no_value

name	BC018473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193217 MGI:3039625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St6galnac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20445 MGI:1341826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67622 MGI:1914872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107817 MGI:1858910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110005A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74319 MGI:1921569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 245 ESTs

name	Sfrs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20382 MGI:98284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69900 MGI:1917150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268510 MGI:3606200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042036 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Sec14l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74136 MGI:1921386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53860 MGI:1858222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667423 MGI:3646811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 715 ESTs, 6 Proteins pseudo : _no_value

name	Tnrc6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217351 MGI:2443265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217353 MGI:1098686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217356 MGI:2669037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030468B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77727 MGI:1924977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	Syngr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20973 MGI:1328324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21877 MGI:98763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afmid (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71562 MGI:2448704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Birc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11799 MGI:1203517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262564 GeneID:100043184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1126 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 1 transcript_id : XM_001480395.1

name	LOC100043184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262566 GeneID:100043184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 664 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 2 transcript_id : XM_001480398.1

name	2310067B10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421147 GeneID:71947 MGI:1919197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310067B10 gene transcript_id : NM_028014.3

name	Caskin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981529 GeneID:140721 MGI:2157062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cask-interacting protein 2 transcript_id : NM_080643.2

name	Tsen54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108389162 GeneID:76265 MGI:1923515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae) transcript_id : NM_029557.1

name	Llgl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922655 GeneID:217325 MGI:1918843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lethal giant larvae homolog 2 (Drosophila) transcript_id : NM_145438.2

name	Recql5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18485509 GeneID:170472 MGI:2156841
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RecQ protein-like 5 transcript_id : NM_130454.1

name	2210020M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361183 GeneID:66528 MGI:1913778
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210020M01 gene transcript_id : NM_183259.2

name	Sap30bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130518 GeneID:57230 MGI:1927479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAP30 binding protein transcript_id : NM_020483.3

name	Itgb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735427 GeneID:192897 MGI:96613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 4 transcript_id : NM_133663.2

name	Itgb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735425 GeneID:192897 MGI:96613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 4 transcript_id : NM_001005608.2

name	Galk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102412 GeneID:14635 MGI:95730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactokinase 1 transcript_id : NM_016905.2

name	H3f3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089277 GeneID:15081 MGI:1101768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H3 histone, family 3B transcript_id : NM_008211.3

name	Unk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376628 GeneID:217331 MGI:2442456
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unkempt homolog (Drosophila) transcript_id : NM_172569.2

name	Unc13d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62243587 GeneID:70450 MGI:1917700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-13 homolog D (C. elegans) transcript_id : NM_001009573.2

name	Wbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131203 GeneID:22378 MGI:104709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 2 transcript_id : NM_016852.2

name	Trim47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387213 GeneID:217333 MGI:1917374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 47 transcript_id : NM_172570.3

name	Trim65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892171 GeneID:338364 MGI:2442815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 65 transcript_id : NM_178802.3

name	Mrpl38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430534 GeneID:60441 MGI:1926269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L38 transcript_id : NM_024177.3

name	Fbf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922652 GeneID:217335 MGI:1922033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas (TNFRSF6) binding factor 1 transcript_id : NM_172571.3

name	Acox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793428 GeneID:11430 MGI:1330812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A oxidase 1, palmitoyl transcript_id : NM_015729.2

name	2310004N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262568 GeneID:69535 MGI:1916785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 74 ESTs, 1 Protein product : RIKEN cDNA 2310004N24 gene transcript_id : XM_181318.8

name	Cdk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369976 GeneID:69681 MGI:1916931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 3 transcript_id : NM_027165.2

name	Evpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185906 GeneID:14027 MGI:107507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : envoplakin transcript_id : NM_025276.3

name	Srp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271534 GeneID:217337 MGI:1917447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle 68 transcript_id : NM_146032.3

name	Galr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378655 GeneID:14428 MGI:1337018
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galanin receptor 2 transcript_id : NM_010254.3

name	Exoc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393336 GeneID:53413 MGI:1859270
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exocyst complex component 7 transcript_id : NM_016857.1

name	Foxj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345414 GeneID:15223 MGI:1347474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box J1 transcript_id : NM_008240.2

name	1110014K08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326476 GeneID:319370 MGI:1914635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110014K08 gene transcript_id : NM_176902.3

name	Qrich2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369223 GeneID:217341 MGI:2684912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine rich 2 transcript_id : NM_001033267.2

name	Prpsap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262514 GeneID:67763 MGI:1915013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 139 ESTs, 2 Proteins product : phosphoribosyl pyrophosphate synthetase-associated protein 1 transcript_id : XM_181343.5

name	Sphk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130341 GeneID:20698 MGI:1316649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine kinase 1 transcript_id : NM_025367.5

name	Sphk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130164 GeneID:20698 MGI:1316649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine kinase 1 transcript_id : NM_011451.2

name	Ube2o (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50234895 GeneID:217342 MGI:2444266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2O transcript_id : NM_173755.3

name	Aanat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892622 GeneID:11298 MGI:1328365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylalkylamine N-acetyltransferase transcript_id : NM_009591.2

name	Rhbdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802637 GeneID:217344 MGI:2442473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid 5 homolog 2 (Drosophila) transcript_id : NM_172572.2

