MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-264P14
Chromosome	11 (Build37)
Map Location	117,412,863 - 117,509,644
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Ube2o, Aanat, Rhbdf2, Cygb, OTTMUSG00000003947, 1810032O08Rik, St6galnac2, LOC634720, BC018473, St6galnac1, Mxra7, Jmjd6, 1110005A03Rik, LOC100043293, Sfrs2, Mfsd11, Mgat5b, LOC100042036, Sec14l1, Sept9, EG667423
Downstream gene	Tnrc6c, Tmc6, Tmc8, 6030468B19Rik, Syngr2, Tk1, Afmid, Birc5, LOC546519, Tha1, Socs3, Pgs1, Dnahc17, Pscd1, Usp36, Timp2, Ddc8, Lgals3bp, Cant1, C1qtnf1, D230014K01Rik, D11Bwg0517e
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ube2o (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217342 MGI:2444266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aanat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11298 MGI:1328365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217344 MGI:2442473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cygb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114886 MGI:2149481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000003947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038570 MGI:3649529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	1810032O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66293 MGI:1913543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	St6galnac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20446 MGI:107553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634720 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 5 Proteins pseudo : _no_value

name	BC018473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193217 MGI:3039625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St6galnac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20445 MGI:1341826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67622 MGI:1914872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107817 MGI:1858910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110005A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74319 MGI:1921569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 245 ESTs

name	Sfrs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20382 MGI:98284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69900 MGI:1917150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268510 MGI:3606200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042036 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Sec14l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74136 MGI:1921386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53860 MGI:1858222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667423 MGI:3646811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 715 ESTs, 6 Proteins pseudo : _no_value

name	Tnrc6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217351 MGI:2443265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217353 MGI:1098686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217356 MGI:2669037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030468B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77727 MGI:1924977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	Syngr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20973 MGI:1328324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21877 MGI:98763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afmid (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71562 MGI:2448704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Birc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11799 MGI:1203517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC546519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71776 MGI:1919026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Socs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12702 MGI:1201791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74451 MGI:1921701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69926 MGI:1917176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins

name	Pscd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19157 MGI:1334257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72344 MGI:1919594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 107 ESTs, 3 Proteins

name	Timp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21858 MGI:98753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58251 MGI:1929713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals3bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19039 MGI:99554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cant1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	C1qtnf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56745 MGI:1919254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230014K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217364 MGI:2443788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Bwg0517e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ube2o (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50234895 GeneID:217342 MGI:2444266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2O transcript_id : NM_173755.3

name	Aanat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892622 GeneID:11298 MGI:1328365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylalkylamine N-acetyltransferase transcript_id : NM_009591.2

name	Rhbdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802637 GeneID:217344 MGI:2442473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid 5 homolog 2 (Drosophila) transcript_id : NM_172572.2

name	Cygb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802729 GeneID:114886 MGI:2149481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoglobin transcript_id : NM_030206.2

name	OTTMUSG00000003947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262516 GeneID:100038570 MGI:3649529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : predicted gene, OTTMUSG00000003947 transcript_id : XM_001477353.1

name	St6galnac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842375 GeneID:20446 MGI:107553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 transcript_id : NM_009180.3

name	St6galnac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116571 GeneID:20445 MGI:1341826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 transcript_id : NM_011371.2

name	Mxra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345537 GeneID:67622 MGI:1914872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix-remodelling associated 7 transcript_id : NM_026280.2

name	Jmjd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988378 GeneID:107817 MGI:1858910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 6 transcript_id : NM_033398.2

name	1110005A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980785 GeneID:74319 MGI:1921569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110005A03 gene transcript_id : NM_028865.2

name	LOC100043293 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262572 GeneID:100043293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 245 ESTs product : hypothetical protein LOC100043293 transcript_id : XM_001480574.1

name	Sfrs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755477 GeneID:20382 MGI:98284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 2 (SC-35) transcript_id : NM_011358.1

name	Mfsd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863770 GeneID:69900 MGI:1917150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 11 transcript_id : NM_178620.3

name	Mgat5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301484 GeneID:268510 MGI:3606200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 5, isoenzyme B transcript_id : NM_172948.3

name	LOC100042036 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262519 GeneID:100042036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042036 transcript_id : XM_001477442.1

name	Sec14l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371946 GeneID:74136 MGI:1921386
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC14-like 1 (S. cerevisiae) transcript_id : NM_028777.2

name	Sept9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393783 GeneID:53860 MGI:1858222
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 9 transcript_id : NM_017380.1

name	Tnrc6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378034 GeneID:217351 MGI:2443265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 6C transcript_id : NM_198022.2

name	Tmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703875 GeneID:217353 MGI:1098686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 6 transcript_id : NM_145439.1

name	Tmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803122 GeneID:217353 MGI:1098686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 6 transcript_id : NM_181321.3

name	Tmc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469502 GeneID:217356 MGI:2669037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like 8 transcript_id : NM_181856.1

name	6030468B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390956 GeneID:77727 MGI:1924977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : RIKEN cDNA 6030468B19 gene transcript_id : XM_126537.4

name	Syngr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106428 GeneID:20973 MGI:1328324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 2 transcript_id : NM_009304.1

