MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-258C12
Chromosome	11 (Build37)
Map Location	71,108,221 - 71,109,406
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Alox12e, Alox15, LOC668466, Pelp1, Arrb2, Med11, Cxcl16, Zmynd15, Tm4sf5, Vmo1, C730027E14Rik, Psmb6, Pld2, Mink1, Chrne, LOC668433, Gp1ba, Slc25a11, Rnf167, Pfn1, Eno3, Spag7, Camta2, AI842396, Kif1c, LOC668488, Zfp3, A430084P05Rik, Rabep1, LOC668461, Nup88, Rpain, C1qbp, Dhx33, Derl2, Mis12, 6330403K07Rik, LOC382536, Nlrp1a, Nlrp1b, Nlrp1c
Downstream gene	LOC100043249, 9230020A06Rik, Wscd1, Aipl1, 6720460F02Rik, Pitpnm3, 4933427D14Rik, Txnl5, Med31, 4930563E22Rik, Slc13a5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Alox12e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11685 MGI:1274790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11687 MGI:87997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 8 Proteins pseudo : _no_value

name	Pelp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75273 MGI:1922523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216869 MGI:99474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66172 MGI:1913422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxcl16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66102 MGI:1932682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574428 MGI:3603821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm4sf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75604 MGI:1922854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327956 MGI:2685587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730027E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216871 MGI:2444527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19175 MGI:104880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pld2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18806 MGI:892877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mink1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Chrne (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11448 MGI:87894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gp1ba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14723 MGI:1333744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67863 MGI:1915113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70510 MGI:1917760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18643 MGI:97549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eno3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13808 MGI:95395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spag7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216873 MGI:107380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camta2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216874 MGI:2135957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI842396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103844 MGI:2144284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16562 MGI:1098260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Zfp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193043 MGI:99177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A430084P05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327957 MGI:3610314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54189 MGI:1860236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 4 Proteins pseudo : _no_value

name	Nup88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpain (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69723 MGI:1916973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12261 MGI:1194505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216877 MGI:2445102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Derl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116891 MGI:2151483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mis12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67139 MGI:1914389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330403K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103712 MGI:1918001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382536
definition	note : RNA binding motif protein 7 pseudogene pseudo : _no_value

name	Nlrp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195046 MGI:2684861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637515 MGI:3582959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627984 MGI:3582962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein pseudo : _no_value

name	9230020A06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619299 MGI:3588244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Wscd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216881 MGI:2448493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aipl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114230 MGI:2148800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6720460F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109212 MGI:1924434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitpnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327958 MGI:2685726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933427D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74477 MGI:1921727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52700 MGI:1289248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67279 MGI:1914529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930563E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75304 MGI:1922554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs

name	Slc13a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237831 MGI:3037150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729794 GeneID:11685 MGI:1274790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate lipoxygenase, epidermal transcript_id : NM_145684.1

name	Alox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948632 GeneID:11687 MGI:87997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 15-lipoxygenase transcript_id : NM_009660.3

name	Pelp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345821 GeneID:75273 MGI:1922523
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline, glutamic acid and leucine rich protein 1 transcript_id : NM_029231.3

name	Arrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801978 GeneID:216869 MGI:99474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin, beta 2 transcript_id : NM_145429.3

name	Med11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754137 GeneID:66172 MGI:1913422
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 11 homolog (S. cerevisiae) transcript_id : NM_025397.2

name	Cxcl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802996 GeneID:66102 MGI:1932682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 16 transcript_id : NM_023158.6

name	Zmynd15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365130 GeneID:574428 MGI:3603821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYND-type containing 15 transcript_id : NM_001029929.2

name	Tm4sf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802651 GeneID:75604 MGI:1922854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 4 superfamily member 5 transcript_id : NM_029360.2

name	Vmo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888887 GeneID:327956 MGI:2685587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitelline membrane outer layer 1 homolog (chicken) transcript_id : NM_001013607.1

name	C730027E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122496 GeneID:216871 MGI:2444527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730027E14 gene transcript_id : NM_146020.1

name	Psmb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803367 GeneID:19175 MGI:104880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 6 transcript_id : NM_008946.3

name	Pld2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130632 GeneID:18806 MGI:892877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D2 transcript_id : NM_008876.2