name	Cygb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802729 GeneID:114886 MGI:2149481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoglobin transcript_id : NM_030206.2

name	OTTMUSG00000003947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262516 GeneID:100038570 MGI:3649529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : predicted gene, OTTMUSG00000003947 transcript_id : XM_001477353.1

name	St6galnac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842375 GeneID:20446 MGI:107553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 transcript_id : NM_009180.3

name	St6galnac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116571 GeneID:20445 MGI:1341826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 transcript_id : NM_011371.2

name	Mxra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345537 GeneID:67622 MGI:1914872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix-remodelling associated 7 transcript_id : NM_026280.2

name	Jmjd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988378 GeneID:107817 MGI:1858910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 6 transcript_id : NM_033398.2

name	1110005A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980785 GeneID:74319 MGI:1921569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110005A03 gene transcript_id : NM_028865.2

name	LOC100043293 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262572 GeneID:100043293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 245 ESTs product : hypothetical protein LOC100043293 transcript_id : XM_001480574.1

name	Sfrs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755477 GeneID:20382 MGI:98284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 2 (SC-35) transcript_id : NM_011358.1

name	Mfsd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863770 GeneID:69900 MGI:1917150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 11 transcript_id : NM_178620.3

name	Mgat5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301484 GeneID:268510 MGI:3606200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 5, isoenzyme B transcript_id : NM_172948.3

name	LOC100042036 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262519 GeneID:100042036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042036 transcript_id : XM_001477442.1

name	Sec14l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371946 GeneID:74136 MGI:1921386
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC14-like 1 (S. cerevisiae) transcript_id : NM_028777.2

name	Sept9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393783 GeneID:53860 MGI:1858222
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 9 transcript_id : NM_017380.1

name	Tnrc6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378034 GeneID:217351 MGI:2443265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 6C transcript_id : NM_198022.2

name	Tmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703875 GeneID:217353 MGI:1098686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 6 transcript_id : NM_145439.1

name	Tmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803122 GeneID:217353 MGI:1098686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 6 transcript_id : NM_181321.3

name	Tmc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469502 GeneID:217356 MGI:2669037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like 8 transcript_id : NM_181856.1

name	6030468B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390956 GeneID:77727 MGI:1924977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : RIKEN cDNA 6030468B19 gene transcript_id : XM_126537.4

name	Syngr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106428 GeneID:20973 MGI:1328324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 2 transcript_id : NM_009304.1

name	Tk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678356 GeneID:21877 MGI:98763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymidine kinase 1 transcript_id : NM_009387.1

name	Afmid (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560783 GeneID:71562 MGI:2448704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylformamidase transcript_id : NM_027827.2

name	Birc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59859889 GeneID:11799 MGI:1203517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : baculoviral IAP repeat-containing 5 transcript_id : NM_001012273.1

name	Birc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59859886 GeneID:11799 MGI:1203517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : baculoviral IAP repeat-containing 5 transcript_id : NM_009689.2

name	LOC100043184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262565 GeneID:100043184
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480445.1

name	LOC100043184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262567 GeneID:100043184
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480448.1

name	2310067B10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328308 CCDS:CCDS25646.1 GeneID:71947 MGI:1919197
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71947 protein_id : NP_082290.2

name	Caskin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981530 CCDS:CCDS25647.1 GeneID:140721 MGI:2157062
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cask-interacting protein 2 protein_id : NP_542374.2

name	Tsen54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:108389163 CCDS:CCDS25648.1 GeneID:76265 MGI:1923515
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 note : likely ortholog of H. sapiens SEN54L product : tRNA splicing endonuclease 54 homolog protein_id : NP_083833.1

name	Llgl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922656 CCDS:CCDS25649.1 GeneID:217325 MGI:1918843
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : lethal giant larvae-like protein 2 product : lethal giant larvae homolog 2 protein_id : NP_663413.2

name	Recql5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485510 CCDS:CCDS25650.1 GeneID:170472 MGI:2156841
definition	GO_function : GO:0004386 - helicase activity [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA] codon_start : 1 product : RecQ protein-like 5 protein_id : NP_569721.1

name	2210020M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304038 GeneID:66528 MGI:1913778
definition	codon_start : 1 product : hypothetical protein LOC66528 protein_id : NP_899082.1

name	Sap30bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560336 CCDS:CCDS25651.1 GeneID:57230 MGI:1927479
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcriptional regulator protein (Hcngp) product : transcriptional regulator protein protein_id : NP_065229.2

name	Itgb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735428 GeneID:192897 MGI:96613
definition	GO_component : GO:0009925 - basal plasma membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0046847 - filopodium formation [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : integrin beta 4 isoform 2 protein_id : NP_598424.2

name	Itgb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735426 GeneID:192897 MGI:96613
definition	GO_component : GO:0009925 - basal plasma membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0046847 - filopodium formation [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : integrin beta 4 isoform 1 protein_id : NP_001005608.2

name	Galk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93102413 CCDS:CCDS25654.1 GeneID:14635 MGI:95730
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004335 - galactokinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0046835 - carbohydrate phosphorylation [Evidence IEA]; GO:0019402 - galactitol metabolism [Evidence IMP]; GO:0006012 - galactose metabolism [Evidence IDA] [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA] codon_start : 1 product : galactokinase 1 protein_id : NP_058601.2