name	Tk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678356 GeneID:21877 MGI:98763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymidine kinase 1 transcript_id : NM_009387.1

name	Afmid (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560783 GeneID:71562 MGI:2448704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylformamidase transcript_id : NM_027827.2

name	Birc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59859889 GeneID:11799 MGI:1203517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : baculoviral IAP repeat-containing 5 transcript_id : NM_001012273.1

name	Birc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59859886 GeneID:11799 MGI:1203517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : baculoviral IAP repeat-containing 5 transcript_id : NM_009689.2

name	LOC546519 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390957 GeneID:546519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC546519 transcript_id : XM_621267.2

name	Tha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374714 GeneID:71776 MGI:1919026
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonine aldolase 1 transcript_id : NM_027919.2

name	Socs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982458 GeneID:12702 MGI:1201791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of cytokine signaling 3 transcript_id : NM_007707.2

name	Pgs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367139 GeneID:74451 MGI:1921701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylglycerophosphate synthase 1 transcript_id : NM_133757.2

name	Dnahc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262521 GeneID:69926 MGI:1917176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins product : dynein, axonemal, heavy chain 17 transcript_id : XM_126677.7

name	Pscd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543515 GeneID:19157 MGI:1334257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology, Sec7 and coiled-coil domains 1 transcript_id : NM_011180.2

name	Usp36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390967 GeneID:72344 MGI:1919594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 107 ESTs, 3 Proteins product : ubiquitin specific peptidase 36, transcript variant 1 transcript_id : XM_126772.6

name	Timp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61835847 GeneID:21858 MGI:98753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue inhibitor of metalloproteinase 2 transcript_id : NM_011594.3

name	Ddc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946811 GeneID:58251 MGI:1929713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific protein, Ddc8 transcript_id : NM_021440.1

name	Lgals3bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130236 GeneID:19039 MGI:99554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactoside-binding, soluble, 3 binding protein transcript_id : NM_011150.2

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043963 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_001025618.1

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043971 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_001025617.1

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043950 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_029502.2

name	C1qtnf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892163 GeneID:56745 MGI:1919254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1q and tumor necrosis factor related protein 1 transcript_id : NM_019959.2

name	D230014K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369815 GeneID:217364 MGI:2443788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230014K01 gene transcript_id : NM_172573.1

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677494 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001039168.1

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677498 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001024931.2

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677496 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001039167.1

name	Ube2o (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50234896 CCDS:CCDS25670.1 GeneID:217342 MGI:2444266
definition	GO_function : GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] codon_start : 1 note : ubiquitinating enzyme E2-230 kDa product : ubiquitin-conjugating enzyme E2O protein_id : NP_776116.2

name	Aanat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752938 CCDS:CCDS25671.1 GeneID:11298 MGI:1328365
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004059 - aralkylamine N-acetyltransferase activity [Evidence IEA]; GO:0004060 - arylamine N-acetyltransferase activity [Evidence IEA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : arylalkylamine N-acetyltransferase protein_id : NP_033721.1

name	Rhbdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369806 CCDS:CCDS25672.1 GeneID:217344 MGI:2442473
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : rhomboid, veinlet-like 6 product : rhomboid-like protein 6 protein_id : NP_766160.1

name	Cygb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549320 CCDS:CCDS25673.1 GeneID:114886 MGI:2149481
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] [Evidence ISS]; GO:0004601 - peroxidase activity [Evidence ISS] GO_process : GO:0015671 - oxygen transport [Evidence IEA] [Evidence ISS]; GO:0006979 - response to oxidative stress [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : histoglobin; stellate cell activation associated protein product : cytoglobin protein_id : NP_084482.1

name	OTTMUSG00000003947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262517 GeneID:100038570 MGI:3649529
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477403.1

name	St6galnac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543707 GeneID:20446 MGI:107553
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : Gal-beta-1,3-GalNAc alpha-2,6-sialyltransferase; alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase II; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase B; ST6GalNAc II; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase) B; sialytransferase; ST6 neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 product : sialyltransferase 7B protein_id : NP_033206.2

name	St6galnac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116572 GeneID:20445 MGI:1341826
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence TAS]; GO:0009312 - oligosaccharide biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : ST6GalNAc I; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase) A; GalNAc alpha-2,6-sialyltransferase I product : sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl galactosaminde alpha-2,6-sialyltransferase A protein_id : NP_035501.2

name	Mxra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037101 CCDS:CCDS25677.1 GeneID:67622 MGI:1914872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : matrix-remodelling associated 7 protein_id : NP_080556.1

name	Jmjd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125988379 CCDS:CCDS25678.1 GeneID:107817 MGI:1858910
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IMP] codon_start : 1 note : apoptotic cell clearance receptor PtdSerR product : phosphatidylserine receptor protein_id : NP_203971.2

name	1110005A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980786 CCDS:CCDS25679.1 GeneID:74319 MGI:1921569
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74319 protein_id : NP_083141.2

name	LOC100043293 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262573 GeneID:100043293
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480624.1

name	Sfrs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755478 CCDS:CCDS25680.1 GeneID:20382 MGI:98284
definition	GO_component : GO:0016607 - nuclear speck [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005681 - spliceosome complex [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0006376 - mRNA splice site selection [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : splicing factor Sc35; myelin regulatory factor 1 product : splicing factor, arginine/serine-rich 2 protein_id : NP_035488.1