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052103 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_001045964.1

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052521 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_001045959.1

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052415 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_176893.2

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052441 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_016713.2

name	Chrne (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752949 GeneID:11448 MGI:87894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, epsilon polypeptide transcript_id : NM_009603.1

name	LOC668433 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390186 GeneID:668433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC668433 transcript_id : XM_001004767.1

name	Gp1ba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754037 GeneID:14723 MGI:1333744
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein 1b, alpha polypeptide transcript_id : NM_010326.1

name	Slc25a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980956 GeneID:67863 MGI:1915113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11 transcript_id : NM_024211.2

name	Rnf167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076962 GeneID:70510 MGI:1917760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 167 transcript_id : NM_027445.1

name	Pfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803120 GeneID:18643 MGI:97549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : profilin 1 transcript_id : NM_011072.3

name	Eno3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982848 GeneID:13808 MGI:95395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enolase 3, beta muscle transcript_id : NM_007933.2

name	Spag7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388082 GeneID:216873 MGI:107380
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 7 transcript_id : NM_172561.2

name	Camta2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130545 GeneID:216874 MGI:2135957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin binding transcription activator 2 transcript_id : NM_178116.3

name	AI842396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523978 GeneID:103844 MGI:2144284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI842396 transcript_id : NM_213729.1

name	Kif1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23821039 GeneID:16562 MGI:1098260
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1C transcript_id : NM_153103.1

name	LOC668488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390191 GeneID:668488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC668488 transcript_id : XM_001001755.1

name	Zfp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83423531 GeneID:193043 MGI:99177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 3 transcript_id : NM_177565.3

name	A430084P05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382084 GeneID:327957 MGI:3610314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430084P05 gene transcript_id : NM_001045526.2

name	Rabep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507020 GeneID:54189 MGI:1860236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabaptin, RAB GTPase binding effector protein 1 transcript_id : NM_019400.1

name	Nup88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955408 GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 88 transcript_id : NM_172394.2

name	Nup88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053893 GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 88 transcript_id : NM_001083331.1

name	Rpain (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037172 GeneID:69723 MGI:1916973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RPA interacting protein transcript_id : NM_027186.1

name	C1qbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181166 GeneID:12261 MGI:1194505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent binding protein transcript_id : NM_007573.2

name	Dhx33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109637749 GeneID:216877 MGI:2445102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 33 transcript_id : NM_178367.4

name	Derl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130773 GeneID:116891 MGI:2151483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Der1-like domain family, member 2 transcript_id : NM_033562.3

name	Mis12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356584 GeneID:67139 MGI:1914389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MIS12 homolog (yeast) transcript_id : NM_025993.2

name	6330403K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21624634 GeneID:103712 MGI:1918001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330403K07 gene transcript_id : NM_134022.1

name	Nlrp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921280 GeneID:195046 MGI:2684861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1A transcript_id : NM_001004142.1

name	Nlrp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665739 GeneID:637515 MGI:3582959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1B transcript_id : NM_001040696.1

name	Nlrp1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986636 GeneID:627984 MGI:3582962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1C transcript_id : NM_001039234.1

name	Wscd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475951 GeneID:216881 MGI:2448493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WSC domain containing 1 transcript_id : NM_177618.4

name	Aipl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426862 GeneID:114230 MGI:2148800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor-interacting protein-like 1 transcript_id : NM_053245.1

name	6720460F02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388016 GeneID:109212 MGI:1924434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720460F02 gene transcript_id : NM_144526.3

name	Pitpnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032318 GeneID:327958 MGI:2685726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PITPNM family member 3 transcript_id : NM_001081641.1

name	Pitpnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032351 GeneID:327958 MGI:2685726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PITPNM family member 3 transcript_id : NM_001024927.2

name	4933427D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130566 GeneID:74477 MGI:1921727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933427D14 gene transcript_id : NM_028963.2

name	Txnl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801882 GeneID:52700 MGI:1289248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin-like 5 transcript_id : NM_026559.3