name	H3f3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680161 GeneID:15081 MGI:1101768
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : H3L-like histone product : H3 histone, family 3B protein_id : NP_032237.1

name	Unk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369808 CCDS:CCDS25655.1 GeneID:217331 MGI:2442456
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003711 - transcriptional elongation regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger CCCH type domain containing 5 product : zinc finger CCCH type containing 5 protein_id : NP_766157.1

name	Unc13d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62243588 CCDS:CCDS25656.1 GeneID:70450 MGI:1917700
definition	codon_start : 1 product : unc-13 homolog D protein_id : NP_001009573.2

name	Wbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394539 CCDS:CCDS25657.1 GeneID:22378 MGI:104709
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WW domain binding protein 2 protein_id : NP_058548.1

name	Trim47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559881 GeneID:217333 MGI:1917374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 47 protein_id : NP_766158.2

name	Trim65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520291 GeneID:338364 MGI:2442815
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : tripartite motif-containing 65 protein_id : NP_848917.1

name	Mrpl38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430535 CCDS:CCDS25658.1 GeneID:60441 MGI:1926269
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence ISS] codon_start : 1 note : ribosomal protein, mitochondrial, L3 product : mitochondrial ribosomal protein L38 protein_id : NP_077139.2

name	Fbf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922653 CCDS:CCDS25659.1 GeneID:217335 MGI:1922033
definition	codon_start : 1 note : likely ortholog of H. sapiens Fas (TNFRSF6) binding factor 1 (FBF1) product : Fas (TNFRSF6) binding factor 1 protein_id : NP_766159.3

name	Acox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793429 CCDS:CCDS25660.1 GeneID:11430 MGI:1330812
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005778 - peroxisomal membrane [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0003997 - acyl-CoA oxidase activity [Evidence TAS]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : Acyl-CoA oxidase product : acyl-Coenzyme A oxidase 1, palmitoyl protein_id : NP_056544.2

name	2310004N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262569 GeneID:69535 MGI:1916785
definition	codon_start : 1 product : hypothetical protein LOC69535 protein_id : XP_181318.3

name	Cdk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312362 GeneID:69681 MGI:1916931
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 3 protein_id : NP_081441.1

name	Evpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185907 CCDS:CCDS25661.1 GeneID:14027 MGI:107507
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 note : 210-kD protein; 210kDa protein product : envoplakin protein_id : NP_079552.3

name	Srp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271535 CCDS:CCDS25662.1 GeneID:217337 MGI:1917447
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : signal recognition particle 68kDa; likely ortholog of H. sapiens signal recognition particle 68kDa (SRP68) product : signal recognition particle 68 protein_id : NP_666144.3

name	Galr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560584 CCDS:CCDS25663.1 GeneID:14428 MGI:1337018
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0031175 - neurite development [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : galanin receptor 2 protein_id : NP_034384.2

name	Exoc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393337 CCDS:CCDS25664.1 GeneID:53413 MGI:1859270
definition	GO_component : GO:0000145 - exocyst [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : exocyst component protein 70 kDa homolog product : exocyst component protein homolog protein_id : NP_058553.1

name	Foxj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345415 CCDS:CCDS25665.1 GeneID:15223 MGI:1347474
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0042384 - cilium biogenesis [Evidence IMP]; GO:0035089 - establishment of apical/basal cell polarity [Evidence IMP]; GO:0007389 - pattern specification [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : HNF-3/forkhead homolog 4 product : forkhead box J1 protein_id : NP_032266.2

name	1110014K08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892683 CCDS:CCDS25666.1 GeneID:319370 MGI:1914635
definition	codon_start : 1 product : hypothetical protein LOC319370 protein_id : NP_795876.1

name	Qrich2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701774 CCDS:CCDS25667.1 GeneID:217341 MGI:2684912
definition	codon_start : 1 product : glutamine rich 2 protein_id : NP_001028439.1

name	Prpsap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262515 GeneID:67763 MGI:1915013
definition	codon_start : 1 note : overriding stop codons product : similar to likely ortholog of H. sapiens phosphoribosyl pyrophosphate synthetase-associated protein 1 (PRPSAP1) protein_id : XP_181343.6 transl_except : (pos:complement(116334936..116334938),aa:OTHER)

name	Sphk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532969 CCDS:CCDS25668.1 GeneID:20698 MGI:1316649
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0005516 - calmodulin binding [Evidence ISS]; GO:0017050 - D-erythro-sphingosine kinase activity [Evidence ISS]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS]; GO:0008481 - sphinganine kinase activity [Evidence ISS] GO_process : GO:0001568 - blood vessel development [Evidence IGI]; GO:0007420 - brain development [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0048146 - positive regulation of fibroblast proliferation [Evidence ISS]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0046521 - sphingoid catabolism [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : sphingosine kinase 1 isoform 2 protein_id : NP_079643.2

name	Sphk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094105 CCDS:CCDS25669.1 GeneID:20698 MGI:1316649
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0005516 - calmodulin binding [Evidence ISS]; GO:0017050 - D-erythro-sphingosine kinase activity [Evidence ISS]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS]; GO:0008481 - sphinganine kinase activity [Evidence ISS] GO_process : GO:0001568 - blood vessel development [Evidence IGI]; GO:0007420 - brain development [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0048146 - positive regulation of fibroblast proliferation [Evidence ISS]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0046521 - sphingoid catabolism [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : sphingosine kinase 1 isoform 1 protein_id : NP_035581.1