name	Mfsd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519955 CCDS:CCDS25681.1 GeneID:69900 MGI:1917150
definition	codon_start : 1 product : major facilitator superfamily domain containing 11 protein_id : NP_848735.1

name	Mgat5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476097 CCDS:CCDS25682.1 GeneID:268510 MGI:3606200
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : beta1,6-N-acetylglucosaminyltransferase IX (GnT-IX); UDP-N-acetylglucosamine: alpha1,6-D-mannoside beta1,6-N-acetylglucosaminyltransferase b product : beta1,6-N-acetylglucosaminyltransferase IX protein_id : NP_766536.2

name	LOC100042036 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262520 GeneID:100042036
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477492.1

name	Sec14l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311923 CCDS:CCDS25683.1 GeneID:74136 MGI:1921386
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SEC14-like 1 protein_id : NP_083053.1

name	Sept9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393784 CCDS:CCDS25684.1 GeneID:53860 MGI:1858222
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 function : putative proto-oncogene note : MLL septin-like fusion; SL3-3 integration site 1 product : septin 9 protein_id : NP_059076.1

name	Tnrc6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378035 GeneID:217351 MGI:2443265
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : trinucleotide repeat containing 6C protein_id : NP_932139.2

name	Tmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32441274 CCDS:CCDS25687.1 GeneID:217353 MGI:1098686
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; transmembrane channel-like protein 6 product : transmembrane channel-like protein 6 isoform 1 protein_id : NP_663414.2

name	Tmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044457 CCDS:CCDS25688.1 GeneID:217353 MGI:1098686
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transmembrane channel-like protein 6 product : transmembrane channel-like protein 6 isoform 2 protein_id : NP_851838.1

name	Tmc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469503 CCDS:CCDS25689.1 GeneID:217356 MGI:2669037
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane channel-like gene family 8 product : epidermodysplasia verruciformis 2 protein_id : NP_862904.1

name	6030468B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20913795 GeneID:77727 MGI:1924977
definition	codon_start : 1 product : hypothetical protein LOC77727 protein_id : XP_126537.1

name	Syngr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106429 CCDS:CCDS25691.1 GeneID:20973 MGI:1328324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 product : synaptogyrin 2 protein_id : NP_033330.1

name	Tk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678357 CCDS:CCDS25692.1 GeneID:21877 MGI:98763
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004797 - thymidine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 exception : mismatches in translation product : thymidine kinase 1 protein_id : NP_033413.1

name	Afmid (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746157 CCDS:CCDS25693.1 GeneID:71562 MGI:2448704
definition	EC_number : 3.5.1.9 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004061 - arylformamidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006569 - tryptophan catabolism [Evidence IEA]; GO:0019441 - tryptophan catabolism to kynurenine [Evidence IDA] codon_start : 1 note : fFormylkynureninase; formylkynureninase product : kynurenine formamidase protein_id : NP_082103.1

name	Birc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753090 CCDS:CCDS25694.1 GeneID:11799 MGI:1203517
definition	GO_component : GO:0005814 - centriole [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005881 - cytoplasmic microtubule [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0031021 - interphase microtubule organizing center [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0030496 - midbody [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0048037 - cofactor binding [Evidence ISS]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS] [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0051303 - establishment of chromosome localization [Evidence ISS]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007067 - mitosis [Evidence IEA]; GO:0043154 - negative regulation of caspase activity [Evidence ISS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence ISS]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence ISS]; GO:0031503 - protein complex localization [Evidence ISS]; GO:0031577 - spindle checkpoint [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; survivin; apoptosis inhibitor 4 product : baculoviral IAP repeat-containing 5 isoform 1 protein_id : NP_033819.1

name	Birc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59859890 CCDS:CCDS25695.1 GeneID:11799 MGI:1203517
definition	GO_component : GO:0005814 - centriole [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005881 - cytoplasmic microtubule [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0031021 - interphase microtubule organizing center [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0030496 - midbody [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0048037 - cofactor binding [Evidence ISS]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS] [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0051303 - establishment of chromosome localization [Evidence ISS]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007067 - mitosis [Evidence IEA]; GO:0043154 - negative regulation of caspase activity [Evidence ISS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence ISS]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence ISS]; GO:0031503 - protein complex localization [Evidence ISS]; GO:0031577 - spindle checkpoint [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; survivin; apoptosis inhibitor 4 product : baculoviral IAP repeat-containing 5 isoform 3 protein_id : NP_001012273.1

name	LOC546519 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390958 GeneID:546519
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621267.2

name	Tha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229133 GeneID:71776 MGI:1919026
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : threonine aldolase 1 protein_id : NP_082195.1

name	Socs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671758 CCDS:CCDS25697.1 GeneID:12702 MGI:1201791
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence IDA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : cytokine inducible SH2-containing protein 3; STAT-induced STAT inhibitor 3; cytokine-inducible SH2 protein 3; E2a-Pbx1 target gene in fibroblasts 10 product : suppressor of cytokine signaling 3 protein_id : NP_031733.1