name	Med31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119161 GeneID:67279 MGI:1914529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 31 homolog (yeast) transcript_id : NM_026068.2

name	4930563E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390195 GeneID:75304 MGI:1922554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs product : RIKEN cDNA 4930563E22 gene, transcript variant 1 transcript_id : XM_618902.3

name	Slc13a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385951 GeneID:237831 MGI:3037150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 transcript_id : NM_001004148.3

name	Alox12e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729795 CCDS:CCDS24943.1 GeneID:11685 MGI:1274790
definition	GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA] codon_start : 1 product : arachidonate lipoxygenase, epidermal protein_id : NP_663717.1

name	Alox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948633 CCDS:CCDS24944.1 GeneID:11687 MGI:87997
definition	GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : arachidonate 15-lipoxygenase protein_id : NP_033790.3

name	Pelp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38230105 CCDS:CCDS24945.1 GeneID:75273 MGI:1922523
definition	codon_start : 1 exception : mismatches in translation product : proline-, glutamic acid-, leucine-rich protein 1 protein_id : NP_083507.2

name	Arrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703856 CCDS:CCDS24946.1 GeneID:216869 MGI:99474
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IGI] [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : beta arr2; beta-arrestin-2; beta-arrestin2 product : arrestin, beta 2 protein_id : NP_663404.1

name	Med11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754138 CCDS:CCDS24947.1 GeneID:66172 MGI:1913422
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 11 homolog protein_id : NP_079673.2

name	Cxcl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745124 CCDS:CCDS24948.1 GeneID:66102 MGI:1932682
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA]; GO:0005044 - scavenger receptor activity [Evidence IDA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : Cxc chemokine ligand 16; SR-PSOX/CXCL16; Scavenger Receptor; zinc finger, MYND-type containing 15 product : chemokine (C-X-C motif) ligand 16 protein_id : NP_075647.3

name	Zmynd15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480094 CCDS:CCDS24949.1 GeneID:574428 MGI:3603821
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, MYND domain containing 15 protein_id : NP_001025100.1

name	Tm4sf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312990 CCDS:CCDS24950.1 GeneID:75604 MGI:1922854
definition	codon_start : 1 exception : mismatches in translation product : transmembrane 4 superfamily member 5 protein_id : NP_083636.1

name	Vmo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888888 CCDS:CCDS24951.1 GeneID:327956 MGI:2685587
definition	codon_start : 1 product : vitelline membrane outer layer 1 homolog protein_id : NP_001013625.1

name	C730027E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122497 CCDS:CCDS24952.1 GeneID:216871 MGI:2444527
definition	codon_start : 1 product : hypothetical protein LOC216871 protein_id : NP_666132.1

name	Psmb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982099 GeneID:19175 MGI:104880
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : subunit 2 product : proteasome (prosome, macropain) subunit, beta type 6 protein_id : NP_032972.2

name	Pld2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679379 CCDS:CCDS24953.1 GeneID:18806 MGI:892877
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0004630 - phospholipase D activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0002031 - G-protein coupled receptor internalization [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence IDA] codon_start : 1 product : phospholipase D2 protein_id : NP_032902.1

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052104 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 4 protein_id : NP_001039429.1

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052522 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 3 protein_id : NP_001039424.1

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052416 CCDS:CCDS24955.1 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 2 protein_id : NP_795712.2

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052442 CCDS:CCDS24954.1 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 1 protein_id : NP_057922.2

name	Chrne (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752950 CCDS:CCDS24956.1 GeneID:11448 MGI:87894
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor epsilon; AChrepsilon; AchR epsilon subunit; acetylcholine receptor epsilon subunit product : cholinergic receptor, nicotinic, epsilon polypeptide protein_id : NP_033733.1

name	LOC668433 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390187 GeneID:668433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004767.1

name	Gp1ba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754038 CCDS:CCDS24957.1 GeneID:14723 MGI:1333744
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0000902 - cell morphogenesis [Evidence IMP]; GO:0007599 - hemostasis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : glycoprotein 1b, alpha polypeptide protein_id : NP_034456.1