name	Ube2o (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50234896 CCDS:CCDS25670.1 GeneID:217342 MGI:2444266
definition	GO_function : GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] codon_start : 1 note : ubiquitinating enzyme E2-230 kDa product : ubiquitin-conjugating enzyme E2O protein_id : NP_776116.2

name	Aanat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752938 CCDS:CCDS25671.1 GeneID:11298 MGI:1328365
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004059 - aralkylamine N-acetyltransferase activity [Evidence IEA]; GO:0004060 - arylamine N-acetyltransferase activity [Evidence IEA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : arylalkylamine N-acetyltransferase protein_id : NP_033721.1

name	Rhbdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369806 CCDS:CCDS25672.1 GeneID:217344 MGI:2442473
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : rhomboid, veinlet-like 6 product : rhomboid-like protein 6 protein_id : NP_766160.1

name	Cygb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549320 CCDS:CCDS25673.1 GeneID:114886 MGI:2149481
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] [Evidence ISS]; GO:0004601 - peroxidase activity [Evidence ISS] GO_process : GO:0015671 - oxygen transport [Evidence IEA] [Evidence ISS]; GO:0006979 - response to oxidative stress [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : histoglobin; stellate cell activation associated protein product : cytoglobin protein_id : NP_084482.1

name	OTTMUSG00000003947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262517 GeneID:100038570 MGI:3649529
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477403.1

name	St6galnac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543707 GeneID:20446 MGI:107553
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : Gal-beta-1,3-GalNAc alpha-2,6-sialyltransferase; alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase II; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase B; ST6GalNAc II; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase) B; sialytransferase; ST6 neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 product : sialyltransferase 7B protein_id : NP_033206.2

name	St6galnac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116572 GeneID:20445 MGI:1341826
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence TAS]; GO:0009312 - oligosaccharide biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : ST6GalNAc I; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase) A; GalNAc alpha-2,6-sialyltransferase I product : sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase A protein_id : NP_035501.2

name	Mxra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037101 CCDS:CCDS25677.1 GeneID:67622 MGI:1914872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : matrix-remodelling associated 7 protein_id : NP_080556.1

name	Jmjd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125988379 CCDS:CCDS25678.1 GeneID:107817 MGI:1858910
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IMP] codon_start : 1 note : apoptotic cell clearance receptor PtdSerR product : phosphatidylserine receptor protein_id : NP_203971.2

name	1110005A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980786 CCDS:CCDS25679.1 GeneID:74319 MGI:1921569
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74319 protein_id : NP_083141.2

name	LOC100043293 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262573 GeneID:100043293
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480624.1

name	Sfrs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755478 CCDS:CCDS25680.1 GeneID:20382 MGI:98284
definition	GO_component : GO:0016607 - nuclear speck [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005681 - spliceosome complex [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0006376 - mRNA splice site selection [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : splicing factor Sc35; myelin regulatory factor 1 product : splicing factor, arginine/serine-rich 2 protein_id : NP_035488.1

name	Mfsd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519955 CCDS:CCDS25681.1 GeneID:69900 MGI:1917150
definition	codon_start : 1 product : major facilitator superfamily domain containing 11 protein_id : NP_848735.1

name	Mgat5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476097 CCDS:CCDS25682.1 GeneID:268510 MGI:3606200
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : beta1,6-N-acetylglucosaminyltransferase IX (GnT-IX); UDP-N-acetylglucosamine: alpha1,6-D-mannoside beta1,6-N-acetylglucosaminyltransferase b product : beta1,6-N-acetylglucosaminyltransferase IX protein_id : NP_766536.2

name	LOC100042036 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262520 GeneID:100042036
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477492.1

name	Sec14l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311923 CCDS:CCDS25683.1 GeneID:74136 MGI:1921386
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SEC14-like 1 protein_id : NP_083053.1

name	Sept9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393784 CCDS:CCDS25684.1 GeneID:53860 MGI:1858222
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 function : putative proto-oncogene note : MLL septin-like fusion; SL3-3 integration site 1 product : septin 9 protein_id : NP_059076.1

name	Tnrc6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378035 GeneID:217351 MGI:2443265
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : trinucleotide repeat containing 6C protein_id : NP_932139.2

name	Tmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32441274 CCDS:CCDS25687.1 GeneID:217353 MGI:1098686
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; transmembrane channel-like protein 6 product : transmembrane channel-like protein 6 isoform 1 protein_id : NP_663414.2

name	Tmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044457 CCDS:CCDS25688.1 GeneID:217353 MGI:1098686
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transmembrane channel-like protein 6 product : transmembrane channel-like protein 6 isoform 2 protein_id : NP_851838.1

name	Tmc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469503 CCDS:CCDS25689.1 GeneID:217356 MGI:2669037
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane channel-like gene family 8 product : epidermodysplasia verruciformis 2 protein_id : NP_862904.1

name	6030468B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20913795 GeneID:77727 MGI:1924977
definition	codon_start : 1 product : hypothetical protein LOC77727 protein_id : XP_126537.1

name	Syngr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106429 CCDS:CCDS25691.1 GeneID:20973 MGI:1328324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 product : synaptogyrin 2 protein_id : NP_033330.1