name	Pgs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626163 CCDS:CCDS25698.1 GeneID:74451 MGI:1921701
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008444 - CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity [Evidence ISS] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence ISS] codon_start : 1 product : silencer-associated factor protein_id : NP_598518.1

name	Dnahc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262522 GeneID:69926 MGI:1917176
definition	codon_start : 1 note : overriding stop codons product : similar to hCG1813078 protein_id : XP_126677.7 transl_except : (pos:complement(117887371..117887373),aa:OTHER)

name	Pscd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543516 GeneID:19157 MGI:1334257
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 note : cytohesin 1 product : pleckstrin homology, Sec7 and coiled-coil domains 1 protein_id : NP_035310.2

name	Usp36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390968 GeneID:72344 MGI:1919594
definition	codon_start : 1 product : ubiquitin specific protease 36 isoform 1 protein_id : XP_126772.5

name	Timp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543867 CCDS:CCDS25699.1 GeneID:21858 MGI:98753
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0009986 - cell surface [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IMP]; GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0005178 - integrin binding [Evidence IDA]; GO:0008191 - metalloendopeptidase inhibitor activity [Evidence TAS] [Evidence IMP] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0030814 - regulation of cAMP metabolism [Evidence IDA]; GO:0043408 - regulation of MAPKKK cascade [Evidence IDA]; GO:0045664 - regulation of neuron differentiation [Evidence IDA] [Evidence IMP] codon_start : 1 product : tissue inhibitor of metalloproteinase 2 protein_id : NP_035724.2

name	Ddc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946812 CCDS:CCDS25700.1 GeneID:58251 MGI:1929713
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : testis-specific protein DDC8 product : testis specific protein, Ddc8 protein_id : NP_067415.1

name	Lgals3bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755144 CCDS:CCDS25701.1 GeneID:19039 MGI:99554
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence ISS] [Evidence TAS] codon_start : 1 note : peptidylprolyl isomerase C-associated protein; mama product : lectin, galactoside-binding, soluble, 3 binding protein protein_id : NP_035280.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043972 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_001020788.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043964 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_001020789.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043951 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_083778.2

name	C1qtnf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910610 CCDS:CCDS25703.1 GeneID:56745 MGI:1919254
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : putative secreted protein ZSIG37; mouse ortholog product : C1q and tumor necrosis factor related protein 1 protein_id : NP_064343.1

name	D230014K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369816 CCDS:CCDS25704.1 GeneID:217364 MGI:2443788
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217364 protein_id : NP_766161.1

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677499 CCDS:CCDS25705.1 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 3 protein_id : NP_001020102.2

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677495 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 2 protein_id : NP_001034257.1

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677497 CCDS:CCDS25706.1 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 1 protein_id : NP_001034256.1

name	1810032O08Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262518 GeneID:66293 MGI:1913543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA 1810032O08 gene transcript_id : XR_035342.1

name	LOC634720 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262571 GeneID:634720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 5 Proteins product : similar to alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase pseudo : _no_value transcript_id : XR_034744.1

name	BC018473 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:126090534 GeneID:193217 MGI:3039625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018473 transcript_id : NR_003364.1

name	EG667423 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94390955 GeneID:667423 MGI:3646811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 715 ESTs, 6 Proteins product : predicted gene, EG667423 pseudo : _no_value transcript_id : XR_002024.1