name	Slc25a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312994 CCDS:CCDS24958.1 GeneID:67863 MGI:1915113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 product : solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11 protein_id : NP_077173.1

name	Rnf167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076963 CCDS:CCDS24959.1 GeneID:70510 MGI:1917760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : novel PA domain and C3HC4 type zinc finger (RING finger) containing protein product : ring finger protein 167 protein_id : NP_081721.1

name	Pfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755040 CCDS:CCDS24960.1 GeneID:18643 MGI:97549
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IGI]; GO:0008064 - regulation of actin polymerization and/or depolymerization [Evidence TAS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0042989 - sequestering of actin monomers [Evidence TAS] codon_start : 1 note : actin binding protein product : profilin 1 protein_id : NP_035202.1

name	Eno3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679651 CCDS:CCDS24961.1 GeneID:13808 MGI:95395
definition	GO_component : GO:0000015 - phosphopyruvate hydratase complex [Evidence IEA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004634 - phosphopyruvate hydratase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : enolase 3, beta muscle protein_id : NP_031959.1

name	Spag7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369786 CCDS:CCDS24962.1 GeneID:216873 MGI:107380
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sperm associated antigen 7 protein_id : NP_766149.1

name	Camta2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017453 CCDS:CCDS24963.1 GeneID:216874 MGI:2135957
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : calmodulin binding transcription activator 2 protein_id : NP_835217.1

name	AI842396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523979 CCDS:CCDS24964.1 GeneID:103844 MGI:2144284
definition	codon_start : 1 product : inhibitor of CDK interacting with cyclin A1 protein_id : NP_998894.1

name	Kif1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821040 CCDS:CCDS24965.1 GeneID:16562 MGI:1098260
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence IDA] codon_start : 1 exception : mismatches in translation note : kinesin superfamily protein 1C; kinesin 1C; lethal factor toxin susceptibility 1; N-3 kinsin product : kinesin family member 1C protein_id : NP_694743.1

name	LOC668488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390192 GeneID:668488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001755.1

name	Zfp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243904 CCDS:CCDS24966.1 GeneID:193043 MGI:99177
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 3 protein_id : NP_808233.1

name	A430084P05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865879 CCDS:CCDS24967.1 GeneID:327957 MGI:3610314
definition	codon_start : 1 product : hypothetical protein LOC327957 protein_id : NP_001038991.1

name	Rabep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507021 CCDS:CCDS24968.1 GeneID:54189 MGI:1860236
definition	GO_component : GO:0005768 - endosome [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : rabaptin 5; neurocrescin; RAB5 effector protein product : rabaptin, RAB GTPase binding effector protein 1 protein_id : NP_062273.1

name	Nup88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955409 GeneID:19069 MGI:104900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; preimplantation protein 2; nucleoporin 88kDa product : nucleoporin 88 isoform 1 protein_id : NP_765982.2

name	Nup88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053894 GeneID:19069 MGI:104900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; preimplantation protein 2; nucleoporin 88kDa product : nucleoporin 88 isoform 2 protein_id : NP_001076800.1

name	Rpain (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037173 CCDS:CCDS24969.1 GeneID:69723 MGI:1916973
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : RPA interacting protein delta 2; RPA interacting protein epsilon product : RPA interacting protein protein_id : NP_081462.1

name	C1qbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181167 CCDS:CCDS24970.1 GeneID:12261 MGI:1194505
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006956 - complement activation [Evidence IEA] codon_start : 1 product : complement component 1, q subcomponent binding protein protein_id : NP_031599.2

name	Dhx33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560585 CCDS:CCDS24971.1 GeneID:216877 MGI:2445102
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33 product : DEAH (Asp-Glu-Ala-His) box polypeptide 33 protein_id : NP_848144.3

name	Derl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15808990 CCDS:CCDS24972.1 GeneID:116891 MGI:2151483
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0030307 - positive regulation of cell growth [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0030970 - retrograde protein transport, ER to cytosol [Evidence ISS]; GO:0030968 - unfolded protein response [Evidence ISS] codon_start : 1 note : derlin 2; carcinoma related product : Der1-like domain family, member 2 protein_id : NP_291040.1