name	Tk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678357 CCDS:CCDS25692.1 GeneID:21877 MGI:98763
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004797 - thymidine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 exception : mismatches in translation product : thymidine kinase 1 protein_id : NP_033413.1

name	Afmid (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746157 CCDS:CCDS25693.1 GeneID:71562 MGI:2448704
definition	EC_number : 3.5.1.9 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004061 - arylformamidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006569 - tryptophan catabolism [Evidence IEA]; GO:0019441 - tryptophan catabolism to kynurenine [Evidence IDA] codon_start : 1 note : fFormylkynureninase; formylkynureninase product : kynurenine formamidase protein_id : NP_082103.1

name	Birc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753090 CCDS:CCDS25694.1 GeneID:11799 MGI:1203517
definition	GO_component : GO:0005814 - centriole [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005881 - cytoplasmic microtubule [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0031021 - interphase microtubule organizing center [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0030496 - midbody [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0048037 - cofactor binding [Evidence ISS]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS] [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0051303 - establishment of chromosome localization [Evidence ISS]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007067 - mitosis [Evidence IEA]; GO:0043154 - negative regulation of caspase activity [Evidence ISS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence ISS]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence ISS]; GO:0031503 - protein complex localization [Evidence ISS]; GO:0031577 - spindle checkpoint [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; survivin; apoptosis inhibitor 4 product : baculoviral IAP repeat-containing 5 isoform 1 protein_id : NP_033819.1

name	Birc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59859890 CCDS:CCDS25695.1 GeneID:11799 MGI:1203517
definition	GO_component : GO:0005814 - centriole [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005881 - cytoplasmic microtubule [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0031021 - interphase microtubule organizing center [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0030496 - midbody [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0048037 - cofactor binding [Evidence ISS]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS] [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0051303 - establishment of chromosome localization [Evidence ISS]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007067 - mitosis [Evidence IEA]; GO:0043154 - negative regulation of caspase activity [Evidence ISS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence ISS]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence ISS]; GO:0031503 - protein complex localization [Evidence ISS]; GO:0031577 - spindle checkpoint [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; survivin; apoptosis inhibitor 4 product : baculoviral IAP repeat-containing 5 isoform 3 protein_id : NP_001012273.1

name	LOC629971 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629971
definition	number : 1 pseudo : _no_value

name	LOC668255 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262570 GeneID:668255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 146 ESTs, 4 Proteins product : similar to ribosomal protein S11 pseudo : _no_value transcript_id : XR_034731.1

name	1810032O08Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262518 GeneID:66293 MGI:1913543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA 1810032O08 gene transcript_id : XR_035342.1

name	LOC634720 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262571 GeneID:634720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 5 Proteins product : similar to alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase pseudo : _no_value transcript_id : XR_034744.1

name	BC018473 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:126090534 GeneID:193217 MGI:3039625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018473 transcript_id : NR_003364.1

name	EG667423 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94390955 GeneID:667423 MGI:3646811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 715 ESTs, 6 Proteins product : predicted gene, EG667423 pseudo : _no_value transcript_id : XR_002024.1