clone name	MSMg01-530O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485E05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145L08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-264P14.b	B6Ng01-264P14.g
ACC	GA068744	GA068745
length	1,129	1,110
definition	B6Ng01-264P14.b	B6Ng01-264P14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(117,412,863 - 117,413,987)	(117,508,534 - 117,509,644)
sequence	gaattcccaatgtgttcttggccagctgtgtgcactagtcacaagagatt ccctgggagtgacagtagagaggtcttataggataacagagactaggcca cccttgatgcttcatcaatgcacggggcctcacacgatctgtgaagaata cctgttcccacccatcagagagcacacctgcaggggctctcgtgagctca ggtgtgatcagagtctgttgctgcagcctgagcccgttagtccaggaaag ccactcccaacctgtcaacacatgtactgtagagtcctacatcgagcagg tttctgctgattggggtgggggtggcaggttctgggaacagtggggatgc ccaagagccaggccagacgctatggacatgatttctgaggctcagtgagg caggaagagggcaacagaaaggaagcctgagtaagggagttgcagagaag actgaactgggtggcaccaccatttcctcctggctggaccccagggtctg aagtgcccagggcagccagagcaggccatctcctgcctcccaccaatggt ttccaggaaaggctcagttgtcatggcaacatccatccaattactccact tttgcagaaatcacctaccagccaagttggctggaactcaccccttctaa agaacaagtcctccgcttgaagtttggcctcgctgtggccaagcgtgtga agcgagaagtggagaggcgggttgggcacatgggccacaagagagatggt cacagaggcagaggctataaccaagggacaatggctagccttcacaaacc agagacaggcggagagctggatcctgcaagggtgctaaaggataggcaag ttaggaaagggattctatgtgaatagctttgctgaggacagggctggtca ctgagaaggctgaggtgcccgtgaagtcttcctagagggtgcggagttca gaaggaagtggcttggccaattggtcatttactgaaagtaacaaagttgg agattggcctgtattgtgattatacacttaggagggttgggcagcccaac caaggagggcggtgctcctgtgcatggtgtctggagtgacagggtgtcaa ggtaaagattcgtttgatgagtacagtca	gaattcagattcatcctcagctacacagtgagggcttggccagcctgtgg gcgatgcgtaaaattgtctcagtaaactaaacacagcgctggacagatgg ctcagcagttaacagcactagctgctcttccaaaagacccaggactgatc ccagcatccacatgatggttcacagccatctgtaacttcagctacaaatc ccatgccttcttctggtctccataggtaccaggacatatgtagtgcacaa atttccaggcaaaactcgacacacatcatgtaatgaaaggtaaacaaaac agagtcaaacagagctgctggaagtgaaggggtatgtgtcaggcagcagg gcaggagcggggtactgggctccgcagggatggcagttcgggtgacaagc agatttctgaagccgtttgcagaatgagacctgtttgacctcaaacactc agagcttcagctcttcctggaagcaataggatggctaatgagaggaataa ggctagaaacctcactggcttgttgcagctgcccaggccctaccttcaag cagttgatggtctgggaatttggagcaggttaaccaagagcccgtcatca cactgtgtgccagtcttctgagtgtgtgtgccgcattaccaccaccaggg acaggtcttgcccttagaccacctatgttcctccctagaatgcagtctta gggttttactgctgtgaacagacaccatgaccaaggcaactcttataagg atgataattggggctggcttgcaggtttggaggttcattccattatcatt aaggcaggaacataatggcctccaggtaggcatggtacaggaggagctga gagttctacatcttcatctgaaggctgctagcagactactgccttccagg cagctagaatgagggtcttaaagcccacgcccacagtgacacacccactc caacaaggcacacttctaatagtgccattccccgtgctgagcacatacaa acatcacaactgcagtctttgtttttggaacatactggagatctgccttg caggaaccagtcctcaagtgcagttatccttttgagaagagattgccgat ttgcctgagg
quality values	Open. Hide. 46 16 25 39 54 46 34 28 31 40 62 62 38 46 62 62 62 37 46 62 49 62 47 44 56 62 62 62 56 62 27 34 34 19 22 21 20 18 28 24 30 62 59 62 59 62 59 59 59 62 62 62 62 54 54 54 62 54 54 62 62 59 62 59 62 59 62 62 62 59 62 62 62 62 62 54 42 56 59 46 45 49 54 59 59 62 62 59 56 62 49 59 59 62 59 56 62 62 59 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 54 54 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 56 62 59 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 41 46 58 54 54 58 58 58 58 58 58 58 58 54 52 54 58 58 58 52 49 58 54 58 58 58 48 58 58 58 54 58 52 58 58 58 54 54 54 58 52 58 58 54 52 58 54 45 25 44 54 58 47 58 58 58 45 35 54 58 58 58 58 58 54 52 50 58 58 40 49 58 51 49 58 53 53 58 47 34 51 58 54 50 58 48 58 51 49 42 38 51 46 45 50 48 29 49 58 50 46 58 58 46 48 58 51 50 46 58 44 42 58 50 37 35 58 47 52 58 58 41 58 58 50 58 46 49 50 58 49 39 46 46 54 58 37 28 58 58 58 36 54 51 51 40 49 38 53 50 39 46 32 51 51 50 51 54 53 58 58 35 44 37 51 53 58 58 34 53 53 54 46 27 36 24 35 32 49 54 54 37 46 40 54 51 49 52 51 33 47 49 54 40 54 40 25 42 37 39 41 54 31 47 14 23 19 39 50 32 37 40 37 33 35 46 21 40 42 33 37 54 19 49 45 53 37 40 32 34 22 22 19 38 18 54 44 31 31 36 40 31 54 37 33 40 32 24 40 45 52 53 35 34 32 31 21 24 42 21 28 32 37 18 32 34 27 23 51 30 47 21 51 21 35 21 31 37 33 26 14 30 42 31 34 27 37 7 20 8 51 33 31 38 39 36 31 42 22 24 19 30 11 9 16 33 29 30 14 8 25 19 20 13 32 25 36 32 30 46 24 17 12 22 31 34 32 31 34 27 18 25 24 11 19 23 30 31 46 31 29 31 31 16 27 26 31 30 16 11 14 41 23 10 31 37 21 14 26 32 31 31 31 39 23 31 42 9 25 13 31 14 35 14 23 23 36 31 44 24 13 10 13 21 32 17 31 25 31 8 7 33 32 33 16 31 14 41 31 17 22 31 31 22 9 6 15 7 31 8 6 11 15 10 31 13 15 14 7 13 33 10 17 13 22 24 9 29 13 11 32 24 25 19 22 33 31 32 39 32 27 31 31 12 17 34 13 8 16 26 10 19 11 19 7 4 7 6 25 7 8 4 25 5 11 15 9 6 7 6 14 23 17 28 15 25 11 12 7 6 5 5 4 12 10 6 7 3 9 15 5 18 21 5 28 12 16 16 8 27 6 15 27 10 13 28 12 10 11 11 9 6 9 24 8 7 5 29 3 4 10 4 3 6 12 16 8 5 6 11 3 2 3 4 1 2 4 6 12 12 13 5 7 5 4 1 4 4 6 16 12 11 18 22 5 17 3 5 4 4 4 3 3 8 4 16 5 6 5 6 11 19 8 23 20 10 18 20 12 18 9 10 5 18 5 6 11 5 6	Open. Hide. 46 35 56 47 62 44 41 56 62 54 42 44 22 28 32 45 50 24 24 27 45 59 59 62 62 62 59 59 59 54 54 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 54 54 62 62 59 62 62 62 56 59 56 48 54 54 62 62 62 62 62 54 62 59 48 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 59 54 54 59 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 42 49 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 43 35 62 62 62 62 62 62 62 62 62 46 37 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 54 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 49 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 31 58 58 58 58 58 58 54 58 58 54 58 58 58 58 49 58 58 58 58 54 58 58 58 58 52 58 58 58 58 58 54 48 44 58 58 58 58 58 54 58 58 58 58 54 52 58 58 58 58 52 58 58 58 54 49 58 54 52 58 58 58 58 58 58 37 42 58 58 58 58 58 52 58 54 49 58 54 51 51 53 45 42 51 58 54 58 50 58 58 58 58 58 53 49 51 58 52 53 53 58 47 58 46 51 58 58 51 49 49 51 51 58 51 58 53 58 58 58 48 49 58 52 58 53 58 51 58 50 58 49 50 50 58 51 53 39 58 50 58 51 50 58 51 49 54 58 58 28 40 40 58 58 51 52 53 52 51 43 43 44 51 51 41 39 39 24 49 41 58 52 53 53 52 51 41 50 44 44 50 34 58 51 47 53 52 54 52 32 53 39 52 39 52 53 52 52 52 34 54 50 31 54 49 22 35 52 45 54 42 53 51 42 39 47 41 45 52 42 52 39 41 54 39 37 52 47 51 42 46 37 47 12 54 28 31 35 33 53 52 53 53 42 40 33 33 22 46 24 30 42 41 40 37 40 37 51 44 54 54 51 45 37 32 51 31 35 12 32 32 32 8 32 24 53 53 41 35 41 21 44 20 33 32 28 32 41 20 9 14 51 33 27 32 43 27 20 31 34 31 13 51 22 31 18 33 19 32 31 31 29 21 21 30 51 51 41 31 42 33 26 31 31 36 27 32 31 37 28 34 31 31 28 12 26 32 34 17 46 28 10 42 31 21 34 42 31 35 9 33 18 26 42 32 36 14 16 23 32 31 21 34 30 24 34 23 31 31 27 27 10 39 24 36 32 31 31 33 23 36 31 13 27 18 30 32 22 16 31 24 41 31 31 28 24 24 30 27 30 26 31 38 34 32 22 31 31 25 25 24 21 48 27 26 34 20 25 18 44 25 20 31 36 31 27 26 11 33 41 31 18 26 20 21 21 34 31 19 9 30 13 27 48 30 20 21 31 13 10 15 10 24 9 15 24 17 24 12 16 12 25 6 7 24 8 24 14 27 21 27 17 26 11 21 9 18 12 28 43 43 21 12 14 25 24 28 16 15 11 15 18 20 7 7 7 9 15 34 7 16 9 25 19 11 10 13 9 20 6 9 7 14 24 28 11 20 30 27 17 7 28 34 28 13 7 11 11 10 11 5 14 11 28 9 14 5 6 6 22 10 6 5 6 13 23 4 4 5 8 12 9 9 6 12 5 14 6 3 1 3 5 14 9 7 20 5 6 5 7 5 12 13 7 6 18 13 8 9 17 26 16 4 4 3 3 16 8 13 8 24 4 5 24 4 6 5 22 10 22 9 12 6 4 6 6 12 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_117412863_117413987
seq2: B6Ng01-264P14.b_48_1176