name	Mis12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313120 CCDS:CCDS24973.1 GeneID:67139 MGI:1914389
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA] [Evidence ISS]; GO:0000778 - condensed nuclear chromosome kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0051382 - kinetochore assembly [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : MIS12 homolog protein_id : NP_080269.1

name	6330403K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624635 GeneID:103712 MGI:1918001
definition	codon_start : 1 product : hypothetical protein LOC103712 protein_id : NP_598783.1

name	Nlrp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921281 GeneID:195046 MGI:2684861
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006919 - caspase activation [Evidence ISS]; GO:0008219 - cell death [Evidence IDA]; GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0051402 - neuron apoptosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : death effector filament-forming Ced-4-like apoptosis protein; NACHT/LRR/pyrin domain-containing protein 1; caspase recruitment domain protein; NACHT, LRR and PYD containing protein 1; NLR family, pyrin domain containing 1 product : NACHT, leucine rich repeat and PYD containing 1 protein_id : NP_001004142.1

name	Nlrp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665740 GeneID:637515 MGI:3582959
definition	codon_start : 1 product : NACHT-, LRR-, and PYD-containing protein 1 paralog b protein_id : NP_001035786.1

name	Nlrp1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986637 GeneID:627984 MGI:3582962
definition	codon_start : 1 product : NACHT-, LRR-, and PYD-containing 1 paralog c protein_id : NP_001034323.1

name	Wscd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560748 CCDS:CCDS24975.1 GeneID:216881 MGI:2448493
definition	codon_start : 1 product : WSC domain containing 1 protein_id : NP_808286.2

name	Aipl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426863 CCDS:CCDS24976.1 GeneID:114230 MGI:2148800
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0001917 - photoreceptor inner segment [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0001918 - farnesylated protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0007603 - phototransduction, visible light [Evidence IMP]; GO:0018343 - protein farnesylation [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA]; GO:0030823 - regulation of cGMP metabolism [Evidence IMP]; GO:0001895 - retinal homeostasis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : aryl hydrocarbon receptor-interacting protein-like 1 protein_id : NP_444475.1

name	6720460F02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27735010 GeneID:109212 MGI:1924434
definition	codon_start : 1 product : hypothetical protein LOC109212 protein_id : NP_653109.2

name	Pitpnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032319 GeneID:327958 MGI:2685726
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Pitpnm family member 3 isoform 2 protein_id : NP_001075110.1

name	Pitpnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972419 CCDS:CCDS24978.1 GeneID:327958 MGI:2685726
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Pitpnm family member 3 isoform 1 protein_id : NP_001020098.1

name	4933427D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859728 CCDS:CCDS24979.1 GeneID:74477 MGI:1921727
definition	codon_start : 1 product : hypothetical protein LOC74477 protein_id : NP_083239.1

name	Txnl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386060 CCDS:CCDS24980.1 GeneID:52700 MGI:1289248
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : putative 42-9-9 protein product : thioredoxin-like 5 protein_id : NP_080835.1

name	Med31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119162 CCDS:CCDS24981.1 GeneID:67279 MGI:1914529
definition	GO_component : GO:0000119 - mediator complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016455 - RNA polymerase II transcription mediator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 31 homolog protein_id : NP_080344.2

name	4930563E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63622315 GeneID:75304 MGI:1922554
definition	codon_start : 1 product : hypothetical protein LOC75304 isoform 1 protein_id : XP_618902.1

name	Slc13a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921291 CCDS:CCDS24983.1 GeneID:237831 MGI:3037150
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0015137 - citrate transporter activity [Evidence IDA]; GO:0015141 - succinate transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015142 - tricarboxylic acid transporter activity [Evidence IDA] GO_process : GO:0015746 - citrate transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0015744 - succinate transport [Evidence IDA]; GO:0006842 - tricarboxylic acid transport [Evidence IDA] codon_start : 1 note : sodium-coupled citrate transporter; novel solute carrier family 13 (sodium-dependent dicarboxylate transporter) (Slc13a2 or 3) member product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 protein_id : NP_001004148.1