clone name	MSMg01-524A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485E05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145L08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043C04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-251G15.b	B6Ng01-251G15.g
ACC	GA058681	GA058682
length	1,073	872
definition	B6Ng01-251G15.b	B6Ng01-251G15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(116,716,238 - 116,717,319)	(116,576,124 - 116,576,929)
sequence	gaattctttgatgtaagttattggaaagaggaggaaagagaaaaaaggaa accctgaagccaggcctgatgctacaggtttctaagtttatcactaggga ggtgtagatacctgaagttcaaggttatcttgtattatgctacaagctcc acgccagacaagagaggaggcaattggagggagagaggttgtatatgtgc atgtatttagtacatttccagctacaaatccaaagtactacagacctgtg aagttttcattttctatgtctaaacagcataaaaatctttttttgttttg ttttgtttttttgagacagggtttctctgtatagccctggctgtcctgga acttactctgtagaccaggctggccttgaactcagaaattcacctgcctc tgcctcccaagtgctggaattaaagacgtgcgtcactactgctcagcttc agcataaaaatctttgttttttttttttttttttttctttttgttgtttt tcgagaaagggtttctctgtatagccttggctgtcctggaactcactttg tagaccaggctggcctcaaactcagaaatccgccgcctctgcctccgagt gctggcattaaaggcgtgcgccaccacgcccagcttcagcataaaaatct taaagcttctgatgaaattataaattgagaatgagattacaaagcctcaa aaatccaatgtttcaacaactacagcactgttcaggattagaacatgatt ttgacaagacttgcatgcatattgagccagaagcactatactgcctgcat agccatgatcttagtaaagaacctggggtcacagagctaacttgctgaac gtagcaaagcatcccagttctgaagccaggctttcaatcccaagcctcct aattctacagaagacctttagtcatcatcgtaaaagaattaccatcacgc ttatttattttgggattcacggcatgcaccccatgcctgctctgtaactt tatactacatttaaatttatgttgtatgtaggagagtgttcctcttgctt gaagacaccatgaaactgcagga	gaattccattacctgtgtacacaggaatctcttatatgaccgtaatatag cttatgatcgccttgctcccttcacaggcttagcaggcgcttggttgtca gaaggaccaggtagccacaaagattcatcagccatcacatacatattcat gatcgccccaacttactcctatgttaactggaggattggggtttaggccc aatatatataattagtccccgttacctgtacagagagagcagagcaagga acacagttttagcatccaaaggctcctcagactgttgaactatggcttcc cttaccagacaatttcaatggttttctcatcgtgtcctctcctgcagaac atgagtataacctcagccccatcttaacacctctgactccattctgatgt tacaacatccctgtagttcacaggccaactcaattcaacgggtttttttc cacagtccaaagcctttcagcagctgtggtctctgcttcgtaagcattta aaaatttaaatttagtaagatattatgtaatctgtccctgggagtcctca tagcccccttttgtttcaaaagtatcttttttttttttgagtgagataag atcttaacaatgaacaggcaaaaggttgtttcattttattaggaacataa gcaggagtgttgtaagttgcttttttttttttgtataagtagcccattag agccttagtctctaataaatgtgtaattacagaatcagccttcttcagaa ttcaaggcagattccagttgaaatccagggtatgttatcaatactataat gtatagatttttaatttttccaaatttctgctgaacaaaatacatcaaat tttgacaaatttttattttctt
quality values	Open. Hide. 52 15 25 25 58 54 58 58 58 58 28 23 47 62 52 47 62 62 54 56 47 62 62 62 54 62 62 62 62 62 62 47 44 56 28 46 56 46 43 50 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 54 42 54 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 59 56 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 56 54 56 62 56 62 62 62 62 62 44 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 46 62 56 62 62 56 56 47 36 56 47 56 56 62 62 62 47 43 47 41 41 36 40 47 56 56 56 52 34 29 40 52 41 47 62 52 47 52 62 47 48 52 52 62 46 52 42 43 50 43 39 38 52 52 43 48 38 43 31 52 47 47 47 42 52 52 52 52 41 33 41 52 47 34 34 40 52 37 34 33 17 52 46 38 47 52 52 35 42 50 35 40 47 42 32 42 52 52 52 46 50 50 35 54 36 46 52 34 42 52 43 52 35 45 54 52 54 54 52 58 52 52 47 54 52 52 54 47 34 42 42 31 52 46 48 48 40 36 35 34 48 43 35 28 50 54 34 42 42 58 43 58 25 31 40 42 52 53 50 50 46 47 47 47 35 46 50 46 29 40 42 51 40 50 50 32 35 28 58 43 48 58 58 49 30 51 28 23 48 49 42 23 22 53 34 50 26 48 33 40 40 39 37 39 27 49 58 58 34 39 35 33 29 50 50 54 50 54 50 37 39 39 37 50 50 37 39 37 43 27 32 37 39 50 49 51 53 52 35 32 30 44 32 26 52 28 25 50 20 19 30 40 44 24 15 54 54 44 47 47 35 12 25 28 47 21 44 44 32 53 18 31 36 36 27 40 24 47 34 40 43 40 44 52 37 29 33 18 25 53 25 39 33 30 31 31 33 29 53 39 41 33 45 31 32 32 28 35 52 34 19 28 45 28 31 31 32 33 53 32 35 38 51 42 33 31 24 15 30 31 34 47 47 40 20 19 23 30 34 18 37 8 25 31 31 13 16 30 26 31 32 36 29 33 27 20 23 30 29 13 28 31 46 42 23 30 29 34 21 31 22 23 35 31 23 9 16 24 43 43 22 27 39 31 26 32 16 31 46 39 24 21 20 27 26 39 27 12 10 16 32 31 25 16 20 31 25 18 14 24 25 27 21 32 10 21 31 27 11 25 11 22 31 31 31 23 28 34 33 19 31 23 18 37 31 26 12 21 39 43 26 14 27 12 4 4 6 11 12 19 25 19 16 21 22 32 29 22 32 22 48 29 19 17 43 31 24 6 40 19 29 16 17 11 16 11 14 21 20 24 20 28 27 9 30 31 40 22 11 21 27 21 19 10 27 21 10 24 7 27 8 26 20 11 13 40 13 13 28 8 16 19 6 17 5 27 38 3 5 17 9 3 16 9 13 9 10 17 16 6 4 9 5 4 1 3 9 6 15 5 6 4 7 10 11 15 8 4 4 19 8 10 23 5 4 7 16 15 9 8 15 4 4 4 11 20 19 7 21 27 13 8 10 21 7 5 3 6 7	Open. Hide. 62 38 44 44 62 62 47 26 62 59 59 51 45 45 38 24 29 28 50 56 43 56 46 62 62 59 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 48 48 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 24 15 18 13 23 18 43 43 48 62 51 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 59 34 24 21 6 21 31 19 62 56 59 59 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 46 46 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 62 62 62 62 62 62 62 59 59 51 45 59 59 62 16 18 18 11 15 59 62 56 62 62 62 56 62 62 62 56 56 56 56 44 54 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 56 62 62 51 62 62 62 62 56 62 56 56 56 56 56 62 62 62 47 47 56 62 62 56 62 56 56 56 43 56 62 62 62 62 62 62 62 62 62 47 62 62 47 47 62 62 62 62 50 56 62 62 62 62 62 62 62 62 62 62 62 62 46 50 52 43 52 40 62 52 52 62 50 42 62 52 62 48 38 54 62 47 62 47 12 62 62 52 52 52 52 35 30 62 47 54 62 62 52 54 58 39 52 54 50 52 48 42 40 38 39 35 26 27 32 35 52 42 45 54 42 37 46 52 51 48 38 54 43 52 58 40 42 34 58 52 41 58 31 54 54 52 52 34 52 52 52 54 58 54 58 58 58 58 58 58 52 33 47 26 35 33 15 39 22 22 37 37 42 41 34 25 46 49 42 18 41 28 46 32 12 20 14 9 18 24 27 34 34 31 17 27 25 28 16 28 31 16 52 33 36 42 31 13 15 47 15 39 49 41 30 37 35 23 38 50 32 25 25 11 11 33 40 11 32 16 23 29 15 13 19 28 44 18 31 13 52 17 46 31 23 14 32 53 52 32 37 48 20 29 23 23 11 32 58 58 21 30 18 15 14 11 17 33 33 12 18 28 29 31 16 32 20 16 24 21 39 9 31 26 13 12 10 9 43 43 51 16 50 16 6 40 37 40 23 40 6 9 27 37 12 37 6 9 13 37 21 19 22 54 19 23 41 50 44 19 18 13 13 26 32 25 15 18 13 24 27 30 11 12 19 11 16 49 29 20 52 53 46 10 15 12 44 51 10 9 22 54