seq1  GAATTCCCAATGTGTTCTTGGCCAGCTGTGTGCACTAGTCACAAGAGATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAATGTGTTCTTGGCCAGCTGTGTGCACTAGTCACAAGAGATT  50

seq1  CCCTGGGAGTGACAGTAGAGAGGTCTTATAGGATAACAGAGACTAGGCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGGGAGTGACAGTAGAGAGGTCTTATAGGATAACAGAGACTAGGCCA  100

seq1  CCCTTGATGCTTCATCAATGCACGGGGCCTCACACGATCTGTGAAGAATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTGATGCTTCATCAATGCACGGGGCCTCACACGATCTGTGAAGAATA  150

seq1  CCTGTTCCCACCCATCAGAGAGCACACCTGCAGGGGCTCTCGTGAGCTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTTCCCACCCATCAGAGAGCACACCTGCAGGGGCTCTCGTGAGCTCA  200

seq1  GGTGTGATCAGAGTCTGTTGCTGCAGCCTGAGCCCGTTAGTCCAGGAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTGATCAGAGTCTGTTGCTGCAGCCTGAGCCCGTTAGTCCAGGAAAG  250

seq1  CCACTCCCAACCTGTCAACACATGTACTGTAGAGTCCTACATCGAGCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTCCCAACCTGTCAACACATGTACTGTAGAGTCCTACATCGAGCAGG  300