name	LOC668466 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261976 GeneID:668466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 8 Proteins product : similar to Fgfr1op2 protein pseudo : _no_value transcript_id : XR_034580.1

name	LOC668461 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261977 GeneID:668461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 4 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034654.1

name	LOC100043249 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261978 GeneID:100043249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein product : hypothetical protein LOC100043249 pseudo : _no_value transcript_id : XR_034671.1

name	9230020A06Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261979 GeneID:619299 MGI:3588244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230020A06 gene transcript_id : XR_035429.1

clone name	MSMg01-409N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512K03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520P01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-097L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name		B6Ng01-258C12.g
ACC		GA063667
length		1,192
definition		B6Ng01-258C12.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence		gaattcttaacctacaagacaattgttcctgttttgggctcacaactcct ctaccataggactcctctaccataggactttagactcctctaaagtctat aaatgtaaggactgcgggttgctgaataaccaccatattccagctttccc cgctatgaatggctaattgttatcaaatacccatttatctgaaatgtata tctgtaaatatctatagtaaaacagtactccatccagacttcttttcctt tcatatataacaaatttcaattttatgtgactggagagaaaaatgagtaa gatattaggtttgtctgtgaggtattccaaataccattagtatgtgagtt aacaatctgattgggaaagtcacactttgaatgtgggtagcaccatccaa ttgtgttgggacccagacaaaagaggaggacacctgtcagcttatctcag aataaaagctagaaccttggccattctaggaaacctcttgcaaacttagt atccaaacatgtaagccaatctattaaatttcattttattgttaaaatgt atatttggttggttatgcctctaggggtcactgatatagagctttgatac aaaattaatatctaagaacaaggggagaaggagatacacagaacttccaa aacagcactctttgcttttgcaatttgttaatagatacagaatattgtat aagtataaaatgatatactttctgcacaagtcataattttccttgatttg cattaaaagaactctaacaaatactctttttaagagtctactatgtgaac acacacacacaaatgatttatcattaaaacatatacaaaccataaagaaa caagaatttaaatatctttatcatcataaacaggtgggctaataaatatc catggaggaaagatcaaaaaagagatcacagagaatcagattcccatggt tataaatgatgtcccctcctccatgtgcctggggagaggggaggatacag gtgcagcagccttttccaggtaagcaagtacttggtaaatacgactttct taccacagcccaggccaattacagaataaacctgggcttccatgatggtt ttggataaatccataaagaatgcctgtataatggaatccaatttattagc atactgagatgcctacccttagtccttggtttttactttctg
quality values		Open. Hide. 62 49 39 39 62 62 62 47 62 62 51 56 44 38 35 34 28 34 37 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 54 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 56 54 62 62 62 62 62 62 62 62 62 54 54 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 54 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 52 58 58 58 58 58 58 58 49 48 58 58 49 47 54 58 58 58 58 58 58 58 54 54 54 58 58 58 54 54 54 54 58 58 58 53 53 53 51 58 58 58 58 58 58 58 58 45 53 49 53 40 58 58 58 52 58 51 54 49 47 51 58 51 51 58 52 58 48 51 50 50 48 58 58 58 41 37 58 48 32 58 54 31 39 39 53 53 41 53 53 52 58 58 49 58 58 50 49 36 58 58 58 49 46 54 54 58 51 58 58 53 58 58 52 51 58 58 58 58 51 50 58 51 43 58 40 51 39 37 25 50 53 45 42 45 42 52 51 39 43 58 50 39 40 41 58 58 40 50 52 32 51 50 53 42 45 29 54 54 41 39 53 52 32 45 53 42 49 54 54 37 53 52 49 41 37 42 37 52 42 49 37 42 39 49 40 37 54 54 53 39 51 42 52 45 37 32 54 51 37 37 23 40 53 52 54 54 45 32 35 28 28 42 45 35 29 36 31 31 54 51 39 32 45 53 53 40 54 54 54 45 32 52 35 53 29 32 34 40 35 37 32 33 52 42 45 39 52 45 32 31 34 32 53 40 42 32 51 31 39 41 53 36 32 40 40 23 53 53 35 42 31 28 21 40 27 51 51 31 43 26 43 32 45 23 40 27 51 30 30 32 21 26 30 46 42 38 42 46 32 30 29 33 43 35 31 32 48 41 31 46 28 37 19 27 31 38 46 31 22 24 31 32 36 36 25 34 26 46 30 30 21 43 42 17 22 46 30 26 36 31 31 31 31 48 31 30 32 36 26 19 16 30 33 43 30 21 25 28 47 30 16 24 16 32 48 46 46 46 46 36 21 37 18 15 22 32 30 22 17 25 32 9 17 33 17 31 31 10 29 13 38 31 44 33 23 21 23 44 30 21 29 18 27 48 32 21 31 34 21 31 24 20 6 5 9 23 11 11 27 28 31 24 24 28 29 34 26 30 27 25 43 34 11 23 7 18 9 47 43 11 34 14 37 28 28 28 31 8 25 19 13 23 30 21 17 30 8 9 27 12 37 48 48 17 9 9 34 10 17 32 21 22 11 23 20 17 19 7 13 28 10 28 12 14 11 7 38 19 13 13 29 14 21 13 23 32 15 6 6 22 13 8 7 5 11 17 6 13 32 19 5 3 13 10 7 30 22 7 14 19 6 5 5 13 27 20 20 38 23 9 10 12 28 34 30 8 21 21 6 9 8 30 9 13 4 6 3 6 21 17 9 3 13 3 5 17 17 4 14 9 7 4 23 8 25 15 9 8 17 4 19 6 8 14 16 4 7 4 10 6 26 5 8 6 7 23 4 4 14 17 15 17 9 11 8 7 3 2 3 6 7 5 15 7 4 8 4 2 3 2 3 8 11 14 7 16 17 13 7 3 1 3 5 15 5 4 4 4 7 25 28 25 8 8 3 4 16 10 11 9 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_71108221_71109406
seq2: B6Ng01-258C12.g_65_1256 (reverse)