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_116716238_116717319
seq2: B6Ng01-251G15.b_46_1118 (reverse)

seq1  TCCTGCAGGTTTTCAT-GTGTCTTCCACGCAGGA-GAACACTCTCCTACC  48
      ||||||||  |||||| ||||||| || ||| || ||||||||||||| |
seq2  TCCTGCAG--TTTCATGGTGTCTT-CAAGCAAGAGGAACACTCTCCTA-C  46

seq1  ATACAAACATAAATTTTAAAATGTAGTAATAAAGTTACAGAGCAGGCATG  98
      |||| |||||||||||  ||||||||| ||||||||||||||||||||| 
seq2  ATAC-AACATAAATTT--AAATGTAGT-ATAAAGTTACAGAGCAGGCAT-  91

seq1  GGGGTGCATGCCGTGAATCCCAAAATAAATAAGCGTGATGGTAAATTCTT  148
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GGGGTGCATGCCGTGAATCCCAAAATAAATAAGCGTGATGGT-AATTCTT  140

seq1  TTACGATGATGACTAAAGGTCTTCTGTAGAATTAGGAGGCTTTGGGATTG  198
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  TTACGATGATGACTAAAGGTCTTCTGTAGAATTAGGAGGC-TTGGGATTG  189

seq1  AAAGCCTGGCTTCAGAACTGGGATGCTTTGCTACGTTCAGCAAGTTAGCT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCTGGCTTCAGAACTGGGATGCTTTGCTACGTTCAGCAAGTTAGCT  239

seq1  CTGTGACCCCAGGTTCTTTACTAAGATCATGGCTATGCAGGCAGTATAGT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGACCCCAGGTTCTTTACTAAGATCATGGCTATGCAGGCAGTATAGT  289

seq1  GCTTCTGGCTCAATATGCATGCAAGTCTTGTCAAAATCATGTTCTAATCC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCTGGCTCAATATGCATGCAAGTCTTGTCAAAATCATGTTCTAATCC  339

seq1  TGAACAGTGCTGTAGTTGTTGAAACATTGGATTTTTGAGGCTTTGTAATC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACAGTGCTGTAGTTGTTGAAACATTGGATTTTTGAGGCTTTGTAATC  389

seq1  TCATTCTCAATTTATAATTTCATCAGAAGCTTTAAGATTTTTATGCTGAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTCTCAATTTATAATTTCATCAGAAGCTTTAAGATTTTTATGCTGAA  439

seq1  GCTGGGCGTGGTGGCGCACGCCTTTAATGCCAGCACTCGGAGGCAGAGGC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGGCGTGGTGGCGCACGCCTTTAATGCCAGCACTCGGAGGCAGAGGC  489

seq1  GGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGG  539

seq1  ACAGCCAAGGCTATACAGAGAAACCCTTTCTCGAAAAACAACAAAAAGAA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCCAAGGCTATACAGAGAAACCCTTTCTCGAAAAACAACAAAAAGAA  589

seq1  AAAAAAAAAAAAAAAAAACAAAGATTTTTATGCTGAAGCTGAGCAGTAGT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAAAAAAAAAACAAAGATTTTTATGCTGAAGCTGAGCAGTAGT  639

seq1  GACGCACGTCTTTAATTCCAGCACTTGGGAGGCAGAGGCAGGTGAATTTC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGCACGTCTTTAATTCCAGCACTTGGGAGGCAGAGGCAGGTGAATTTC  689

seq1  TGAGTTCAAGGCCAGCCTGGTCTACAGAGTAAGTTCCAGGACAGCCAGGG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTTCAAGGCCAGCCTGGTCTACAGAGTAAGTTCCAGGACAGCCAGGG  739

seq1  CTATACAGAGAAACCCTGTCTCAAAAAAACAAAACAAAACAAAAAAAGAT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATACAGAGAAACCCTGTCTCAAAAAAACAAAACAAAACAAAAAAAGAT  789