seq1  TTTCTGCTGATTGGGGTGGGGGTGGCAGGTTCTGGGAACAGTGGGGATGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGCTGATTGGGGTGGGGGTGGCAGGTTCTGGGAACAGTGGGGATGC  350

seq1  CCAAGAGCCAGGCCAGACGCTATGGACATGATTTCTGAGGCTCAGTGAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGAGCCAGGCCAGACGCTATGGACATGATTTCTGAGGCTCAGTGAGG  400

seq1  CAGGAAGAGGGCAACAGAAAGGAAGCCTGAGTAAGGGAGTTGCAGAGAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAGAGGGCAACAGAAAGGAAGCCTGAGTAAGGGAGTTGCAGAGAAG  450

seq1  ACTGAACTGGGTGGCACCACCATTTCCTCCTGGCTGGACCCCAGGGTCTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAACTGGGTGGCACCACCATTTCCTCCTGGCTGGACCCCAGGGTCTG  500

seq1  AAGTGCCCAGGGCAGCCAGAGCAGGCCATCTCCTGCCTCCCACCAATGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGCCCAGGGCAGCCAGAGCAGGCCATCTCCTGCCTCCCACCAATGGT  550

seq1  TTCCAGGAAAGGCTCAGTTGTCATGGCAACATCCATCCAATTACTCCACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGGAAAGGCTCAGTTGTCATGGCAACATCCATCCAATTACTCCACT  600

seq1  TTTGCAGAAATCACCTACCAGCCAAGTTGGCTGGAACTCACCCCTTCTAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCAGAAATCACCTACCAGCCAAGTTGGCTGGAACTCACCCCTTCTAA  650

seq1  AGAACAAGTCCTCCGCTTGAAGTTTGGCCTCGCTGTGGCCAAGCGTGTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACAAGTCCTCCGCTTGAAGTTTGGCCTCGCTGTGGCCAAGCGTGTGA  700

seq1  AGCGAGAAGTGGAGAGGCGGGTTGGGCACATGGGCCACAAGAGAGATGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGAGAAGTGGAGAGGCGGGTTGGGCACATGGGCCACAAGAGAGATGGT  750

seq1  CACAGAGGCAGAGGCTATAACCAAGGGACAATGGCTAGCCTTCACAAACC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGAGGCAGAGGCTATAACCAAGGGACAATGGCTAGCCTTCACAAACC  800

seq1  AGAGACAGGCGGAGAGCTGGATCCTGCCAAGGTGCTAAAGGATAGGCAAG  850
      ||||||||||||||||||||||||||| | ||||||||||||||||||||
seq2  AGAGACAGGCGGAGAGCTGGATCCTGCAAGGGTGCTAAAGGATAGGCAAG  850

seq1  TTAGGAAAGGGATTCTATGTGAAATAGCTTTGCTGAGGACAGGGCTGGTC  900
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  TTAGGAAAGGGATTCTATGTG-AATAGCTTTGCTGAGGACAGGGCTGGTC  899

seq1  ACTGAGAAGGCTGAGGTGCCCGTGAAGTCTTCCTAGAGGGTGCGGAGTCC  950
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ACTGAGAAGGCTGAGGTGCCCGTGAAGTCTTCCTAGAGGGTGCGGAGTTC  949

seq1  AGAAGGAAGTGGC-TGGCCAATTGGTCATTTACTGAAAGTAACAAAAGTG  999
      ||||||||||||| ||||||||||||||||||||||||||||||||  ||
seq2  AGAAGGAAGTGGCTTGGCCAATTGGTCATTTACTGAAAGTAACAAAGTTG  999

seq1  GAGAATGG-CTGTATTGTGA-TATACACATAGGAGG--TTGGCAAGCCAA  1045
      |||| ||| ||||||||||| ||||||| |||||||  | ||||  ||||
seq2  GAGATTGGCCTGTATTGTGATTATACACTTAGGAGGGTTGGGCAGCCCAA  1049

seq1  CCAAGGAGGGCGGGTGCT-CTGGGCAGAGGTGTCCTGAGTGACA-GGTGG  1093
      ||||||||||| |||||| ||| |||  ||||||  |||||||| |||| 
seq2  CCAAGGAGGGC-GGTGCTCCTGTGCA-TGGTGTCTGGAGTGACAGGGTGT  1097

seq1  CCAGTAGAAGA-TCGGTTGATTGAGTACAGTCA  1125
      | ||   |||| ||| |||| ||||||||||||
seq2  CAAGGTAAAGATTCGTTTGA-TGAGTACAGTCA  1129

seq1: chr11_117508534_117509644
seq2: B6Ng01-264P14.g_68_1177 (reverse)

seq1  CCTCA-GCAAATC-GCCATCTCTTCTCAAAAGGATACTGGCACTTGAGGC  48
      ||||| ||||||| || |||||||||||||||||||   |||||||||| 
seq2  CCTCAGGCAAATCGGCAATCTCTTCTCAAAAGGATAACTGCACTTGAGGA  50