seq1  CAGAAAGTAAAAAACAAGGAATTAAGAGTTAAGCAAATCTAGTATGCATA  50
      ||||||||||||| ||||| | |||| | || |||  || ||||||| ||
seq2  CAGAAAGTAAAAACCAAGG-ACTAAG-GGTAGGCATCTC-AGTATGC-TA  46

seq1  ATAAATTTGAAT-CAATATACAAGCATTCTTTAAGAATTTACCAAAAACA  99
      ||||||| || | || |||||| |||||||||| | ||||| | ||||| 
seq2  ATAAATTGGATTCCATTATACAGGCATTCTTTATGGATTTATCCAAAACC  96

seq1  TTCAATGAAACCCA-GTTTA-TCTGTAATTTGCCTTGGGCTGT-GTAAGA  146
       |||  ||| |||| ||||| ||||||||| ||| |||||||| ||||||
seq2  ATCATGGAAGCCCAGGTTTATTCTGTAATTGGCC-TGGGCTGTGGTAAGA  145

seq1  AAGTCGTATTTA-CAAGTACTTGCTTTACTTGAAAA-GCTGCTGCACCTG  194
      |||||||||||| |||||||||||||  || ||||| |||||||||||||
seq2  AAGTCGTATTTACCAAGTACTTGCTTACCTGGAAAAGGCTGCTGCACCTG  195

seq1  TATCCT-CCCTCT-CCCAGGCACATGGAG--AGAGACATCATTTATAACC  240
      |||||| |||||| |||||||||||||||   | ||||||||||||||||
seq2  TATCCTCCCCTCTCCCCAGGCACATGGAGGAGGGGACATCATTTATAACC  245

seq1  ATGGGAATCTGATTCTCTGTGATCTCTTTTTTGATCTTTCCTCCATGGAT  290
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGAATCTGATTCTCTGTGATCTCTTTTTTGATCTTTCCTCCATGGAT  295