seq1  TTTTATGCTGTTTAGACATAGAAAATGAAAACTTCACAGGTCTGTAGTAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATGCTGTTTAGACATAGAAAATGAAAACTTCACAGGTCTGTAGTAC  839

seq1  TTTGGATTTGTAGCTGGAAATGTACTAAATACATGCACATATACAACCTC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGATTTGTAGCTGGAAATGTACTAAATACATGCACATATACAACCTC  889

seq1  TCTCCCTCCAATTGCCTCCTCTCTTGTCTGGCGTGGAGCTTGTAGCATAA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCTCCAATTGCCTCCTCTCTTGTCTGGCGTGGAGCTTGTAGCATAA  939

seq1  TACAAGATAACCTTGAACTTCAGGTATCTACACCTCCCTAGTGATAAACT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAGATAACCTTGAACTTCAGGTATCTACACCTCCCTAGTGATAAACT  989

seq1  TAGAAACCTGTAGCATCAGGCCTGGCTTCAGGGTTTCCTTTTTTCTCTTT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAACCTGTAGCATCAGGCCTGGCTTCAGGGTTTCCTTTTTTCTCTTT  1039

seq1  CCTCCTCTTTCCAATAACTTACATCAAAGAATTC  1082
      ||||||||||||||||||||||||||||||||||
seq2  CCTCCTCTTTCCAATAACTTACATCAAAGAATTC  1073

seq1: chr11_116576124_116576929
seq2: B6Ng01-251G15.g_69_876

seq1  GAATTCCATTACCTGTGTACACAGGAATCTCTTATATGACCGTAATATAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATTACCTGTGTACACAGGAATCTCTTATATGACCGTAATATAG  50

seq1  CTTATGATCGCCTTGCTCCCTTCACAGGCTTAGCAGGCGCTTGGTTGTCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATGATCGCCTTGCTCCCTTCACAGGCTTAGCAGGCGCTTGGTTGTCA  100

seq1  GAAGGACCAGGTAGCCACAAAGATTCATCAGCCATCACATACATATTCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGACCAGGTAGCCACAAAGATTCATCAGCCATCACATACATATTCAT  150

seq1  GATCGCCCCAACTTACTCCTATGTTAACTGGAGGATTGGGGTTTAGGCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCGCCCCAACTTACTCCTATGTTAACTGGAGGATTGGGGTTTAGGCCC  200

seq1  AATATATATAATTAGTCCCCGTTACCTGTACAGAGAGAGCAGAGCAAGGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATATATAATTAGTCCCCGTTACCTGTACAGAGAGAGCAGAGCAAGGA  250

seq1  ACACAGTTTTAGCATCCAAAGGCTCCTCAGACTGTTGAACTATGGCTTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGTTTTAGCATCCAAAGGCTCCTCAGACTGTTGAACTATGGCTTCC  300

seq1  CTTACCAGACAATTTCAATGGTTTTCTCATCGTGTCCTCTCCTGCAGAAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACCAGACAATTTCAATGGTTTTCTCATCGTGTCCTCTCCTGCAGAAC  350

seq1  ATGAGTATAACCTCAGCCCCATCTTAACACCTCTGACTCCATTCTGATGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGTATAACCTCAGCCCCATCTTAACACCTCTGACTCCATTCTGATGT  400

seq1  TACAACATCCCTGTAGTTCACAGGCCAACTCAATTCAACGGGTTTTTTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAACATCCCTGTAGTTCACAGGCCAACTCAATTCAACGGGTTTTTTTC  450

seq1  CACAGTCCAAAGCCTTTCAGCAGCTGTGGTCTCTGCTTCGTAAGCATTTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTCCAAAGCCTTTCAGCAGCTGTGGTCTCTGCTTCGTAAGCATTTA  500

seq1  AAAATTTAAATTTAGTAAGATATTATGTAATCTGTCCCTGGGAGTCCTCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTTAAATTTAGTAAGATATTATGTAATCTGTCCCTGGGAGTCCTCA  550

seq1  TAGCCCCCTTTTGTTTCAAAAGTATCTTTTTTTTTTTTGAGTGAGATAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCCCCTTTTGTTTCAAAAGTATCTTTTTTTTTTTTGAGTGAGATAAG  600

seq1  ATCTTAACAATGAACAGGCAAAAGGTTGTTTCATTTTATTAGGAACATAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTAACAATGAACAGGCAAAAGGTTGTTTCATTTTATTAGGAACATAA  650

seq1  GCAGGAGTGTTGTAAGTTGCTTTTTTTTTTTTGTATAAGTAGCCCATTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGAGTGTTGTAAGTTGCTTTTTTTTTTTTGTATAAGTAGCCCATTAG  700

seq1  AGCCTTAGTCTCTAATAAATGTGTAATTACAGAATCAGCCTTC-TCAGAA  749
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  AGCCTTAGTCTCTAATAAATGTGTAATTACAGAATCAGCCTTCTTCAGAA  750

seq1  TTCAAGGCAGATTCCAGTTGAAATCCAGGGTATG-TATCAATACTATAAT  798
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  TTCAAGGCAGATTCCAGTTGAAATCCAGGGTATGTTATCAATACTATAAT  800

seq1  GTATAGAT  806
      ||||||||
seq2  GTATAGAT  808

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information