seq1  CTGGTTCCTGCAGGGCAGATCT-CAGTAATGGTTCCAAAACAAAGACTGC  97
      |||||||||||| ||||||||| |||| ||| | | ||||||||||||||
seq2  CTGGTTCCTGCAAGGCAGATCTCCAGT-ATGTTCCAAAAACAAAGACTGC  99

seq1  AGTTGTGATGGTTTGTATGTGCTCAGCACGGGGAATGGCACTATTAGGAG  147
      ||||||||| |||||||||||||||||||||||||||||||||||| || 
seq2  AGTTGTGAT-GTTTGTATGTGCTCAGCACGGGGAATGGCACTATTA-GAA  147

seq1  GTGTGGCCTTGTTGGAGTGGGTGTGTCACTGTGGGCGTGGGCTTTAAGAC  197
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGT-GCCTTGTTGGAGTGGGTGTGTCACTGTGGGCGTGGGCTTTAAGAC  196

seq1  CCTCATTCTAGCTGCCTGGAAGGCAGTAGTCTGCTAGCAGCCTTCAGATG  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCATTCTAGCTGCCTGGAAGGCAGTAGTCTGCTAGCAGCCTTCAGATG  246

seq1  AAGATGTAGAACTCTCAGCTCCTCCTGTACCATGCCTACCTGGAGGCCAT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATGTAGAACTCTCAGCTCCTCCTGTACCATGCCTACCTGGAGGCCAT  296

seq1  TATGTTCCTGCCTTAATGATAATGGAATGAACCTCCAAACCTGCAAGCCA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTTCCTGCCTTAATGATAATGGAATGAACCTCCAAACCTGCAAGCCA  346

seq1  GCCCCAATTATCATCCTTATAAGAGTTGCCTTGGTCATGGTGTCTGTTCA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCAATTATCATCCTTATAAGAGTTGCCTTGGTCATGGTGTCTGTTCA  396

seq1  CAGCAGTAAAACCCTAAGACTGCATTCTAGGGAGGAACATAGGTGGTCTA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGTAAAACCCTAAGACTGCATTCTAGGGAGGAACATAGGTGGTCTA  446

seq1  AGGGCAAGACCTGTCCCTGGTGGTGGTAATGCGGCACACACACTCAGAAG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCAAGACCTGTCCCTGGTGGTGGTAATGCGGCACACACACTCAGAAG  496

seq1  ACTGGCACACAGTGTGATGACGGGCTCTTGGTTAACCTGCTCCAAATTCC  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGCACACAGTGTGATGACGGGCTCTTGGTTAACCTGCTCCAAATTCC  546

seq1  CAGACCATCAACTGCTTGAAGGTAGGGCCTGGGCAGCTGCAACAAGCCAG  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACCATCAACTGCTTGAAGGTAGGGCCTGGGCAGCTGCAACAAGCCAG  596

seq1  TGAGGTTTCTAGCCTTATTCCTCTCATTAGCCATCCTATTGCTTCCAGGA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGTTTCTAGCCTTATTCCTCTCATTAGCCATCCTATTGCTTCCAGGA  646

seq1  AGAGCTGAAGCTCTGAGTGTTTGAGGTCAAACAGGTCTCATTCTGCAAAC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTGAAGCTCTGAGTGTTTGAGGTCAAACAGGTCTCATTCTGCAAAC  696

seq1  GGCTTCAGAAATCTGCTTGTCACCCGAACTGCCATCCCTGCGGAGCCCAG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCAGAAATCTGCTTGTCACCCGAACTGCCATCCCTGCGGAGCCCAG  746

seq1  TACCCCGCTCCTGCCCTGCTGCCTGACACATACCCCTTCACTTCCAGCAG  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCCGCTCCTGCCCTGCTGCCTGACACATACCCCTTCACTTCCAGCAG  796

seq1  CTCTGTTTGACTCTGTTTTGTTTACCTTTCATTACATGATGTGTGTCGAG  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTTTGACTCTGTTTTGTTTACCTTTCATTACATGATGTGTGTCGAG  846

seq1  TTTTGCCTGGAAATTTGTGCACTACATATGTCCTGGTACCTATGGAGACC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGCCTGGAAATTTGTGCACTACATATGTCCTGGTACCTATGGAGACC  896

seq1  AGAAGAAGGCATGGGATTTGTAGCTGAAGTTACAGATGGCTGTGAACCAT  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAAGGCATGGGATTTGTAGCTGAAGTTACAGATGGCTGTGAACCAT  946

seq1  CATGTGGATGCTGGGATCAGTCCTGGGTCTTTTGGAAGAGCAGCTAGTGC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGGATGCTGGGATCAGTCCTGGGTCTTTTGGAAGAGCAGCTAGTGC  996

seq1  TGTTAACTGCTGAGCCATCTGTCCAGCGCTGTGTTTAGTTTACTGAGACA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAACTGCTGAGCCATCTGTCCAGCGCTGTGTTTAGTTTACTGAGACA  1046

seq1  ATTTTACGCATCGCCCACAGGCTGGCCAAGCCCTCACTGTGTAGCTGAGG  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTACGCATCGCCCACAGGCTGGCCAAGCCCTCACTGTGTAGCTGAGG  1096

seq1  ATGAATCTGAATTC  1111
      ||||||||||||||
seq2  ATGAATCTGAATTC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information