seq1  ATTTATTAG-CCACCTGTTTATGATGATAAAGATATTTAAATTCTTGTTT  339
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATTAGCCCACCTGTTTATGATGATAAAGATATTTAAATTCTTGTTT  345

seq1  CTTTATGGTTTGTATATGTTTTAATGATAAATCATTTGTGTGTGTGTGTT  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATGGTTTGTATATGTTTTAATGATAAATCATTTGTGTGTGTGTGTT  395

seq1  CACATAGTAGACTCTTAAAAAGAGTATTTGTTAGAGTTCTTTTAATGCAA  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATAGTAGACTCTTAAAAAGAGTATTTGTTAGAGTTCTTTTAATGCAA  445

seq1  ATCAAGGAAAATTATGACTTGTGCAGAAAGTATATCATTTTATACTTATA  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGGAAAATTATGACTTGTGCAGAAAGTATATCATTTTATACTTATA  495

seq1  CAATATTCTGTATCTATTAACAAATTGCAAAAGCAAAGAGTGCTGTTTTG  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATATTCTGTATCTATTAACAAATTGCAAAAGCAAAGAGTGCTGTTTTG  545

seq1  GAAGTTCTGTGTATCTCCTTCTCCCCTTGTTCTTAGATATTAATTTTGTA  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTTCTGTGTATCTCCTTCTCCCCTTGTTCTTAGATATTAATTTTGTA  595

seq1  TCAAAGCTCTATATCAGTGACCCCTAGAGGCATAACCAACCAAATATACA  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGCTCTATATCAGTGACCCCTAGAGGCATAACCAACCAAATATACA  645

seq1  TTTTAACAATAAAATGAAATTTAATAGATTGGCTTACATGTTTGGATACT  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAACAATAAAATGAAATTTAATAGATTGGCTTACATGTTTGGATACT  695

seq1  AAGTTTGCAAGAGGTTTCCTAGAATGGCCAAGGTTCTAGCTTTTATTCTG  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTTGCAAGAGGTTTCCTAGAATGGCCAAGGTTCTAGCTTTTATTCTG  745

seq1  AGATAAGCTGACAGGTGTCCTCCTCTTTTGTCTGGGTCCCAACACAATTG  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAAGCTGACAGGTGTCCTCCTCTTTTGTCTGGGTCCCAACACAATTG  795

seq1  GATGGTGCTACCCACATTCAAAGTGTGACTTTCCCAATCAGATTGTTAAC  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGTGCTACCCACATTCAAAGTGTGACTTTCCCAATCAGATTGTTAAC  845

seq1  TCACATACTAATGGTATTTGGAATACCTCACAGACAAACCTAATATCTTA  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACATACTAATGGTATTTGGAATACCTCACAGACAAACCTAATATCTTA  895

seq1  CTCATTTTTCTCTCCAGTCACATAAAATTGAAATTTGTTATATATGAAAG  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATTTTTCTCTCCAGTCACATAAAATTGAAATTTGTTATATATGAAAG  945

seq1  GAAAAGAAGTCTGGATGGAGTACTGTTTTACTATAGATATTTACAGATAT  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAGAAGTCTGGATGGAGTACTGTTTTACTATAGATATTTACAGATAT  995

seq1  ACATTTCAGATAAATGGGTATTTGATAACAATTAGCCATTCATAGCGGGG  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTCAGATAAATGGGTATTTGATAACAATTAGCCATTCATAGCGGGG  1045

seq1  AAAGCTGGAATATGGTGGTTATTCAGCAACCCGCAGTCCTTACATTTATA  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCTGGAATATGGTGGTTATTCAGCAACCCGCAGTCCTTACATTTATA  1095

seq1  GACTTTAGAGGAGTCTAAAGTCCTATGGTAGAGGAGTCCTATGGTAGAGG  1139
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTTAGAGGAGTCTAAAGTCCTATGGTAGAGGAGTCCTATGGTAGAGG  1145

seq1  AGTTGTGAGCCCAAAACAGGAACAATTGTCTTGTAGGTTAAGAATTC  1186
      |||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGTGAGCCCAAAACAGGAACAATTGTCTTGTAGGTTAAGAATTC  1192

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information